1. Microbiology and Infectious Disease
  2. Structural Biology and Molecular Biophysics
Download icon

A contractile injection system stimulates tubeworm metamorphosis by translocating a proteinaceous effector

  1. Charles F Ericson
  2. Fabian Eisenstein
  3. João M Medeiros
  4. Kyle E Malter
  5. Giselle S Cavalcanti
  6. Robert W Zeller
  7. Dianne K Newman
  8. Martin Pilhofer  Is a corresponding author
  9. Nicholas J Shikuma  Is a corresponding author
  1. San Diego State University, United States
  2. Institute of Molecular Biology and Biophysics, Eidgenössische Technische Hochschule, Switzerland
  3. California Institute of Technology, United States
Short Report
Cite this article as: eLife 2019;8:e46845 doi: 10.7554/eLife.46845
4 figures, 2 tables, 2 data sets and 1 additional file

Figures

Figure 1 with 4 supplements
Two bacterial genes are important for inducing Hydroides metamorphosis and deletions of these genes produce MACs with an ‘empty’ phenotype.

(A) Metamorphosis (%) assay of Hydroides larvae in response to biofilms of P. luteoviolacea wildtype (WT) and different gene deletion strains. Deletion of JF50_12605 or mif1 (JF50_12615) showed a significant loss in the ability to induce metamorphosis when compared to wildtype. (B) Restoration of JF50_12605 and mif1 (JF50_12615) into their native chromosomal loci restored function. Graphs in (A/B) show an average of biological replicates, where each point represents one biological replicate. *p-value≤0.05, ns = not significant. (C–E) Representative cryotomographic images of the ‘filled’ phenotype from wildtype MACs (C), and ‘empty’ phenotype from ΔJF50_12605 (D), and Δmif1 (E) MACs. Scale bar, 100 nm. (F/G) Shown are representative MAC structures (on left; taken from C/E) and their density plots. The wildtype ‘filled’ phenotype shows a relatively homogeneous density profile across the diameter of the MAC. The Δmif1 ‘empty’ phenotype shows a low-density region in the center of the MAC. (H) Shown is the fraction of empty structures for different deletion mutants as observed by cryoET imaging. Note that the ‘empty’ phenotype correlates with the inability to induce metamorphosis (A).

https://doi.org/10.7554/eLife.46845.003
Figure 1—figure supplement 1
Metamorphic response of Hydroides larvae to cell-free MAC extracts from wild type P. luteoviolacea and individual gene mutants.

(A) Metamorphosis (%) of Hydroides larvae 24 h after exposure to extracted MACs from P. luteoviolacea wildtype (WT) and mutants. MAC extracts were diluted 1:100 before being mixed with larvae. (B) Dose-response curve of MAC extracts from WT (red), ∆macB (blue), ∆JF50_12605 (green), and ∆mif1 (purple) mutants.

https://doi.org/10.7554/eLife.46845.004
Figure 1—figure supplement 2
Wildtype and ΔJF50_12590-12615 have structurally similar arrays.

(A-D) MAC arrays were present in (A/B) wildtype (WT) and (C/D) ΔJF50_12590-12615 MAC extracts. Both strains showed arrays that comprised individual contractile structures in extended and contracted conformations. Shown are cryotomographic slices. Scale bar, 100 nm.

https://doi.org/10.7554/eLife.46845.005
Figure 1—figure supplement 3
‘Filled’ and ‘empty’ phenotypes in all studied gene mutant strains.

(A-F) Shown are cryotomographic slices of representative extended MACs for different strains and the corresponding density plots (plots were calculated from the boxed image region). ‘Empty’ and ‘filled’ phenotypes are characterized by differences in densities in the MAC center (arrowheads indicate low-density region in empty structures). Scale bar, 100 nm.

https://doi.org/10.7554/eLife.46845.006
Figure 1—figure supplement 4
Replacing JF50_12605 and mif1 into their native chromosomal loci generates MACs with filled tubes.

(A–B) When complemented into the native chromosomal loci, (A) JF50_12605 and (B) mif1 assemble wildtype-like MACs with a filled phenotype. Scale bar, 100 nm.

https://doi.org/10.7554/eLife.46845.007
Figure 2 with 2 supplements
MACs from a ∆mif1 mutant lack electron density in the tube lumen.

(A–F) Cross sectional (A/C/E) and longitudinal (B/D/F) slices through subtomogram averages of the MAC sheath-tube complex from wildtype (WT; A–D) and ∆mif1 (E–F). The hexameric sheath and tube modules could be clearly discerned (indicated in C/D). The inner tube lumen displayed clear differences in density between WT and ∆mif1. The wildtype tube lumen was filled with densities that likely represent cargo (A-D, indicated in yellow), which was not present in the ∆mif1 lumen (E/F). Note the low-density region that separates the tube and cargo (indicated by arrowheads in B). (G/H) Shown are isosurfaces of the ∆mif1 structure (gray) and of a difference map (yellow; calculated from the wildtype and ∆mif1 structure), highlighting the additional density in the wildtype tube lumen. Scale bar, 10 nm.

https://doi.org/10.7554/eLife.46845.008
Figure 2—figure supplement 1
Fourier shell correlations.

Fourier shell correlation (FSC) between the two independently aligned and averaged half-datasets for the wildtype (yellow graph, WT) and the ∆mif1 (green graph) MAC subtomogram averages. Resolution estimates are ~17 Å and ~23 Å at the 0.5 threshold for wildtype and ∆mif1, respectively, and ~14 Å and ~18 Å at the 0.143 threshold.

https://doi.org/10.7554/eLife.46845.009
Figure 2—figure supplement 2
Triggered MAC tubes show ‘empty’ phenotype.

Shown is a representative cryotomographic slices of WT MACs. Arrowheads indicate expelled tubes with ‘empty’ phenotype.

https://doi.org/10.7554/eLife.46845.010
Mif1 is present in MAC complexes and JF50_12605 is required for Mif1’s association with the MAC complex.

(A) Mass spectrometry of wildtype MAC arrays detected Mif1 but not JF50_12605. Spectral counts for Mif1 were low for MACs purified from the ∆JF50_12605 mutant, indicating a possible chaperone-like function for JF50_12605. (B) Dot blot of purified MACs from wildtype or strains with Mif1 tagged at amino acid positions 943 [C-terminus] (Mif1-FLAG-943), 555 (Mif1-FLAG-555), and 190 (Mif1-FLAG-190) were probed with anti-FLAG antibody. The signal indicates association of Mif1 with MAC arrays. (C) Co-expression, reciprocal pull-down and western blotting of S-tagged JF50_12605 and 6xHis-tagged Mif1 indicate an interaction between both proteins. Strains in which only one component was tagged were used as controls. (D–F) Quantification of bacterial two-hybrid experiments were used to analyze possible interactions between JF50_12605, Mif1 and tube (MacT1) proteins. Briefly, the two fragments of CyaA (T18/T25) were fused to the respective target proteins with the CyaA activity only being restored by interaction between target proteins. JF50_12605 showed a strong interaction with itself and with Mif1.

https://doi.org/10.7554/eLife.46845.011
Figure 4 with 2 supplements
Mif1 is sufficient for stimulating metamorphosis when delivered by electroporation.

(A) Shown is an SDS page gel of purified Mif1, JF50_12605 and GFP. (B) Western blot of purified Mif1 protein probed with a C-terminal anti-Mif1 peptide antibody confirms Mif1 identity. (C) Metamorphosis (%) of Hydroides larvae 24 hr after electroporation with purified Mif1, JF50_12605 or GFP protein, shows induction of metamorphosis by electroporated Mif1. Graph shows an average of biological replicates, where each point represents one biological replicate. ****p-value≤0.0001 by t-test, ns = not significant.

https://doi.org/10.7554/eLife.46845.012
Figure 4—figure supplement 1
Purified Mif1 is unable to induce metamorphosis when added exogenously.

Metamorphosis (%) of Hydroides larvae after being soaked in 250 ng/μl of purified GFP, JF50_12605, and JF50_12615 protein for 24 h. Wildtype (WT) MACs diluted 1:100 were used as a positive control for larval competence.

https://doi.org/10.7554/eLife.46845.013
Figure 4—figure supplement 2
Quantification of GFP protein associated with larvae after electroporation.

We tested if electroporation results in a higher abundance of protein within tubeworm larvae. To this end, tubeworm larvae were mixed with purified GFP protein (0.625 µg/µl, 50 µg total) and electroporated at 30 V (150 V/cm) at 10 ohms and 3000 µF. As a control, a second treatment of tubeworm larvae mixed with GFP without electroporation was performed. After electroporation, larvae were washed five times to remove unassociated GFP protein. (A) Western blot analysis of larval lysate with and without electroporation resulted in higher recovery of GFP in electroporated larvae (+) when compared to un-electroporated control (-). (B) To normalize protein loading, we visualized the stain-free SDS-PAGE gel. (C/D) To quantify the amount of protein recovered after electroporation, a GFP standard curve was created by performing a Western blot on known GFP concentrations (n = 3). (E) To determine the amount of GFP associated with tubeworm larvae, we quantified GFP with (+) and without (-) electroporation. Values are a mean percent of total GFP electroporated (n = 4 biological replicates, ± SD).

https://doi.org/10.7554/eLife.46845.014

Tables

Table 1
Strains and plasmids used in this work.
https://doi.org/10.7554/eLife.46845.015
Strain no.GenotypeSource or reference
Strain
NJS5HI1 StrRP. luteoviolacea HI1, StrR(Huang et al., 2012)
NJS23macBP. luteoviolacea HI1, StrRmacB(Shikuma et al., 2014)
NJS235∆JF50_12590-F50_12615P. luteoviolacea HI1, StrR ∆R4(Shikuma et al., 2016)
NJS289∆JF50_12590P. luteoviolacea HI1, StrR∆JF50_12590This Study
NJS287∆JF50_12595P. luteoviolacea HI1, StrR∆JF50_12595This Study
NJS285∆JF50_12600P. luteoviolacea HI1, StrR∆JF50_12600This Study
NJS283∆JF50_12605P. luteoviolacea HI1, StrR∆JF50_12605This Study
NJS281∆JF50_12610P. luteoviolacea HI1, StrR∆JF50_12610This Study
NJS279∆JF50_12615P. luteoviolacea HI1, StrR∆JF50_12615This Study
NJS294∆JF50_12605::12605P. luteoviolacea HI1, StrR∆JF50_12605::JF50_12605This Study
NJS295∆JF50_12615::12615P. luteoviolacea HI1, StrR∆JF50_12615::JF50_12615This Study
Plasmid
pNJS007pCVD443AmpR, KmR, sacB, pGP704 derivative(Huang et al., 2012)
pNJS266pCVD443_∆12590pCVD443::∆12590 AmpR, KmRThis Study
pNJS265pCVD443_∆12595pCVD443::∆12595 AmpR, KmRThis Study
pNJS264pCVD443_∆12600pCVD443::∆12600 AmpR, KmRThis Study
pNJS263pCVD443_∆12605pCVD443::∆12605 AmpR, KmRThis Study
pNJS262pCVD443_∆12610pCVD443::∆12610 AmpR, KmRThis Study
pNJS261pCVD443_∆12615pCVD443::∆12615 AmpR, KmRThis Study
pNJS256pCVD443_12590–615 complementAmpR, KmR(Shikuma et al., 2016)
pNJS282pCVD443_12605 complementAmpR, KmRThis Study
pNJS074pCVD443_∆12585AmpR, KmRThis Study
pNJS267pUT18AmpR(Karimova et al., 2000)
pNJS268pUT18CAmpR(Karimova et al., 2000)
pNJS269pKT25KmR(Karimova et al., 2000)
pNJS270pKNT25KmR(Karimova et al., 2000)
pNJS283pUT18_12605AmpRThis Study
pNJS299pUT18_12615AmpRThis Study
pNJS527pUT18_12680AmpRThis Study
pNJS284pKT25_12605KmRThis Study
pNJS285pKT25_12615KmRThis Study
pNJS529pKT25_12680KmRThis Study
pNJS286pKNT25_12605KmRThis Study
pNJS300pKNT25_12615KmRThis Study
pNJS530pKNT25_12680KmRThis Study
pNJS393pET15b_12605AmpRThis Study
pNJS395pET15b_12615AmpRThis Study
pNJS397pET15b_GFPAmpRThis Study
Table 2
Primers used in this work.
https://doi.org/10.7554/eLife.46845.016
PrimerSequence
1556_dATGATGGGTTAAAAAGGATCGATCCTCTAGATTGGAGCAATAAACGGGTTC
1556_dBGTTCATAATTAAACTGCGATCGCAGCCATAAGGCCTCCTTGATA
1556_dCTATCAAGGAGGCCTTATGGCTGCGATCGCAGTTTAATTATGAAC
1556_dDTTTTGAGACACAACGTGAATTCAAAGGGAGAGCTCCGCTTTGGGTACTGGCTTTA
1556_intFCCGAGCAAACGTTATCACAA
1556_intRTCAGCGCTCTCATTATGTGC
1555_dATGATGGGTTAAAAAGGATCGATCCTCTAGACCGAGCAAACGTTATCACAA
1555_dBCCTTGCATGAGGTTAAGAAAGTTTGACGTACCCTTCAGCCATATT
1555_dCAATATGGCTGAAGGGTACGTCAAACTTTCTTAACCTCATGCAAGG
1555_dDTTTTGAGACACAACGTGAATTCAAAGGGAGAGCTCGATGCGGTAACGGTTGTTCT
1555_intFAGCGATTGATGCTGAACAAA
1555_intRACCATCGCATAACCCGTAAC
1554_dATGATGGGTTAAAAAGGATCGATCCTCTAGATACGCCGTCCAGTTAGGACT
1554_dBGTTTGTTAACGTCACGGCAGCTGCATTGCCATTTAAACTCC
1554_dCGGAGTTTAAATGGCAATGCAGCTGCCGTGACGTTAACAAAC
1554_dDTTTTGAGACACAACGTGAATTCAAAGGGAGAGCTCATTGATTGGAAGCGCGATAG
1554_intFTTTATGAGGCACCAACGACA
1554_intRGCCTGTGCCGTTTTATCTGT
1553_dATGATGGGTTAAAAAGGATCGATCCTCTAGAGGCGATCAGTGGAGTGAAGT
1553_dBAATACTTCTTGCTCAGCCCCGCGTGCTTCTTCTGTCATGT
1553_dCACATGACAGAAGAAGCACGCGGGGCTGAGCAAGAAGTATT
1553_dDTTTTGAGACACAACGTGAATTCAAAGGGAGAGCTCTCAGAACCAGCAGTCTCACG
1553_intFCGGGCCTAGAAATCACTCAA
1553_intRTCGACGTCAAATCAGTCGAG
1552_dATGATGGGTTAAAAAGGATCGATCCTCTAGAGAGAGCAAGAAGTGGCGAGT
1552_dBTAGCCTTTTAGTGCCGCTTTTGAGGCGTCCATATCTGACA
1552_dCTGTCAGATATGGACGCCTCAAAAGCGGCACTAAAAGGCTA
1552_dDTTTTGAGACACAACGTGAATTCAAAGGGAGAGCTCTGCTGACCAAGCAGATTGAC
1552_intFGGGCAATTGTTGTGGATTTT
1552_intRTGATCCCAAACCACTTGTGA
1551_dATGATGGGTTAAAAAGGATCGATCCTCTAGAGACTGCTGGTTCTGATTCGAT
1551_dBAACAGATCATTACATTAAAATGAGCCTCTGTTCTTGTTGTTGCATTTCA
1551_dCTGAAATGCAACAACAAGAACAGAGGCTCATTTTAATGTAATGATCTGTT
1551_dDTTTTGAGACACAACGTGAATTCAAAGGGAGAGCTCCTTCTCCATTTTCGCCTTTG
1551_intFCGTTTTCAGTGACCATCACG
1551_intRCGGTGGGCAAAAAGGTATAA
pUT18_605_F1CAGCTATGACCATGATTACGCCAAGCTTGCATGCCATGACAGAAGAAGCACGCGAAAAAA
pUT18_605_R1CTGGCGGCTGAATTCGAGCTCGGTACCCGGGGATCATTCACAAGTGCTAATTGATAAAAT
pUT18_615_F1CAGCTATGACCATGATTACGCCAAGCTTGCATGCCATGCAACAACAAGAACAGGAGCAAG
pUT18_615_R1CTGGCGGCTGAATTCGAGCTCGGTACCCGGGGATCCATTAAAATGAGCCTTTCTTTTTCA
pUT18_680_FCATGATTACGCCAAGCTTGCATGCCATGGCTACTACTAAAGCAGATATCG
pUT18_680_RAATTCGAGCTCGGTACCCGGGGATCATGGAACTCAATCTTGATGTCATCT
pKT_605_F1CCGATTACCTGGCGCGCACGCGGCGGGCTGCAGGGATGACAGAAGAAGCACGCGAAAAAA
pKT_605_R1AACGACGGCCGAATTCTTAGTTACTTAGGTACCCGCTAATTCACAAGTGCTAATTGATAA
pKT_615_F1CCGATTACCTGGCGCGCACGCGGCGGGCTGCAGGGATGCAACAACAAGAACAGGAGCAAG
pKT_615_R1AACGACGGCCGAATTCTTAGTTACTTAGGTACCCGTTACATTAAAATGAGCCTTTCTTTT
pKT_680_F1CCTGGCGCGCACGCGGCGGGCTGCAATGGCTACTACTAAAGCAGATATCG
pKT_680_R1GCCGAATTCTTAGTTACTTAGGTACTTAATGGAACTCAATCTTGATGTCA
pKNT_605_F1CAGCTATGACCATGATTACGCCAAGCTTGCATGCCATGACAGAAGAAGCACGCGAAAAAA
pKNT_605_R1TGATGCGATTGCTGCATGGTCATTGAATTCGAGCTATTCACAAGTGCTAATTGATAAAAT
pKNT_615_F1CAGCTATGACCATGATTACGCCAAGCTTGCATGCCATGCAACAACAAGAACAGGAGCAAG
pKNT_615_R1TGATGCGATTGCTGCATGGTCATTGAATTCGAGCTCATTAAAATGAGCCTTTCTTTTTCA
pKNT_615_F2CATGATTACGCCAAGCTTGCATGCCATGCAACAACAAGAACAGGAGCAAG
pKNT25-680_FCATGATTACGCCAAGCTTGCATGCCATGGCTACTACTAAAGCAGATATCG
pKNT25-680_RGCTGCATGGTCATTGAATTCGAGCTATGGAACTCAATCTTGATGTCATCT
pET15b_605_F1TGCCGCGCGGCAGCCATATGATGACAGAAGAAGCACGCG
pET15b_605_R1GCTTTGTTAGCAGCCGGATCCCTAATTCACAAGTGCTAATT

Data availability

Subtomogram averages were deposited in the Electron Microscopy Data Bank (accession numbers EMD-4730 and EMD-4731).

The following data sets were generated
  1. 1
    Electron Microscopy Data Bank
    1. Eisenstein Fabian
    2. Medeiros Joao
    3. Pilhofer Martin
    (2019)
    ID EMD-4730. Subtomogram average of MAC sheath and inner tube of P. luteoviolacea Mif1 mutant.
  2. 2
    Electron Microscopy Data Bank
    1. Eisenstein Fabian
    2. Medeiros Joao
    3. Pilhofer Martin
    (2019)
    ID EMD-4731. Subtomogram average of MAC sheath and inner tube of wildtype P. luteoviolacea.

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)