TMC1 is an essential component of a leak channel that modulates tonotopy and excitability of auditory hair cells in mice
- Tsinghua University, China
- IDG/McGovern Institute for Brain Research at Tsinghua University, China
- Hong Kong University of Science and Technology, China
Figures
Figure 1
TMC1 mediates a background current in outer hair cells.
(A) Diagram of the recording configuration. The P6 outer hair cells (OHCs, mostly P6 apical-middle OHCs if not specified otherwise) in acutely dissociated cochlea were whole-cell voltage-clamped …
-
Figure 1—source data 1
TMC1 mediates a background current in outer hair cells.
- https://doi.org/10.7554/eLife.47441.003
Figure 2 with 1 supplement
TMC1 but not TMC2 conducts the background current.
(A) Exogenous expression of TMC1 in wild-type OHCs from organotypic P3 cochlear tissue cultured for 1 day in vitro (P3 + 1DIV). EGFP was co-expressed as an indicator. The OHCs were stained to show …
-
Figure 2—source data 1
TMC1 but not TMC2 conducts the background current.
- https://doi.org/10.7554/eLife.47441.006
Figure 2—figure supplement 1
Localization of ectopically expressed TMC2 in OHCs.
(A) Exogenous expression of TMC2 in P3 + 1DIV OHCs. The OHCs were stained to show spatial pattern of TMC2 (by HA antibody, red) and EGFP (by GFP antibody, green). The hair bundle was stained by …
Figure 3 with 1 supplement
TMC1-mediated leak current is not carried by the resting open MET channel.
(A) Representative Im trace showing fluid jet (FJ)-induced open and closed status of MET current and DHS-induced alteration of baseline current. The OHCs were bathed in external solution with 0.3 mM …
-
Figure 3—source data 1
TMC1-mediated leak current is not carried by the resting open MET channel.
- https://doi.org/10.7554/eLife.47441.009
Figure 3—figure supplement 1
Removal of hair bundles disrupts leak current of OHCs.
(A) A photo showing the OHC in recording with hair bundle removed. The circles with white dashed line indicate hair-bundle removed OHCs. (B) Quantification of ILeak recorded in wild-type OHCs with …
-
Figure 3—figure supplement 1—source data 1
Removal of hair bundles disrupts leak current of OHCs.
- https://doi.org/10.7554/eLife.47441.010
Figure 4 with 1 supplement
Amino-acid substitution in TMC1 alters the leak current.
(A) TMC1 with 10 putative transmembrane domains. The six substituted amino acids are highlighted as colored balls in the predicted positions, and the deafness (dn) truncation is at the third …
-
Figure 4—source data 1
Amino-acid substitution in TMC1 alters the leak current.
- https://doi.org/10.7554/eLife.47441.013
Figure 4—figure supplement 1
Cysteine substitution in TMC1 affects the MET current and the leak current.
(A) Plots of amplitude of the background current recorded from Tmc1-knockout OHCs expressing engineered TMCs as indicated, before and after MTSET treatment. (B) Representative trace of Im recording …
-
Figure 4—figure supplement 1—source data 1
Cysteine substitution in TMC1 affects the MET current and the leak current.
- https://doi.org/10.7554/eLife.47441.014
Figure 5
TMC1-mediated leak conductance is antagonized by MET channel blockers.
(A and B) Representative trace (A) and statistical curve (B) of Im inhibition by DHS. A 10 Hz train of 800 nm step deflection was applied to the hair bundle by a glass probe to induce MET currents. …
-
Figure 5—source data 1
TMC1-mediated leak conductance is antagonized by MET channel blockers.
- https://doi.org/10.7554/eLife.47441.016
Figure 6
High-concentration Ca2+ blocks the leak current but not MET current.
(A) Monovalent cations Li+ and Cs+ conducted the leak current. In this experiment, 150 mM NaCl was substituted with 150 mM LiCl or 150 mM CsCl in the external solution. (B) Divalent cations 10 mM Ba2…
-
Figure 6—source data 1
High-concentration Ca2+ blocks the leak current but not MET current.
- https://doi.org/10.7554/eLife.47441.018
Figure 7
IHC excitability is down-regulated in Tmc1-knockout mice.
(A) Representative current-clamp recording in IHCs bathed in external solution with 100 μM DHS from wild-type (black) and Tmc1-knockout (red) mice. For the most part, the IHCs were held at 0 pA. To …
-
Figure 7—source data 1
IHC excitability is down-regulated in Tmc1-knockout mice.
- https://doi.org/10.7554/eLife.47441.020
Figure 8 with 1 supplement
TMC1-mediated leak and MET currents in OHCs.
(A) Diagram showing the tonotopic map in mouse hair cells (adapted from Figure 1B in Kim and Fettiplace, 2013), labeled with response frequencies (kHz, gray) and location (D% to apex, black). The …
-
Figure 8—source data 1
TMC1-mediated leak and MET currents in OHCs.
- https://doi.org/10.7554/eLife.47441.023
Figure 8—figure supplement 1
TMC1-dependent background leak current in ageing hair cells.
(A) Representative Im traces in whole-cell voltage-clamp recorded OHCs from P14 wild-type and Tmc1-knockout mice. (B) Quantification of ILeak recorded from P3, P6, and P14 OHCs under conditions …
-
Figure 8—figure supplement 1—source data 1
TMC1-dependent background leak current in ageing hair cells.
- https://doi.org/10.7554/eLife.47441.024
Figure 9
High Ca2+ removes the MET conductance gradient as revealed by unitary channel analysis.
(A) Location-specific single MET channel recording from wild-type OHCs in solution with 3 mM or 35 mM Ca2+ at D05 or D60. The traces were chosen to show nice dual-peak fitting but did not represent …
-
Figure 9—source data 1
High Ca2+ removes the MET conductance gradient as revealed by unitary channel analysis.
- https://doi.org/10.7554/eLife.47441.026
Author response image 1
Author response image 2
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | TMC1 | NCBI ID: 13409 | ||
| Gene (Mus musculus) | TMC2 | NCBI ID:192140 | ||
| Gene (Mus musculus) | Lhfpl5 | NCBI ID: 328789 | ||
| Strain, strain background (Mus musculus) | C57BL6 | Vitalriver | ||
| Genetic reagent (Mus musculus) | C57BL6 TMC1 knockout | MGI: J:184419 | Griffith AJ etc. | From JAX |
| Genetic reagent (Mus musculus) | C57BL6 TMC2 knockout | MGI: J:184419 | Griffith AJ etc. | From JAX |
| Genetic reagent (Mus musculus) | C57BL6 Lhfpl5 knockout | MGI: J:98396 | Johnson KR etc. | From JAX |
| Antibody | Chicken anti-GFP | aveslab | RRID:AB_10000240 | Cat:GFP-1020 (1:1000) |
| Antibody | Anti-mouse HA Clone 16B12 | Biolegend | RRID:AB_2565335 | Cat:901513 (1:500) |
| Antibody | Alexa FluroTM 488 goat anti-chicken IgG(H+L) | Invitrogen | RRID:AB_142924 | Cat: A-11039 Lot:1937504 (1:2000) |
| Antibody | Alexa FluroTM 568 goat anti-mouse IgG(H+L) | Invitrogen | RRID:AB_2534072 | Cat: A-11004 Lot:2014175 (1:1000) |
| Sequence-based reagent | TMC1-DF-F | Ruibio Tech | This paper | 5’:tgagattaacaacaaggaat tcgtgcgtctcaccgttt |
| Sequence-based reagent | TMC1-DF-R | Ruibio Tech | This paper | 5’:tgagacgcacgaattcctt gttgttaatctcatccatcaaggc |
| Sequence-based reagent | mTMC1-G411C-F | Ruibio Tech | This paper | 5’: aatgtccctcctgTGTatgtt ctgtcccaccctgtttga |
| Sequence-based reagent | mTMC1-G411C-R | Ruibio Tech | This paper | 5’:ACAcaggagggacattacc atgttcatttcatttttttcccacca |
| Sequence-based reagent | mTMC1-M412C-F | Ruibio Tech | This paper | 5’:gtccctcctggggTGTttc tgtcccaccctgtttgactt |
| Sequence-based reagent | mTMC1-M412C-R | Ruibio Tech | This paper | 5’:ACAccccaggagggacatt accatgttcatttcatttttttccca |
| Sequence-based reagent | mTMC1-N447C-F | Ruibio Tech | This paper | 5’:tcttcttctaggcTGTttg tatgtattcattctcgcctt |
| Sequence-based reagent | mTMC1-N447C-R | Ruibio Tech | This paper | 5’:ACAgcctagaagaaga gcaaaaatgcgccccaggag |
| Sequence-based reagent | mTMC1-D528C-F | Ruibio Tech | This paper | 5’:tctcaccgtttctTGTgtcct gaccacttacgtcacgat |
| Sequence-based reagent | mTMC1-D528C-R | Ruibio Tech | This paper | 5’:ACAagaaacggtgagacgc acgaattcctgccccaccattgtttc |
| Sequence-based reagent | mTMC1-T532C-F | Ruibio Tech | This paper | 5’:tgacgtcctgaccTGTta cgtcacgatcctcattggcga |
| Sequence-based reagent | mTMC1-T532C-R | Ruibio Tech | This paper | 5’:ACAggtcaggacgtcaga aacggtgagacgcacgaattc |
| Sequence-based reagent | mTMC1-D569C-F | Ruibio Tech | This paper | 5’:atacacagaattcTGT atcagtggcaacgtcctcgctct |
| Sequence-based reagent | mTMC1-D569C-R | Ruibio Tech | This paper | 5’:ACAgaattctgtgtatgaag gatatccatattctaagtcccagca |
| Chemical compound, drug | Dihydrostreptomycin sulfate | HarveyBio | Cat: HZB1169-1 | |
| Chemical compound, drug | d-Tubocurarine | TCI | Cat: C0433 | |
| Chemical compound, drug | Amiloride | Cayman | Cat: 21069 | |
| Chemical compound, drug | MTSET | Cayman | Cat: 21069 | |
| Chemical compound, drug | GdCl3 | Sigma | Cat: 439770–5G | |
| Chemical compound, drug | LaCl3 | Sigma | Cat: 298182–10G | |
| Chemical compound, drug | CoCl2 | Sigma | Cat: 60818–50G | |
| Chemical compound, drug | ZnCl2 | Sigma | Cat: 793523–100G | |
| Chemical compound, drug | MgCl2 | Sigma | Cat: M8266-100G | |
| Chemical compound, drug | CaCl2 | Sigma | Cat: 746495–100G | |
| Chemical compound, drug | CsCl | Sigma | Cat:C3139-25G | |
| Chemical compound, drug | KCl | Sigma | Cat:P9333-500G | |
| Chemical compound, drug | NaCl | Sigma | Cat:S7653-1KG | |
| Chemical compound, drug | NaOH | Sigma | Cat:S8045-500G | |
| Chemical compound, drug | KOH | Sigma | Cat:306568–100G | |
| Chemical compound, drug | CsOH | Sigma | Cat:C8518-10G | |
| Chemical compound, drug | BAPTA Tetrasodium salt hydrate | Bioruler | Cat: RH100017-1g | |
| Chemical compound, drug | EGTA | Sigma | Cat: 03780 | |
| Software, algorithm | Igor 6 | WaveMetrics, Inc | ||
| Software, algorithm | Micro-manager 1.4 | micro-manager.org | ||
| Software, algorithm | HEKA patchmaster | HEKA | ||
| Software, algorithm | Matlab 2014 | MathWorks | ||
| Software, algorithm | Prism GraphPad 6 | GraphPad Software. | ||
| Other | HEKA whole cell recording amplifier | HEKA | Order Number: 895273 | |
| Other | Micromanipulator | Sensapex | Cat:uMp-3 |
Additional files
-
Supplementary file 1
Primers used for generating desired truncation and mutations in mouse Tmc1 cDNA.
Specific primers were designed for PCR of the Tmc1-deafness vector and amino-acid-substituted Tmc1 constructs, based on the pCDNA3.1 vector containing mouse Tmc1 cDNA. DF, deafness; F, forward; R, reverse.
- https://doi.org/10.7554/eLife.47441.027
-
Transparent reporting form
- https://doi.org/10.7554/eLife.47441.028
