A distinct cardiopharyngeal mesoderm genetic hierarchy establishes antero-posterior patterning of esophagus striated muscle
- Institut Pasteur, France
- CNRS UMR 3738, France
- CNRS/MNHN UMR 7221, Muséum national d’Histoire naturelle, France
- National Institutes of Health, United States
- University of Utah, United States
- University of Helsinki, Finland
Figures
Figure 1 with 1 supplement
Cell-autonomous role of Isl1 in esophagus myogenic progenitors.
(A) Structures and levels analyzed in the study. (B) Schematic summary of the chimera experiment. (C–E) Immunostainings on transverse cryosections of a E18.5 Isl1Cre;R26mTmG fetus for the GFP …
Figure 1—figure supplement 1
Isl1nlacZ/+ cells colonize the esophagus of chimeric Tbx1 mutants.
(A) Structures and levels analyzed in the study. (B) Schematic summary of the chimera experiment. (C–C’’) Macroscopic views of E14.5/E15.5 Isl1nlacZ/+ ES cell-derived chimeric embryos (C, Tbx1 …
Figure 2 with 2 supplements
Regulation of esophagus striated muscle patterning involves MET/HGF signaling.
(A–C) RT-qPCR analysis for Isl1 and Myf5 at E15.5 (A), E17.5 (B) and 3 weeks postnatal (C) in different esophagus portions and stomach as indicated in the schematic view (top, right). The low level …
Figure 2—figure supplement 1
Met and Hgf expression along the developing esophagus.
(A–C) RT-qPCR analysis for Met (A), SMA (B) and Hgf (C) at E13.5, E15.5 and E17.5 in different color-coded esophagus portions (top, right). TBP transcript levels were used for normalization of each …
Figure 2—figure supplement 2
Phenotype of Met and Hgf mutants.
(A–C) Macroscopic view of E16.5 control, MetD/D and Hgf-/- fetuses. (D–F) Immunostainings on transverse cryosections at levels indicated in (A–C) for the myogenic marker Desmin. Note the absence of …
Figure 3 with 1 supplement
Isl1 progenitors are present anteriorly in the esophagus of MetD/D mutants.
(A) Structures and levels analyzed in the study. (B,B’) Immunostainings on transverse cryosections of E13.5 control and MetD/D embryos for Isl1 expressing progenitors (white arrowheads) and smooth …
Figure 3—figure supplement 1
Myogenic cells are present anteriorly in the esophagus of MetD/D mutants.
(A–A’’) Quantification of Isl1+ progenitors in E13.5 control and Met mutant embryos in the anteriormost esophagus (n = 3 each condition). (A) Isl1+ cells were counted on the top ten consecutives …
Figure 4 with 4 supplements
MET/HGF signaling is required for migration of Isl1-derived myogenic progenitors.
(A) Macroscopic view of Isl1Cre;R26mT/mG E14.5 dissected esophagus used for explant culture and live imaging. Esophagi were placed in collagen beds in individual Ibidi wells. MET inhibitors …
-
Figure 4—source data 1
This. zip file contains excel tables with the individual tracking parameters.
- https://doi.org/10.7554/eLife.47460.011
Figure 4—figure supplement 1
Met invalidation does not affect the proliferation and survival of Isl1 progenitors.
(A–A’) Tunnel assay on transverse cryosections of E13.5 Met mutant and control embryos. White arrowheads point to Tunnel+ cell outside the ESM (n = 2 each condition). (B–C) Time series from a …
Figure 4—video 1
Time-lapse movie of a control E14.5 Isl1Cre;R26mT/mG esophagus explant culture.
Time as hh:mm. Related to Figure 4. Individual GFP+ cells are tracked on different colors.
Figure 4—video 2
Time-lapse movie of a E14.5 Isl1Cre;R26mT/mG esophagus explant culture treated with 10 μM PF-0417903.
Time as hh:mm. Related to Figure 4. Individual GFP+ cells are tracked on different colors.
Figure 4—video 3
Time-lapse movie of a E14.5 Isl1Cre;R26mT/mG esophagus explant culture treated with 10 μM MGCD-265.
Time as hh:mm. Related to Figure 4. Individual GFP+ cells are tracked on different colors.
Figure 5 with 2 supplements
Met is expressed in undifferentiated Isl1-derived myogenic progenitors.
(A–C) In situ hybridization on transverse cryosections at the esophagus level of E14.5 Isl1Cre;R26mTmG embryos for Hgf (A, B) and Met (C), combined with immunofluorescence for GFP (Isl1-derived …
-
Figure 5—source data 1
Excel table containing individual countings from three independent experiments to generate the histograms in panels 5D-E.
- https://doi.org/10.7554/eLife.47460.018
-
Figure 5—source data 2
This folder contains the initial single cell count matrix of the Ct values (tab2_3_sc_edge_allGenes_Ct.R), and the R source code (eso_t2_t3__analysis.R) used to filter, log-transformed, normalized, calculate the correlation coefficient and generate the correlogram on this figure.
- https://doi.org/10.7554/eLife.47460.019
Figure 5—figure supplement 1
Expression domains of Hgf and Met along the developing esophagus.
RNAscope in situ hybridization on Isl1Cre ;R26mTmG control embryos. (A–B) Whole mount in situ hybridization for Hgf at E13.5 (A) and E14.5 (B) followed by immunostaining for GFP and SMA. Hgf is …
Figure 5—figure supplement 2
Esophagus single cell analysis.
(A) Experimental procedure for the esophagus mononucleated cells analysis. (B) The heatmap shows the normalized converted expression values, with columns corresponding to the genes and rows …
Figure 6
Tbx1-Isl1-Met genetic pathway regulates only a subset of CPM-derived muscles.
(A) Masticatory (purple) and facial (blue) muscles originating from anterior pharyngeal arches (PA1-2) are indicated. Neck muscles (green) derived from posterior PAs including trapezius, pharyngeal …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | B6D2F1/JRj | Janvier | ||
| Genetic reagent (M. musculus) | Islet1Cre | PMID:11299042 | MGI:2447758 | Dr. Thomas M Jessell (Howard Hughes Medical Institute, Columbia University, USA) |
| Genetic reagent (M. musculus) | Myf5nlacZ | PMID:8918877 | MGI:1857973 | Dr. Shahragim Tajbakhsh (Department of Developmental and Stem Cell Biology, Institut Pasteur, France) |
| Genetic reagent (M. musculus) | Tg :Pax7-nGFP | PMID:19531352 | MGI:5308730 | Dr. Shahragim Tajbakhsh (Department of Developmental and Stem Cell Biology, Institut Pasteur, France) |
| Genetic reagent (M. musculus) | R26mT/mG | PMID:17868096 | MGI:3716464 | Pr. Philippe Soriano (Icahn School of Medicine at Mt. Sinai, USA) |
| Genetic reagent (M. musculus) | Hgf KO | PMID:7854452 | MGI:1857656 | Pr. Carmen Birchmeier (Max Delbruck Center for Molecular Medicine, Germany) |
| Genetic reagent (M. musculus) | MetD | PMID:8898205 | MGI:1858019 | Pr. Carola Ponzetto (Department of Molecular Biotechnology, University of Turin, Italy) |
| Genetic reagent (M. musculus) | Tbx1KO | PMID:11242110 | MGI:2179190 | Dr. Virginia Papaioannou (Department of Genetics and Development, Columbia University Medical Center, USA) |
| Antibody | Chicken polyclonal anti-β-gal | Abcam | Cat. #: ab9361 RRID:AB_307210 | IF (1:1000) |
| Antibody | Rabbit polyclonal anti-β-gal | MP Biomedicals | Cat. #: MP 559761 RRID:AB_2687418 | IF (1:1500) |
| Antibody | Chicken polyclonal anti-GFP | Aves Labs | Cat. #: 1020 RRID:AB_10000240 | IF (1:500) |
| Antibody | Chicken polyclonal anti-GFP | Abcam | Cat. #: 13970 RRID:AB_300798 | IF (1:1000) |
| Antibody | Mouse monoclonal IgG1 anti-Islet1 | DSHB | Cat. #: 40.2D6 RRID:AB_528315 | IF (1:1000) |
| Antibody | Mouse monoclonal IgG1 anti-Desmin | Dako | Cat. #: ab8470 RRID:AB_306577 | IF (1:100) |
| Antibody | Mouse monoclonal IgG1 anti-Myod | Dako | Cat. #: M3512 RRID:AB_2148874 | IF (1:100) |
| Antibody | Mouse monoclonal IgG1 anti-Myod | BD-Biosciences | Cat. #: 554130 RRID:AB_395255 | IF (1:500) |
| Antibody | Mouse monoclonal IgG1 anti-Pax7 | DSHB | Cat. #: Pax7 RRID:AB_528428 | IF (1:20) |
| Antibody | Mouse monoclonal IgG2a anti-E-Cad | BD Biosciences | Cat. #: 610182 RRID:AB_397581 | IF (1:500) |
| Antibody | Mouse monoclonal IgG1 anti-Myog | DSHB | Cat. #: F5D RRID:AB_2146602 | IF (1:20) |
| Antibody | Rabbit polyclonal anti-SMA | Abcam | Cat. #: ab5694 RRID:AB_2223021 | IF (1:1000) |
| Antibody | Mouse monoclonal IgG1 anti-Tnnt3 | Sigma Aldrich | Cat. #: T6277 RRID:AB_261723 | IF (1:200) |
| Antibody | Mouse monoclonal IgG2a anti-Tuj1 | Ozyme/BioLegend | Cat. #: BLE801202 RRID:AB_2313773 | IF (1:1000) |
| Antibody | Alexa Fluor 633 F(ab')2 Fragment of Goat Anti-Rabbit IgG (H+L) | Life Technologies | Cat. #: A-21072 RRID:AB_2535733 | IF (1:500) |
| Antibody | Alexa Fluor 555 F(ab')2 Fragment of Goat Anti-Rabbit IgG (H+L) | Life Technologies | Cat. #: A-21430 RRID:AB_2535851 | IF (1:500) |
| Antibody | Alexa Fluor 488 F(ab')2 Fragment of Goat Anti-Rabbit IgG (H+L) | Life Technologies | Cat. #: A-11070 RRID:AB_2534114 | IF (1:500) |
| Antibody | Alexa Fluor 633 Goat Anti-Chicken IgG (H+L) | Life Technologies | Cat. #: A-21103 RRID:AB_2535756 | IF (1:500) |
| Antibody | Alexa Fluor 488 Goat Anti-Chicken IgG (H+L) | Life Technologies | Cat. #: A-11039 RRID:AB_2534096 | IF (1:500) |
| Antibody | Alexa Fluor 633 Goat Anti-Mouse IgG1 (γ1) | Life Technologies | Cat. #: A 21126 RRID:AB_2535768 | IF (1:500) |
| Antibody | Alexa Fluor488 AffiniPure Goat Anti-Mouse IgG1 (γ1) | Jackson ImmunoResearch | Cat. #: 115-545-205 RRID:AB_2338854 | IF (1:500) |
| Antibody | Cy3-AffiniPure Goat Anti-Mouse IgG1 (γ1) | Jackson ImmunoResearch | Cat. #: 115-165-205 RRID:AB_2338694 | IF (1:500) |
| Antibody | Cy3-AffiniPure Goat Anti-Mouse IgG2a (γ2a) | Jackson ImmunoResearch | Cat. #: 115-165-206 RRID:AB_2338695 | IF (1:500) |
| Antibody | Dylight 405 Goat Anti-Mouse IgG2a (γ2a) | Jackson ImmunoResearch | Cat. #: 115-475-206 RRID:AB_2338800 | IF (1:500) |
| Commercial assay, kit | RNAscope 2.5 HD reagent Kit-RED | ACD/Bio-techne | Cat. #: 322350 | |
| Commercial assay, kit | RNAscope Multiplex Fluorescent reagent Kit-V2 | ACD/Bio-techne | Cat. #: 323100 | |
| Commercial assay, kit | RNAscope Probe – Mm-Hgf (C1) | ACD/Bio-techne | Cat. #: 315631 | |
| Commercial assay, kit | RNAscope Probe – Mm-Met (C1) | ACD/Bio-techne | Cat. #: 405301 | |
| Commercial assay, kit | Opal 570 Reagent Pack | PerkinElmer | Cat. #: FP1488001KT | 1 :1500 of reconstituted reagent in RNAscope Multiplex TSA Buffer |
| Sequence-based reagent | qPCR Primer TBP Fw | This paper | ATCCCAAGCGATTTGCTG | Materials and methods, Quantitative RT-qPCR section |
| Sequence-based reagent | qPCR Primer TBP Rev | This paper | CCTGTGCACACCATTTTTCC | Materials and methods, Quantitative RT-qPCR section |
| Sequence-based reagent | qPCR Primer Isl1 Fw | Gopalakrishnan et al., 2015 | CGTGCTTTGTTAGGGATGGGA | |
| Sequence-based reagent | qPCR Primer Isl1 Rev | Gopalakrishnan et al., 2015 | AGTCGTTCTTGCTGAAGCCT | |
| Sequence-based reagent | qPCR Primer Myf5 Fw | This paper | GACAGGGCTGTTACATTCAGG | Materials and methods, Quantitative RT-qPCR section |
| Sequence-based reagent | qPCR Primer Myf5 Rev | This paper | TGAGGGAACAGGTGGAGAAC | Materials and methods, Quantitative RT-qPCR section |
| Sequence-based reagent | qPCR Primer Met Fw | Sambasivan et al., 2009 | GCATTTTTACGGACCCAACC | |
| Sequence-based reagent | qPCR Primer Met Rev | Sambasivan et al., 2009 | TTCACAGCCGGAAGAGTTTC | |
| Sequence-based reagent | qPCR Primer Hgf Fw | This paper | CTTCTCCTTGGCCTTGAATG | Materials and methods - Quantitative RT-qPCR section |
| Sequence-based reagent | qPCR Primer Hgf Rev | This paper | AGGCCATGGTGCTACACTCT | Materials and methods -Quantitative RT-qPCR section |
| Sequence-based reagent | qPCR Primer SMA Fw | This paper | CTCTCTTCCAGCCATCTTTCAT | Materials and methods - Quantitative RT-qPCR section |
| Sequence-based reagent | qPCR Primer SMA Rev | This paper | TATAGGTGGTTTCGTGGATGC | Materials and methods -Quantitative RT-qPCR section |
| Sequence-based reagent | Taqman qPCR Primers Tbp | ThermoFisher Scientific | Cat. #: Mm00446971_m1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Actb | ThermoFisher Scientific | Cat. #: Mm00607939_s1 | Sequence not available, primers and probe map within a single exon |
| Sequence-based reagent | Taqman qPCR Primers Hprt | ThermoFisher Scientific | Cat. #: Mm01545399_m1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Rpl13a | ThermoFisher Scientific | Cat. #: Mm01612987_g1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Rps29 | ThermoFisher Scientific | Cat. #: Mm02342448_gH | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Pax7 | ThermoFisher Scientific | Cat. #: Mm01354484_m1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Myod | ThermoFisher Scientific | Cat. #: Mm01203489_g1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Myog | ThermoFisher Scientific | Cat. #: Mm00446195_g1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Pax3 | ThermoFisher Scientific | Cat. #: Mm00435491_m1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Myf5 | ThermoFisher Scientific | Cat. #: Mm00435125_m1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Mrf4 | ThermoFisher Scientific | Cat. #: Mm00435127_g1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Isl1 | ThermoFisher Scientific | Cat. #: Mm00517585_m1 | Sequence not available, probe spans exons |
| Sequence-based reagent | Taqman qPCR Primers Met | ThermoFisher Scientific | Cat. #: Mm00436382_m1 | Sequence not available, probe spans exons |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.47460.021
