1. Cell Biology

A two-step mechanism for the inactivation of microtubule organizing center function at the centrosome

  1. Jérémy Magescas
  2. Jenny C Zonka
  3. Jessica L Feldman  Is a corresponding author
  1. Stanford University, United States
https://doi.org/10.7554/eLife.47867
Share this article
Cite this article
  1. Jérémy Magescas
  2. Jenny C Zonka
  3. Jessica L Feldman
(2019)
A two-step mechanism for the inactivation of microtubule organizing center function at the centrosome
eLife 8:e47867.
https://doi.org/10.7554/eLife.47867
  2. Download BibTeX
  3. Download .RIS

Abstract

The centrosome acts as a microtubule organizing center (MTOC), orchestrating microtubules into the mitotic spindle through its pericentriolar material (PCM). This activity is biphasic, cycling through assembly and disassembly during the cell cycle. Although hyperactive centrosomal MTOC activity is a hallmark of some cancers, little is known about how the centrosome is inactivated as an MTOC. Analysis of endogenous PCM proteins in C. elegans revealed that the PCM is composed of partially overlapping territories organized into an inner and outer sphere that are removed from the centrosome at different rates and using different behaviors. We found that phosphatases oppose the addition of PCM by mitotic kinases, ultimately catalyzing the dissolution of inner sphere PCM proteins at the end of mitosis. The nature of the PCM appears to change such that the remaining aging PCM outer sphere is mechanically ruptured by cortical pulling forces, ultimately inactivating MTOC function at the centrosome.

https://doi.org/10.7554/eLife.47867.001

eLife digest

New cells are created when existing cells divide, a process that is critical for life. A structure called the spindle is an important part of cell division, helping to orient the division and separate parts of the old cell into the newly generated ones. The spindle is built using filamentous protein structures called microtubules which are arranged by microtubule organizing centers (or MTOCs for short). In animals, an MTOC forms at each end of the spindle around two structures called centrosomes.

A network of proteins called the pericentriolar material (PCM) form around centrosomes, converting them into MTOCs. The PCM grows around centrosomes as a cell prepares to divide and is removed again afterward. Enzymes called kinases are important in controlling cell division and PCM assembly; they are opposed by other enzymes known as phosphatases. The processes involved in organization and removal of the PCM are not well understood.

The microscopic worm Caenorhabditis elegans provides an opportunity to study details of cell division in a living animal. Magescas et al. used fluorescent labels to view proteins from the PCM under a microscope. The images showed two partially overlapping spherical parts to the PCM – inner and outer. Further examination revealed that the inner PCM is maintained by a careful balance of kinase and phosphatase activity. When kinases shut down at the end of cell division, the phosphatases break down the inner PCM. By contrast, the outer PCM is physically torn apart by forces acting through the attached microtubules.

Future work will seek to examine which proteins are specifically affected by phosphatases to identify the key regulators of PCM persistence in the cell and to reveal the proteins needed for MTOC activity at the centrosome. Since poor MTOC regulation can play a part in the growth and spread of cancer, this could lead to targets for new treatments.

https://doi.org/10.7554/eLife.47867.002

Introduction

Numerous cell functions such as transport, migration, and division are achieved through the specific spatial organization of microtubules imparted by microtubule organizing centers (MTOCs). The best-studied MTOC is the centrosome, a membrane-less organelle composed of two barrel-shaped microtubule-based centrioles surrounded by a cloud of pericentriolar material (PCM). Microtubules at the centrosome are mainly nucleated and localized by complexes within the PCM, which generate a radial array of microtubules in dividing animal cells and some specialized cell types such as fibroblasts.

The PCM is a central hub for the regulation of a number of cellular processes including centriole duplication, ciliogenesis, cell cycle regulation, cell fate determination, and microtubule organization (Chichinadze et al., 2013; Fry et al., 2017; Stubenvoll et al., 2016). In Drosophila and human cell lines, PCM proteins including a subset of scaffolding proteins are organized in cumulative layers ultimately recruiting microtubule nucleation and organization factors, such as the conserved microtubule nucleating γ-tubulin ring complex (γ-TuRC) (Fu and Glover, 2012; Lawo et al., 2012; Mennella et al., 2012). In C. elegans, the PCM is much simpler in composition, built from the interdependent recruitment of two scaffolding proteins, SPD-2/CEP192 and SPD-5, the functional homologue of CDK5RAP2/Cnn (Hamill et al., 2002; Kemp et al., 2004). Together with the highly conserved kinase AIR-1/Aurora-A, SPD-2 and SPD-5 are required to localize γ-TuRC, which in C. elegans is composed of TBG-1/γ-tubulin, GIP-1/GCP3, GIP-2/GCP2 and MZT-1/MZT1 (Bobinnec et al., 2000; Hamill et al., 2002; Hannak et al., 2002; Kemp et al., 2004; Lin et al., 2015; Oakley et al., 2015; Sallee et al., 2018). γ-TuRC and AIR-1 have been shown to together be required to build microtubules at the centrosome in the C. elegans zygote (Motegi et al., 2006). Additionally, the major role of the γ-TuRC at the PCM in C. elegans might be to anchor microtubules at the periphery as loss of γ-TuRC results in microtubules distributed throughout the PCM (O'Toole et al., 2012).

In addition to the γ-TuRC, several other microtubule regulating proteins are recruited to the PCM to promote its microtubule organizing center function through the stabilization and growth of microtubules. The conserved complex of ZYG-9/XMAP-215/Alp14, a processive microtubule polymerase (Matthews et al., 1998; Thawani et al., 2018), and TAC-1/TACC/Alp7 promotes microtubule polymerization (Bellanger and Gönczy, 2003; Bellanger et al., 2007). This complex is also involved in microtubule nucleation as has been recently shown in yeast and Xenopus egg extract (Flor-Parra et al., 2018; Thawani et al., 2018). In addition. the microtubule stabilizing and nucleation-promoting factor TPXL-1/TPX2 also localizes to the PCM where it interacts with and activates AIR-1 (Bayliss et al., 2003; Zhang et al., 2017). Although the pathways required to build the PCM are largely known in C. elegans, the organization of proteins within the PCM has been generally unexplored. One notable exception is that microtubules have been shown to localize to the periphery of the PCM by electron microscopy (O'Toole et al., 2012). As TBG-1 is found throughout the PCM, these studies suggest the existence of different pools of TBG-1 at the PCM, with an active population at the periphery that organizes microtubules.

The centrosome is not a static organelle; during each cell cycle, MTOC activity at the centrosome is massively increased to ultimately build the mitotic spindle (Dictenberg et al., 1998; Woodruff et al., 2014). This increase in centrosomal MTOC activity relies on the recruitment of PCM proteins to the centrosome, a process that is controlled by the concentration and availability of PCM proteins and their phosphorylation by mitotic kinases (Decker et al., 2011; Wueseke et al., 2014; Wueseke et al., 2016; Yang and Feldman, 2015). Three main kinases are involved in the regulation of PCM activity: CDK-1/CDK1, PLK-1/PLK1 and AIR-1/Aurora A (Pintard and Archambault, 2018). CDK-1 acts as the main driver of PLK-1 and AIR-1 activity, which likely directly phosphorylate PCM proteins to promote PCM assembly (Woodruff et al., 2014). During mitotic exit, MTOC activity of the centrosome rapidly decreases, marked by the reduction of the PCM and microtubule association. This cycle of centrosomal MTOC activity continues every cell cycle, but can also be naturally discontinued during cell differentiation when MTOC function is often reassigned to non-centrosomal sites (Sanchez and Feldman, 2017). Although the mechanisms controlling PCM disassembly have been relatively unexplored, inhibition of CDK activity can drive precocious PCM disassembly and inhibition of the PP2A phosphatase LET-92 perturbs SPD-5 removal from the centrosome, suggesting that phosphatase activity could be more generally required for the inactivation of MTOC function at the centrosome (Enos et al., 2018; Yang and Feldman, 2015). Additionally, stabilization of CDK1 activity has been shown to inhibit PCM disassembly and promote PCM maintenance (Rusan and Wadsworth, 2005). Although kinase and phosphatase activity are implicated in this MTOC cycle, an understanding of how and when these factors act to inactivate MTOC function at the centrosome and whether all PCM proteins behave in the same manner during disassembly in vivo is currently lacking.

The inactivation of MTOC activity of the centrosome is likely critical in a number of cellular and developmental contexts. For example, asymmetric cell division is often associated with unequal PCM association at the mother vs. daughter centrosome and terminal differentiation of murine cardiomyocytes and keratinocytes has been linked to centrosome inactivation (Cheng et al., 2011; Conduit and Raff, 2010; Muroyama et al., 2016; Zebrowski et al., 2015). In an extreme example, female gametes in a range of organisms completely eliminate centrosomes and this elimination can be a critical step in gametogenesis (Borrego-Pinto et al., 2016; Lu and Roy, 2014; Luksza et al., 2013; Mikeladze-Dvali et al., 2012; Pimenta-Marques et al., 2016). Moreover, hyperactive MTOC function at the centrosome has been linked to several types of epithelial cancers and invasive cell behavior, and is a hallmark of tumors (Godinho and Pellman, 2014; Lingle et al., 1998; Pihan, 2013; Pihan et al., 2001; Salisbury et al., 1999). Despite the clear importance of properly regulating MTOC activity, little is known about the mechanisms that inactivate MTOC function at the centrosome, either what initiates the removal of PCM and microtubules during the cell cycle or what keeps them off the centrosome in differentiated cells.

To better understand how MTOC activity is regulated at the centrosome, here we investigate the localization and dynamics of endogenously tagged PCM proteins in the C. elegans embryo. We find that C. elegans PCM is composed of overlapping spheres of proteins similar to what has been observed in other systems, with SPD-5 and γ-TuRC occupying distinct regions from known binding partners SPD-2 and MZT-1, respectively. Live imaging of PCM components at the end of mitosis revealed two phases of disassembly, beginning with the gradual dissolution of PCM proteins such as PLK-1, SPD-2, TAC-1, and MZT-1, followed by the rupture of the remaining PCM proteins ZYG-9, SPD-5, γ-TuRC, TPXL-1, and AIR-1 into microtubule associated packets. Using pharmacological and genetic perturbations, we found a role for phosphatases in PCM disassembly throughout mitosis, opposing CDK activity during PCM assembly and catalyzing PCM dissolution once CDK activity naturally dissipated. Cell fusion and RNAi experiments indicated that the nature of the remaining PCM was transformed and mechanically cleared from the centrosome by cortical pulling forces. Delay in PCM removal impacted subsequent centriole separation and PCM maturation in the next cell cycle. These data indicate that the inactivation of MTOC function at the centrosome involves a regulated two-step process of PCM disassembly, the timing of which is critical to the developing embryo.

Results

C. elegans PCM is organized into an inner and outer sphere

In order to better understand how PCM proteins behave during disassembly, we first characterized the spatial organization of the PCM during mitosis in the ABp cell of the 4-cell C. elegans embryo. ABp has relatively large centrosomes oriented during mitosis along the left-right axis of the embryo, with one of the centrosomes positioned very close to the coverslip in an end-on orientation (Figure 1A). We analyzed the localization of endogenously-tagged PCM proteins immediately after nuclear envelope breakdown (NEBD) in the ABp cell (Figure 1A). At this time, the centrosome still functions as an MTOC, actively growing and organizing microtubules (Figure 1A).

Figure 1 with 2 supplements see all
Download asset Open asset
C. elegans PCM is organized into layered spheres that disassemble using different behaviors, see also Figure 1—figure supplement 1, Figure 1—figure supplement 2, Videos 1–4.

(A) Left: Cartoon representing the C. elegans 4-cell stage embryo with ABp in red. Right: 7.5 µm z-projection from a live pie-1p::GFP::TBB-1/β-tubulin (green); tagRFP::SPD-5 (red) expressing embryo showing cell division in ABa and ABp. Note that these cells have a synchronized cell division and start dividing earlier than EMS or P2. Insets: Enlargement of ABp centrosome showing microtubules (green) organized around the centrosome (SPD-5, red). Scale bar, 5 µm. (B) Average pixel intensity profile across the ABp centrosome at NEBD: GFP::GIP-1 (orange, n = 18), GFP::SPD-5 (red, n = 18), AIR-1::GFP (magenta, n = 19), GFP::MZT-1 (light blue, n = 21), SPD-2::GFP (green, n = 21), PLK-1::GFP (blue, n = 15), GFP::SAS-4 (black, n = 19). Bold line represents the mean, dotted lines represent standard error of the mean (s.e.m.). (C) Average distance from center at half maximum (HM) pixel intensity for each protein in B: SAS-4: −0.25–0.25 ± 0.06 µm, n = 19; PLK-1: −0.45–0.45 ± 0.02 µm, n = 15; SPD-2: −0.57–0.57 ± 0.01 µm, n = 21; MZT-1: −0.72–0.72 ± 0.01 µm, n = 21; SPD-5: −0.83–0.83 ± 0.01 µm, n = 18; GIP-1: −0.84–0.84 ± 0.02 µm, n = 18; AIR-1 inner bars are the internal edge of the toroid: −0.48–0.48 ± 0.02 µm, n = 19; AIR-1 outer bars are the external edge of the toroid: −1.20–1.20 ± 0.02 µm, n = 19. (D) Cartoon representing the organization of the centrosome based on the boundary of SAS-4 (black, ‘centriole’), SPD-2 (cyan, ‘inner sphere’), and SPD-5 (magenta, ‘outer sphere’. (E) Time-lapse analysis of the disassembly of each protein analyzed in B, C and D starting at NEBD (t = 0 min) and imaged every minute for 9 min. Image LUTs have been scaled to their respective 7 min timepoint in order to demonstrate the packets observed during disassembly. Note that in some images, the two centrioles and the corresponding newly forming centrosomes become apparent (joined magenta double arrows) following removal of that protein from the PCM. Scale bar, 10 µm.

https://doi.org/10.7554/eLife.47867.003

We assessed the localization of the centriole component SAS-4, the PCM scaffolding proteins SPD-2 and SPD-5, the γ-TuRC components GIP-1 and MZT-1, the mitotic kinases AIR-1 and PLK-1, and the microtubule associated proteins ZYG-9, TAC-1 and TPXL-1 (Figure 1B, Figure 1—figure supplement 1). As expected, the centrioles sit at the center of the centrosome (Figure 1B–C, Figure 1—figure supplement 1B and D) surrounded by PCM proteins which formed ordered layers of protein localization. SPD-2 and SPD-5 localization at the PCM is co-dependent (Hamill et al., 2002; Kemp et al., 2004; Pelletier et al., 2004), however these proteins displayed distinct outer localization boundaries within the PCM; both SPD-2 and SPD-5 localized to a more proximal region surrounding the centrioles (distance from center at half maximum intensity for SPD-2: −0.575–0.575 ± 0.02 µm; 77.8 ± 0.8% of total SPD-5 overlapping with SPD-2 in this region), and SPD-5 extended to a more distal region lacking SPD-2 (distance from center at half maximum intensity for SPD-5: −0.83–0.83 ± 0.03 µm; Figure 1B–C). Based on the outer edge of these two matrix proteins, we divide the PCM into an ‘inner’ and ‘outer’ sphere, with the smaller inner sphere defined by the outer edge of SPD-2 localization and the larger outer sphere defined by the outer edge of SPD-5 localization (Figure 1D). PLK-1 showed the most restricted localization, occupying a relatively proximal localization in the inner sphere (Figure 1B,C,E). GIP-1 localization was indistinguishable from SPD-5, extending into the outer sphere (Figure 1B–C, Figure 1—figure supplement 1B and D), however another γ-TuRC component MZT-1 showed an intermediary localization, extending only partially into the outer sphere (Figure 1B–C and Figure 1—figure supplement 1B,D). TAC-1 and ZYG-9 also shared this intermediate localization pattern (Figure 1C, Figure 1—figure supplement 1B–D). Finally, the localization of AIR-1 was mainly restricted to the outer sphere, forming a toroid as previously reported (Hannak et al., 2001) and a complimentary localization pattern to PLK-1. As expected, TPXL-1 and AIR-1 co-localized, consistent with the fact that TPXL-1 is important for AIR-1 recruitment to the centrosome and microtubules (Toya et al., 2011). Both TPXL-1 and AIR-1 localization extended further than the boundary of SPD-5 and GIP-1 (Figure 1—figure supplement 1B–D).

Based on these observations, we conclude that the PCM has a layered structure with an inner sphere delimited by SPD-2 localization (Figure 1D) that also localizes SPD-5, PLK-1, ZYG-9, TAC-1, γ-TuRC components, AIR-1, and TPXL-1, and an outer sphere delimited by SPD-5 localization that also contains ZYG-9, TAC-1, GIP-1, MZT-1, AIR-`1, and TPXL-1 (Figure 1D). Although our imaging approach did not allow us to resolve toroidal localization patterns of the majority of the PCM proteins we analyzed, the boundaries of PCM protein localization follows the general pattern of the predicted orthologs in Drosophila and human cells (Fu and Glover, 2012; Lawo et al., 2012; Mennella et al., 2012; Mennella et al., 2014). This localization pattern is also noteworthy as SPD-5 and GIP-1 are found in a region lacking known binding partners SPD-2 and MZT-1, respectively.

PCM proteins disassemble with different behaviors

Based on their distinct localization within the PCM, we hypothesized that different PCM proteins would disassemble with different kinetics and behaviors. To test this hypothesis, we examined the dynamics of disassembly of each of the endogenously-tagged PCM proteins described above by live-imaging in the ABp cell beginning at NEBD (Figure 1E and Figure 1—figure supplement 2A). SPD-2 (Video 1), MZT-1 (Video 2), TAC-1, and PLK-1 displayed similar disassembly behaviors, leaving the centrosome by gradual ‘dissolution’ over time and eventually only remaining at the two centrioles that will duplicate and mature into new centrosomes (Figure 1E and Figure 1—figure supplement 2A). In contrast, SPD-5 (Video 3), GIP-1 (Video 4), ZYG-9, AIR-1, and TPXL-1 initially showed some gradual disassembly, however the structure containing these proteins then appeared to ‘rupture’ and fragment into ‘packets’ that were distinct from the centrioles (Figure 2A–C). These sub-PCM packets localized SPD-5, GIP-1 (Figure 2A, early packets), microtubules (Figure 2B, early packets), AIR-1 (Figure 2C, early packets), and TPXL-1, but neither SPD-2 nor MZT-1 (Figure 2E, see below). Intriguingly, packets appeared to retain MTOC potential as EBP-2/EB1 comets, a marker of growing microtubule plus ends, dynamically moved from the SPD-5/GIP-1 foci (Figure 2D). The packets appeared to be further disassembled in the cytoplasm following their removal from the PCM, with GIP-1 and microtubules first losing their association, followed by SPD-5 (Figure 2A–C, late packets, Figure 2F).

Figure 2
Download asset Open asset
The PCM fragments into SPD-5 and GIP-1 containing packets that localize dynamic microtubules.

(A–C) Analysis of colocalization of SPD-5 packets (red) with GIP-1 (A, green), or microtubules (B, TBA-1/α-tubulin, green), and TBG-1 (red) with AIR-1(C, green) in early packets (left panels) or late packets (right panels). (C) Three second time projection of EBP-2 (green) showing that packets (SPD-5, red) associate with dynamic microtubules. Magenta arrows represent the direction of EBP-2 movement. Scale bar, 10 µm. (D) Colocalization of SPD-5 packets (red) with SPD-2 (green). Note that SPD-2 does not localize to the packets. (E) Average pixel intensity of SPD-2 (green, n = 8), SPD-5 (red, n = 11), and GIP-1 (orange, n = 8) in early and late packets. ‘a.u.’=arbitrary units. Graph represent mean ± s.e.m. Underlying centrioles and corresponding newly forming centrosomes are indicated by magenta joined double arrows.

https://doi.org/10.7554/eLife.47867.006
Video 1
Download asset
Centrosome disassembly in the ABp cell in a 4-cell embryo expressing endogenous SPD-2::GFP.

Scale bar, 5 µm.

https://doi.org/10.7554/eLife.47867.007
Video 2
Download asset
Centrosome disassembly in the ABp cell in a 4-cell embryo expressing endogenous GFP::MZT-1.

Scale bar, 5 µm.

https://doi.org/10.7554/eLife.47867.008
Video 3
Download asset
Centrosome disassembly in the ABp cell in a 4-cell embryo expressing endogenous GFP::SPD-5.

Yellow arrowhead and ‘c’ mark the centrioles. White arrowhead and ‘p’ mark the packets. Scale bar, 5 µm.

https://doi.org/10.7554/eLife.47867.009
Video 4
Download asset
Centrosome disassembly in the ABp cell in a 4-cell embryo expressing endogenous GFP::GIP-1.

Yellow arrowhead and ‘c’ mark the centrioles. White arrowhead and ‘p’ mark the packets. Scale bars, 5 µm.

https://doi.org/10.7554/eLife.47867.010

To gain a better sense of the timing of the disassembly of the different PCM proteins, we imaged each protein in combination with SPD-5. SPD-2 (Figure 3A) and MZT-1 (Figure 3B) showed a gradual decrease in intensity, beginning at 2 (2.20 ± 0.13 min, n = 10) or 3 min (3.00 ± 0.27 min, n = 8) post-NEBD, respectively, and a decrease in PCM volume beginning 3 min post-NEBD (SPD-2: 3.00 ± 0.21 min, n = 10; MZT-1: 2.88 ± 0.23 min, n = 8). These changes occurred several minutes before the decrease in either SPD-5 or GIP-1 (Figure 3D–E). PLK-1 and TAC-1 showed a similar disassembly behavior as SPD-2 and MZT-1, with a gradual decrease in intensity beginning at 2 min post-NEBD (n = 7, Figure 3—figure supplement 1A). As expected from our observation of their individual localization behaviors, both SPD-5 and GIP-1 colocalized during the process of disassembly (Figure 3C, Video 5). Both proteins began a rapid decrease in intensity following their peak at 3 min post-NEBD (SPD-5: 3.00 ± 0.14 min, n = 11; GIP-1: 3.18 ± 0.12 min, n = 11; Figure 3D–E). Their volume, however, remained unchanged until 6 min post-NEBD (SPD-5: 5.91 ± 0.17 min, n = 11; GIP-1: 6.00 ± 0.19 min, n = 11), at which time we began to see changes in the structural integrity of the PCM as holes appeared. A qualitative assessment of when these holes began to appear tracked perfectly with the quantitative changes we observed in SPD-5 and GIP-1 PCM volume. We refer to the appearance of these holes and the concomitant change in PCM volume as ‘rupture’. Following rupture, SPD-5 and GIP-1 deformation continued until distinct sub-PCM ‘packets’ could be observed individualized from the two future centrosomes (Figure 3A). Intriguingly, both AIR-1 and TPXL-1 appeared to spread onto the microtubules starting 3 min post-NEBD (Figure 2C, Figure 3—figure supplement 1B), 3 min ahead of SPD-5 and GIP-1 rupture, before also localizing in packets. Together, these data indicate that the PCM disassembles in two distinct steps: a dissolution step that is characterized by the decrease in intensity of PCM proteins that starts with the removal of the most internal proteins, PLK-1, SPD-2, TAC-1 and MZT-1; and a rupture step where the deformation and subsequent separation of the PCM leads to further disassembly into individual packets.

Figure 3 with 1 supplement see all
Download asset Open asset
Dissolution of SPD-2 and MZT-1 precedes rupture and packet formation, see also Figure 3—figure supplement 1 and Video 5.

(A–C) Comparison of tagRFP::SPD-5 (red) to SPD-2::GFP (A, green), GFP::MZT-1 (B, green), or GFP::GIP-1 (C, green) disassembly. ‘Dissolution’ (light grey arrow) begins as SPD-2 (t = 2 min. post-NEBD) and then MZT (t = 3 min post-NEBD) are removed from the centrosome. ‘Rupture’ (medium grey arrow) is indicated by holes appearing in the matrix of SPD-5 and GIP-1 surrounding the centrioles, followed by the appearance of individual ‘packets’ (white arrowheads) of SPD-5 and GIP-1. Scale bar, 10 µm. (D–E) Average pixel intensity (D) and volume (E) at the centrosome of PCM proteins during disassembly starting at NEBD (t = 0 min): tagRFP::SPD-5 (red, n = 11), GFP::GIP-1 (orange, n = 9), GFP::MZT-1 (blue, n = 10), SPD-2::GFP (green, n = 8). ‘a.u.’=arbitrary units. Graph lines indicate mean ± s.e.m.

https://doi.org/10.7554/eLife.47867.011
Video 5
Download asset
Centrosome disassembly in the ABp cell in a 4-cell embryo expressing endogenous tagRFP-T::SPD-5; GFP::GIP-1.

Yellow arrowhead and ‘c’ mark the centrioles. White arrowhead and ‘p’ mark the packets. Scale bars, 5 µm.

https://doi.org/10.7554/eLife.47867.013

Cortical forces mediate the disassembly of the PCM and more specifically SPD-5

The formation of packets that appear to be pulled away from the centrioles suggests that mechanical forces underlie this aspect of PCM disassembly. Forces can be exerted on the PCM by a conserved cortically anchored complex of LIN-5/NuMA, (GPR-1/2)/LGN, and (GOA-1/GPA-16)/Gαi, which localizes dynein-dynactin and can pull on the astral microtubules extending from the PCM (Kotak and Gönczy, 2013). Given that greater cortical forces exist in the posterior of the one-cell C. elegans embryo, it has been hypothesized that these forces could be responsible for the asynchrony observed in the disassembly of the anterior vs. the posterior centrosome (Grill et al., 2001). Moreover, a recent study implicated the (GPR-1/2)/LIN-5/DHC-1 complex in SPD-5 disassembly from the PCM (Enos et al., 2018).

To assess the involvement of cortical forces in the general disassembly of the PCM and specifically in rupture and packet formation, we used RNAi to either decrease (gpr-1/2(RNAi)) or increase (csnk-1(RNAi)) cortical forces. In control embryos treated with lacZ RNAi, SPD-5 ruptured starting 6 min post-NEBD (5.91 ± 0.16 min, n = 11; Figure 4A). In contrast, we did not observe SPD-5 rupture or packet formation in gpr-1/2(RNAi) treated embryos (Figure 4A). Instead, SPD-5, like SPD-2, disassembled by gradual dissolution as indicated by the steady decrease in SPD-5 centrosomal volume which was in sharp contrast to the precipitous drop off seen in control embryos (Figure 4B). In csnk-1(RNAi) treated embryos, we observed slightly earlier SPD-5 rupture (5.4 + 0.2 min, n = 7; Figure 4A). In contrast to SPD-5, SPD-2 disassembly was unaffected following depletion of either gpr-1/2 or csnk-1 by RNAi (Figure 4C). Interestingly, SPD-5 levels at the PCM were increased by gpr-1/2 and decreased by csnk-1 depletion (Figure 4A, Figure 4—figure supplement 1A). Together, these results suggest that cortical forces generate the mechanical forces necessary for rupture and packet formation, allowing for the efficient removal of the outer sphere protein SPD-5 but not the exclusively inner sphere protein SPD-2.

Figure 4 with 2 supplements see all
Download asset Open asset
Cortical forces rupture the PCM into packets, see also Figure 4—figure supplement 1 and Figure 4—figure supplement 2.

(A) Time-lapse analysis starting at NEBD (t = 0 min) of the disassembly of endogenous tagRFP::SPD-5 (red) and SPD-2::GFP (green) treated with lacZ(RNAi) (control, top panels, grey (A–E)), gpr-1/2(RNAi) (middle panels, blue (A–E)), or csnk-1(RNAi) (bottom panels, purple (A–E)). Scale bar, 10 µm. (B–C) Average volume at the centrosome of SPD-5 (B) or SPD-2 (C) during disassembly starting at NEBD (t = 0 min). (D) Average onset time for centriole separation starting at NEBD (t = 0 min). Stage 1: Centrioles are apparent as a single focus and then double foci of GFP::SAS-4. Stage 2: Centrioles appear >1 µm apart. control, Stage 1: 5.00 ± 0.218 min; control, stage 2: 6.429 ± 0.202 min, n = 8; gpr-1/2(RNAi), Stage 1: 9.091 ± 0.977 min, gpr-1/2(RNAi), Stage 2: 12.100 ± 0.706 min, n = 11; csnk-1(RNAi), Stage 1: 4.714 ± 0.286 min, csnk-1(RNAi), Stage 2: 5.714 ± 0.421 min, n = 7. (E) Average intensity of SPD-2 or SPD-5 remaining at the centrosome before regrowth in the next cell cycle. SPD-2(control): 1281 ± 139, SPD-5(control): 1337 ± 47, n = 8; SPD-2(gpr-1/2(RNAi)): 1610 ± 166, SPD-5(gpr-1/2(RNAi)): 3173 ± 369, n = 11; SPD-2(csnk-1(RNAi)): 1467 ± 122, SPD-5(csnk-1(RNAi)): 1172 ± 110, n = 7. Asterisks indicate comparison between indicated perturbation and control: *p-value<0.01, ** p-value<0.001, *** p-value<0.0001. ‘a.u.’=arbitrary units. Graphs indicate mean ± s.e.m.

https://doi.org/10.7554/eLife.47867.014

Cortical forces could be present and constant throughout mitosis or instead intensify at the time of disassembly as is the case in the zygote, providing forces only when necessary (Gönczy, 2005; Rose and Gonczy, 2014). To distinguish between these possibilities, we tracked the localization of microtubules, LIN-5, DNC-1/dynactin and DHC-1/dynein heavy chain, during different stages of mitosis. Astral microtubules showed a striking network reorganization post-NEBD, growing progressively longer and contacting the cell cortex, sometimes wrapping around the membrane prior to rupture and packet formation (Figure 4—figure supplement 2A). We saw a similar reorganization of AIR-1 and TPXL-1, which coat these astral microtubules (Figure 4—figure supplement 1B). In contrast, we saw no change in the gross cortical distribution or intensity of LIN-5 (Figure 4—figure supplement 2B), DNC-1 (Figure 4—figure supplement 2C), or DHC-1 (Figure 4—figure supplement 2D) post-NEBD. Interestingly, we observed an ephemeral redistribution of DHC-1 coincident with rupture (Figure 4—figure supplements 2E and 4 min.). This pattern of localization suggests that although cortical complexes are present throughout the cell cycle, they may only make productive contact with astral microtubules at a particular time period to allow for outer sphere disassembly.

The rapid rounds of PCM assembly and disassembly during the early embryonic divisions suggest that efficient and robust PCM disassembly might be critical for subsequent carefully timed events such as centriole separation and the assembly of new PCM in the next cell cycle (Cabral et al., 2013). We tested whether force dependent PCM removal corresponds to centriolar separation by tracking SAS-4::GFP during disassembly (Figure 4D). In control embryos, the centriolar pair appeared as a single SAS-4 focus up to 5 min post-NEBD (Figure 4D). Two closely apposed SAS-4 foci became apparent beginning at 5 min post-NEBD (Stage 1, Figure 4D), which quickly separated by greater than 1 µm beginning about 1 min later (Stage 2, Figure 4D). We saw a significant delay in the onsets of both Stage one and Stage two in gpr-1/2(RNAi) treated embryos, but no significant change in csnk-1(RNAi) treated embryos (Figure 4D). These results suggest that cortical forces facilitate centriole separation either through direct force transmission or indirectly through their role in PCM removal. That csnk-1 RNAi had no effect on the timing of centriole separation suggests that a force-independent licensing event is necessary to initiate separation (Cabral et al., 2013; Tsou and Stearns, 2006), but that centrioles are subsequently held together by PCM. In addition to defects in centriole separation, we observed that gpr-1/2(RNAi) treated embryos had defects in effectively clearing SPD-5, but not SPD-2, from the PCM prior to the subsequent round of PCM accumulation in the next cell cycle (Figure 4B and E). Consistent with these defects, the timing of subsequent SPD-5 accumulation was significantly delayed as compared to control embryos (Figure 3—figure supplement 1C). Together, these results underscore the importance of the timely removal of PCM to the developing embryo.

PP2A phosphatases are required for PCM dissolution

As the growth of the PCM is highly dependent on phosphorylation and CDK inhibition causes precocious removal of PCM proteins (Woodruff et al., 2014; Yang and Feldman, 2015), we hypothesized that the dissolution of the PCM that precedes rupture and packet formation requires phosphatase activity. To test this hypothesis, we treated cycling embryonic cells at anaphase with either a broad-spectrum serine/threonine phosphatase inhibitor (okadaic acid, OA) or a PP2A inhibitor (rubratoxin A, Figure 5A). We observed a stabilization of the PCM in both OA and rubratoxin A treated embryos compared to control embryos treated with DMSO. Notably, treatment with either drug led to depolymerization of the microtubules, perhaps due to the hyperactivation of the depolymerizing kinesin KLP-7 during PP2A inactivation (Schlaitz et al., 2007).

Figure 5
Download asset Open asset
PP2A phosphatases regulate PCM disassembly.

(A) Time-lapse analysis of embryos expressing pie-1p::mCherry::TBA-1/α-tubulin (red) and endogenous GFP::GIP-1 (green) and treated at anaphase (t = 0 min) with DMSO (left panels), 30 µM okadaic acid (middle panels), or 60 µM rubratoxin A (right panels). Scale bar, 10 µm. (B–D) Time-lapse analysis of the disassembly of endogenous tagRFP::SPD-5 (red); SPD-2::GFP (green) starting from cytokinetic furrow ingression (t = 0 min) in the one cell embryo as represented on the cartoon below. Timing of rupture (light gray arrow) at this stage is indicated. Images show posterior (P) embryonic region (black dotted box in cartoon) containing the posterior centrosome (red dot in cartoon). Embryos are treated with lacZ(RNAi) (control, (B), let-92(RNAi) (C), or let-92(RNAi) +gpr-1/2(RNAi) (D). Note the appearance of SPD-2 in packets (C, magenta arrowheads) following let-92 RNAi treatment. Scale bars, 10 µm. (E–F) SPD-2 (E) or SPD-5 (F) intensity at the centrosome during disassembly starting from cytokinetic furrow ingression (t = 0 min) in embryos treated with lacZ(RNAi) (control, grey, n = 8), let-92(RNAi) (orange, n = 8), or let-92 +gpr-1/2(RNAi) (navy, n = 8). SPD-2 disassembly slope (E, 0 to 4 min, black dotted lines): control (slope = −2.31e+6, r2 = 0.97), let-92(RNAi) (slope = −8.60e+5, r2 = 0.94) and let-92 +gpr-1/2(RNAi) (slope = 1.67e+5, r2 = 0.86). SPD-5 disassembly slope (F, 2 to 4 min, black dotted lines): control (slope = −5.65e+6, r2 = 0.95), let-92(RNAi) (slope = −7.46e+5, r2 = 0.92) and let-92 +gpr-1/2(RNAi) (slope = −4.40e+5, r2 = 0.91). Slopes are significantly different from each other (t-test, p-value<0.0001). (G) Average centrosomal pixel intensity at the end of disassembly in control (t = 5’, grey, n = 15) and in let-92(RNAi) treated embryos (t = 15’, orange, n = 13). Note that we accounted for centriole duplication defects following let-92 depletion by comparing the average intensity of each individual centriole/centrosome in control embryos (see two SPD-2 foci representing two individual centrioles/centrosomes, light blue arrowheads at t = 5’ in Figure 5B) to intensity of the single centrosome in let-92 depleted embryos (single SPD-2 focus, light blue arrowhead at t = 15’ in Figure 5C; see Material and methods). Asterisks indicate comparison between indicated perturbation and control: *p-value<0.01, ** p-value<0.001, *** p-value<0.0001. ‘a.u.’=arbitrary units. Graphs indicate mean ± s.e.m.

https://doi.org/10.7554/eLife.47867.017

Consistent with these pharmacological inhibition results, a recent study implicated the PP2A subunit LET-92 in SPD-5 disassembly (Enos et al., 2018). To assess the function of LET-92 on PCM disassembly in general and more specifically on dissolution and packet formation, we treated SPD-2::GFP; tagRFP::SPD-5 expressing embryos with let-92(RNAi). As previously reported, let-92 inhibition caused severe defects in cell division, necessitating analysis in the one-cell zygote rather than 4-cell embryo (Song et al., 2011). We monitored PCM disassembly in the one-cell zygote beginning when the membrane invagination that occurs during cytokinetic furrow formation was visible. At this stage in control embryos, PCM disassembly occurs in a similar manner to ABp cells, with SPD-2 dissolution preceding SPD-5 rupture and packet formation (Figure 5B). let-92 depletion impaired the disassembly of SPD-2 and SPD-5 from the centrosome in three distinct ways (Figure 5C). First, we never saw holes appearing in centrosomal SPD-5, indicating a defect in rupture. Moreover, SPD-5 was only partially cleared into packets, however these packets were more fluid and persisted significantly longer in the cytoplasm than control. Unlike in the 4-cell embryo, we occasionally saw a small fraction of SPD-2 being cleared from the centrosome by rupture in this first cell division, a short-lived phenomenon that was exacerbated when both SPD-2 and SPD-5 were endogenously tagged. In contrast, following let-92 depletion, SPD-2 consistently ruptured and appeared in packets that persisted in the cytoplasm long after those of control embryos. Second, the rate and time of SPD-2 and SPD-5 disassembly were significantly slower in let-92 depleted embryos than in control, as indicated by tracking the total centrosomal SPD-2 and SPD-5 over time (Figure 5E,F). Centriole duplication fails following let-92 depletion such that each centrosome at this stage contains only one rather than two centrioles (Song et al., 2011). Thus, total centrosome intensity measurements underestimate differences between control and let-92 depletion conditions because centriole number defects alter the underlying amounts of centriole-localized SPD-2 or SPD-5. Finally, we found that although much of the SPD-2 and SPD-5 appeared to be cleared from the PCM into packets, let-92 depletion inhibited the complete removal of either protein from the centrosome (Figure 5C,G).

The partial removal of SPD-2 and SPD-5 in packets suggested that let-92 depletion affected mainly dissolution, and that much, but not all, of the remaining PCM was cleared by cortical forces. To test this model, we inhibited let-92 together with gpr-1/2 and observed a strong stabilization of both SPD-2 (Figure 5D,E) and SPD-5 (Figure 5D,F) at the PCM without rupture or packet formation. Together, these results indicate that PP2A phosphatases control the dissolution of SPD-2 and SPD-5, and that both PP2A and cortical forces are required for the efficient and timely removal of the PCM from the centrosome.

Phosphatases are present and active at the centrosome throughout mitosis

The timing of centrosome disassembly is critical. For example, precocious removal of PCM would impair the ability of the centrosome to build the mitotic spindle, and delayed disassembly affects the subsequent centrosome duplication cycle (see above, Figure 4). While cortical pulling forces appear to act on the centrosome post-NEBD (Figure 4—figure supplement 2A), it is unclear when phosphatases such as LET-92 are active to help drive disassembly. Phosphatases could be active at the centrosome throughout the cell cycle or could instead be activated only at the time of disassembly. To distinguish between these possibilities, we first assessed the localization of endogenously-tagged LET-92 throughout mitosis. LET-92 localized to the centrosome through the entire process of assembly and disassembly (Figure 6A), extending into the outer sphere in a similar localization pattern to SPD-5 and GIP-1 (Figure 1—figure supplement 1D). Similarly, LET-92 displayed disassembly behavior and kinetics similar to that of SPD-5 and GIP-1 (Figure 6A), however the low expression of LET-92 made it difficult to reliably determine whether it localized to packets.

Figure 6 with 1 supplement see all
Download asset Open asset
Kinases and phosphatases shape the PCM throughout mitosis, see also Figure 6—figure supplement 1.

(A) Time-lapse analysis of the disassembly of endogenous LET-92 starting at NEBD (t = 0 min) and imaged every minute for 9 min. (B) Time-lapse analysis of embryos expressing endogenous tagRFP-T::SPD-5 (red) and SPD-2::GFP (green) and treated at pre-growth (t = 0 min, left panels), growth (t = 0 min, middle panels) or metaphase (t = 0 min, right panels) with DMSO (‘C’, first row), 200 µM flavopiridol (‘FP’, second row), 30 µM okadaic acid (‘OA’, third row), or flavopiridol and okadaic acid (‘FP, OA’, fourth row). (C) Cartoon showing possible outcomes from the cell fusion experiment of a post-NEBD mitotic embryonic cell (ABp, blue) with decreasing levels of kinases (grey) and a S-phase embryonic cell, (P2, magenta) with high levels of kinases. Assembling (green) or disassembling (red) centrosomes are depicted. (D) Time-lapse analysis of the ABp – P2 fusion experiment in embryos expressing endogenous tagRFP-T::SPD-5 (red) and GFP::GIP-1 (green) and overexpressing PLC∂::mCherry (red). Fusion site is marked by the double-headed white arrow. Top images show the entire embryo and bottom images show a magnification of the control Aba centrosome (white), the disassembling ABp centrosome (blue), and the assembling P2 centrosome (magenta). Packets are marked with white arrowheads.

https://doi.org/10.7554/eLife.47867.018

These localization data raised the possibility that phosphatases are active at the centrosome throughout mitosis rather than just during the disassembly phase. To test this possibility further, we treated cycling SPD-2::GFP; tagRFP::SPD-5 embryos with OA and/or the CDK inhibitor flavopiridol (FP) at three defined timepoints during mitosis (Figure 6B): (1) just prior to PCM growth (‘pre-growth’); (2) during PCM growth (‘growth’); and (3) at metaphase immediately before NEBD when PCM levels at the centrosome are near their peak and just prior to the initiation of disassembly (‘metaphase’). FP treatment in pre-growth cells inhibited the accumulation of SPD-2 and SPD-5 at the centrosome and growth-stage FP treatment induced their precocious disassembly. Metaphase stage FP treatment had relatively little effect on SPD-2 and SPD-5 centrosomal localization, consistent with the fact that CDK is normally inactivated shortly after metaphase (Kipreos and van den Heuvel, 2019). SPD-2 and SPD-5 both accumulated at centrosomes following pre-growth OA treatment, albeit to a lesser extent than in control cells. As predicted by the let-92 RNAi phenotype (Figure 5B–D), growth and metaphase stage PCM was stabilized by OA treatment as indicated by the continued presence of SPD-5 (Figure 6B) or GIP-1 (Figure 5A) at the centrosome during the disassembly period. Surprisingly and in contrast to SPD-5, SPD-2 was precociously disassembled in the presence of OA in growth and metaphase stage embryos.

The precocious disassembly of PCM following CDK inhibition suggested that the association of PCM proteins with the centrosome is normally actively opposed such that turning off assembly immediately triggers disassembly. To test if this opposition is phosphatase dependent, we treated embryos with both FP and OA. Pre-growth stage treated embryos showed no addition of SPD-2 or SPD-5, consistent with a requirement for CDK activity in centrosome maturation. Treatment with both inhibitors at growth or metaphase stage led to a stabilization of SPD-5, consistent with the hypothesis that SPD-5 assembly driven by CDK activity is normally opposed by phosphatase activity. In contrast, SPD-2 was precociously disassembled in the presence of OA and FP in growth and metaphase stage embryos, identically to what was observed in embryos treated with OA alone. These results suggest that the maintenance of SPD-2 at the centrosome is controlled by an OA sensitive phosphatase and indicate that regulation of SPD-2 and SPD-5 can be uncoupled.

Centrosome assembly and disassembly are mutually resistant processes

The differential behavior of PCM proteins in response to the timing of kinase and phosphatase inhibition suggests that assembling and disassembling PCM are inherently different structures. We therefore wanted to test whether the factors that contribute to PCM assembly had any impact on disassembling PCM or vice versa. Using in vivo cell fusion experiments, we previously found that cytoplasm from pre-anaphase cells could rapidly induce the assembly of PCM and microtubules onto inactive centrosomes in both cycling and differentiated cells, indicating that mitotic cytoplasm dominantly selects for PCM assembly (Yang and Feldman, 2015). Using a similar cell fusion approach, we fused a pre-metaphase cell in which the PCM was assembling (P2, Figure 6C) and a post-anaphase cell in which the PCM was disassembling (ABp, Figure 6C) to examine the relationship between assembling and disassembling PCM and the cytoplasmic environments that maintain them. If PCM assembly is dominant, we would expect the PCM in ABp to be stabilized following cell fusion. Conversely, if PCM disassembly is dominant, we would expect cell fusion to induce disassembly of the P2 centrosome. Finally, the process of assembly and disassembly could be mutually resistant to the factors that induce the converse process, that is cell fusion would have no impact on the assembling P2 centrosome or the disassembling ABp centrosome.

We fused ABp (Figure 6D, blue, n = 13) with P2 (Figure 6D, magenta) 2 min after NEBD in the ABp cell in embryos expressing a membrane localized mCherry and endogenously tagged tagRFP::SPD-5 and GFP::GIP-1. Microtubules associated with the disassembling ABp centrosome invaded P2 following fusion, confirming an exchange between the cytoplasm of the two cells (Figure 6—figure supplement 1A). Following fusion, the ABp centrosome (Figure 6D, blue arrows) exhibited normal disassembly, showing packet formation as in the control unfused ABa cell (Figures 6D and 5 min, white arrowheads). Similarly, the P2 centrosome showed normal assembly following cell fusion (Figure 6D, magenta arrows). Interestingly, as soon as the existing PCM was stripped from the ABp centrosome into packets, new PCM rapidly assembled at the ABp centrosome (Figures 6D and 7 min, blue double arrow) in a similar manner to that of P2 (Figures 6D and 7 min, pink double arrow). The addition of PCM in ABp was precocious as the control ABa cell had not yet started adding PCM to its centrosome. This precocious assembly also induced the assembly of microtubules but did not lead to the clustering of the ABp and P2 centrosome (Figure 6—figure supplement 1A). Together, these results indicate that PCM assembly and disassembly are mutually resistant with each state being locked in place; a disassembling centrosome and PCM packets are unaffected by cytoplasm that normally promotes assembly and an assembling centrosome is unaffected by cytoplasm that promotes disassembly. Moreover, the addition of new ‘assembly state’ PCM occurs once the old ‘disassembly state’ PCM is removed. Previous experiments indicated that fusion induced PCM assembly requires CDK activity (Yang and Feldman, 2015), lending further evidence to the idea that the nature of the PCM changes throughout mitosis and becomes resistant to phosphoregulation.

Figure 7
Download asset Open asset
A two-step model of PCM disassembly.

The centrosome is assembled through the activity of mitotic kinases that phosphorylate PCM proteins to be incorporated into an inner (magenta) and outer (blue) sphere. Phosphatases oppose this process, hypothetically by inactivating kinases and/or directly dephosphorylating PCM proteins thereby promoting their disassembly. As kinase activity is naturally attenuated in the cell cycle, phosphatase/LET-92 activity dominates, resulting in PCM dissolution. Microtubules lengthen and more readily contact the cortex with TPXL-1/AIR-1 spreading along those microtubules. This rearrangement could be a key aspect in the regulation of cortical forces that ultimately rupture an aging outer sphere of PCM proteins (blue and black lattice) into packets.

https://doi.org/10.7554/eLife.47867.020

Discussion

Here we present evidence that MTOC function at the centrosome is inactivated through a two-step PCM disassembly process involving the gradual dissolution of proteins localized close to the centrioles followed by the forceful rupture and ejection of proteins that extend more distally. Our data suggest that PCM dissolution is controlled by phosphatase activity, including that of PP2A, and that cortical forces drive the rupture of remaining PCM, pulling it into packets (Figure 7). While previous studies indicated a role for both LET-92 and cortical forces in the disassembly of SPD-5 (Enos et al., 2018), here we have presented a more complete picture of centrosome disassembly in two steps as discussed below. Furthermore, our data indicate that PCM is not a mass of proteins that is assembled and disassembled as a batch by common regulation, but rather a complicated meshwork of proteins with distinct mechanisms of intricate regulation.

Our two-step model for PCM disassembly is predicated on the duality of localization patterns and disassembly behaviors we discovered for different PCM proteins. In particular, we found that the C. elegans centrosome is organized into discrete layers which we propose to be part of two spheres based on the localization boundaries of the matrix proteins SPD-2 and SPD-5. While our analysis of PCM composition is limited by our choice of diffraction-limited imaging platforms, this layered organization appears to be generally conserved between direct and functional orthologs in C. elegans, Drosophila, and human PCM, suggesting evolutionary pressure to create specific functional PCM domains and that the mechanisms of disassembly described here might be generally conserved. We found that known binding partners separate between these two distinct PCM regions. For example, SPD-5 and GIP-1 localize to the outer sphere region which lacks binding partner SPD-2 and MZT-1, respectively. Similarly, we found that both SPD-2 and MZT-1 normally disassemble from the centrosome before either SPD-5 or GIP-1. Furthermore, the precocious removal of SPD-2 by OA treatment did not affect SPD-5 or GIP-1 localization, suggesting that these proteins have the ability to form a matrix in the absence of SPD-2 and MZT-1. SPD-5 can form a matrix in vitro and perhaps its self-association drives outer sphere assembly and maintains PCM structure in the absence of SPD-2 (Woodruff et al., 2015). Finally, the differential localization patterns of PCM proteins correlate with the two different disassembly modes we observed (dissolution vs. rupture): Proximal proteins (PLK-1, SPD-2, MZT-1, TAC-1) disassembled by gradual dissolution while more distally extending proteins (ZYG-9, GIP-1, SPD-5, AIR-1) ruptured and formed packets. These differences in disassembly behaviors might reflect differences in diffusion of individual components as SPD-2 and PLK-1 are known to have increased mobility within the PCM as compared to SPD-5 and GIP-1 (Laos et al., 2015; Woodruff et al., 2017). Thus, removal of more fluid inner sphere proteins could rely on active turnover while disassembly of more stable outer sphere proteins might require physical disruption.

Our data suggest that PCM disassembly is initiated through the active turnover of inner sphere proteins by dephosphorylation, either through the direct action of phosphatases on these proteins or through their inactivation of mitotic kinases. Indeed, the removal of both SPD-2 and MZT-1 appears to exclusively depend on phosphatase activity as they do not localize in packets and their disassembly was not affected by the inhibition of cortical forces. Furthermore, a pool of both SPD-2 and SPD-5 remained at the centrosome following LET-92 depletion, suggesting that cortical forces alone are not sufficient for their effective clearance. Thus, PCM disassembly appears to be initiated by dephosphorylation by the PP2A subunit LET-92. As LET-92 plays a number of roles at the centrosome and phosphatase activity can directly regulate mitotic kinases (Enos et al., 2018; Kitagawa et al., 2011; Song et al., 2011), further studies will be necessary to determine if its role in PCM dissolution is direct or indirect.

Our inhibitor experiments also uncovered key roles for phosphatases in both centrosome assembly and disassembly. Centrosome assembly appears to be the result of a balance of kinase and phosphatase activity acting on PCM proteins. Both TBG-1 and SPD-5 could be prematurely forced from the centrosome by dissolution in the presence of the CDK inhibitor FP (this study and Yang and Feldman, 2015). This precocious dissolution was inhibited by additional treatment with OA, suggesting that the ability of CDK to drive the addition of PCM proteins is actively opposed by serine/threonine phosphatase activity. This phosphatase-based opposition is independent of inhibition of CDK activity and might instead act on other kinases such as PLK-1/PLK1 or AIR-1/Aurora A. Consistently, PP2A can remove activating phosphates from both PLK1 and Aurora A (Horn et al., 2007; Wang et al., 2015). Alternatively, our data are also consistent with phosphatases being directly inhibited by CDK, thus forced CDK inactivation would relieve phosphatase inhibition and result in dissolution. However, we favor a model in which phosphatases actively oppose PCM assembly as this type of model can account for the observed mobility of exclusively inner sphere proteins such as SPD-2 (Laos et al., 2015). Indeed, phosphatases might directly remove PCM protein phosphorylation which in turn could lead to their dissociation from the centrosome. This model seems plausible as SPD-5 can be dephosphorylated in vitro by LET-92 and has been shown to interact with the PP2A targeting subunits RSA-1 and RSA-2 (Enos et al., 2018; Schlaitz et al., 2007). As LET-92 is localized to the centrosome throughout mitosis, PCM dissolution might simply be the result of the normal inhibition of CDK activity in the cell cycle coupled with the continued presence of LET-92 at the centrosome.

These experiments have also revealed differential regulation for SPD-2 and SPD-5. In contrast to LET-92 inhibition which stabilized both SPD-2 and SPD-5 at the centrosome, we found that OA treatment inhibited the removal of SPD-5 from the centrosome but expedited SPD-2 disassembly. These experiments suggest that SPD-2 association with the centrosome is positively regulated by another OA sensitive phosphatase, further separating the localization and regulation of SPD-2 from that of SPD-5. OA induced SPD-2 removal only occurred after NEBD, suggesting that the phosphatase that maintains it at the centrosome is regulated in time and/or space. PP1 and/or PP4 could play this role as both have been shown to positively regulate PCM association with the centrosome, and PP1 can interact directly with the SPD-2 homologue CEP192 (Martin-Granados et al., 2008; Nasa et al., 2017). Thus, PCM disassembly and assembly are regulated by phosphatases and SPD-2 appears to have additional levels of dephosphorylation dependent mechanisms to maintain it the centrosome. In the future, it will be interesting to determine if other inner sphere proteins have similar regulation.

The sensitivity of PCM to kinase and phosphatase activity appears to change during mitosis. Indeed, disassembling PCM appears to be resistant to assembly-competent cytoplasm; PCM continued to disassemble into packets despite exposure to active mitotic kinases following cell fusion. Moreover, the aging PCM matrix appeared to protect centrosomes from the addition of new PCM, which was only added onto centrioles once existing PCM had been stripped away. Likewise, assembling PCM was unaffected by the presence of disassembly-competent cytoplasm following fusion, further underscoring that disassembly by phosphatases is a normal aspect of assembly that is dominated by kinase activity. An alternative explanation for these observed phenomena is that PCM assembly is slower than the off rate of PCM proteins or that diffusion between ABp and P2 is too slow to induce assembly prior to disassembly. However, we previously found that new PCM can add onto inactive centrosomes in interphase cells in under three minutes following fusion to a mitotic cell (Yang and Feldman, 2015). Given that in the present study we observe disassembly and subsequent reassembly in ABp well after this three-minute window, our results instead favor the model that centrosomes become locked in mutually resistant assembly or disassembly states perhaps due to a change in the biophysical nature of the PCM. Recent studies of in vitro assembled PCM point to different physical properties between ‘young’ and ‘old’ condensates of SPD-5, with young condensates behaving more like a liquid and old condensates acting more like a gel (Woodruff et al., 2017).

This change in the nature of the PCM could also be regulated by phosphorylation. For example, Cnn is proposed to live in different states in the PCM in Drosophila, assembling first near the centrioles in a phosphorylated state and transiting towards the PCM periphery as a higher order multimerized scaffold where Cnn molecules are likely eventually dephosphorylated and lose PCM association (Conduit et al., 2014). Similarly, the inner sphere of SPD-5 may represent a specific pool that can be readily dissociated by dephosphorylation, while the outer sphere may represent a macromolecular scaffold that relies on physical disruption for disassembly. More mobile inner sphere proteins such as SPD-2 could be more likely to escape an aging outer sphere matrix of SPD-5 and other proteins which would then be torn apart by cortical forces as it matured into a gel. Indeed, let-92 depletion inhibited rupture and led to the appearance of more fluid packets, consistent with a role for phosphorylation in regulating the nature of the PCM. Interestingly, a recent study reported similar defects upon depletion of PCMD-1 (Erpf et al., 2019). Thus, PCMD-1 could be involved in this phosphorylation dependent regulation of PCM structural integrity. Different landscapes of phosphorylation could be provided by the complementary localization patterns of the two mitotic kinases PLK-1 and AIR-1. Although previous studies had suggested that only more proximally localized AIR-1 is activated by auto-phosphorylation (Hannak et al., 2001; Toya et al., 2011), more recent studies have found that human Aurora A can also be activated by interaction with TPX2 (Zorba et al., 2014). These results suggest that AIR-1 might be similarly active throughout the outer sphere where it colocalizes with TPXL-1 and therefore could phosphorylate a complementary set of PCM proteins to that of PLK-1.

Following dissolution, we found that the PCM fragments into small packets that retain MTOC potential. These packets are reminiscent of PCM flares described in Drosophila (Megraw et al., 2002) and to the fragments that are released from the centrosome in anaphase in the LLC-PK1 kidney cell line (Rusan and Wadsworth, 2005). PCM flares are reported to be present to some extent throughout the cell cycle rather than exclusively during centrosome disassembly like the packets we describe (Lerit et al., 2015; Megraw et al., 2002). However, like packets, flare activity dramatically increases in telophase and centrosome fragments in LLC-PK1 cells appear in anaphase. Flares were first defined by their association with Cnn, the proposed functional ortholog of SPD-5 (Megraw et al., 2002). However, flares also localize D-TACC while the C. elegans orthologue TAC-1 does not localize to packets. Furthermore, γ-TuRC does not localize to flares but does localize to both packets and centrosome fragments. Finally, packets, flares, and centrosome fragments all appear to be dependent on microtubules for their formation. Thus, these remnants of PCM fragmentation appear to be conserved, although the molecular composition and timing of appearance of the resulting structures can vary. Because packets still disassemble following let-92 inhibition and exposure to assembly competent cytoplasm, other kinase- and phosphatase-independent mechanisms must be required for packet disassembly. These mechanisms could include rapid diffusion or proteasome-based degradation and further studies will be required to uncover their mechanism of disassembly.

Finally, our results indicate that cortical forces can shape the PCM mainly through an effect on outer sphere proteins. The balance of cortical forces appears to tune the levels of SPD-5 incorporation into the PCM, independently of SPD-2; decreasing or increasing cortical forces caused more or less SPD-5 incorporation, respectively, but had no effect on the levels of SPD-2. Thus, cortical forces negatively regulate the growth of the PCM, hypothetically by physically changing the nature of PCM in the outer sphere. We found that the effect of cortical forces on the PCM was temporally restricted, with the PCM only becoming sensitive to these forces in late anaphase. This claim is supported by multiple observations. First, when PCM is precociously removed from the centrosome by FP treatment, SPD-5 and γ-TuRC disassemble by dissolution, suggesting that cortical forces are not capable of rupturing the PCM and forming packets at the time of normal PCM growth (this study and Yang and Feldman, 2015). Second, we see astral microtubule rearrangements starting in anaphase that result in a large increase in the number of microtubules that reach the plasma membrane, consistent with what has been seen in other cell types (Rusan and Wadsworth, 2005). Thus, productive force can only act on the PCM beginning in anaphase. Consistently, increasing cortical forces by CSNK-1 inhibition only slightly expedited PCM disassembly. Finally, we see an apparent movement of AIR-1 and TPXL-1 from the PCM along the microtubules also beginning at about the end of anaphase. This redistribution could simply be a biproduct of the microtubule network reorganization. Alternatively, AIR-1 and TPXL-1 relocalization could contribute to microtubule reorganization by stabilizing the microtubules directly or promoting their efficient outgrowth (Bayliss et al., 2003; Zhang et al., 2017).

In total, these results suggest that PCM is disassembled through the removal of the inner sphere of PCM by phosphatase activity, including that of PP2A. This dissolution is followed by the clearance of an aging outer sphere matrix by cortical pulling forces, which liberate dynamic microtubules and inactivate MTOC function at the centrosome (Figure 7). With an understanding of the mechanisms underlying this process, future studies will reveal whether hyperactive MTOC function at the centrosome has a direct effect on the cell cycle or cell differentiation in a developing organism, as has been previously postulated.

Materials and methods

C.elegans strains and maintenance

Request a detailed protocol

C. elegans strains were maintained at 20°C unless otherwise specified and cultured as previously described (Brenner, 1974). Experiments were performed using embryos from one-day adults. Unless otherwise indicated, at least five embryos were scored in each experimental condition. Strains used in this study are as follows.

Strain nameGenotypeSource
N2Bristol N2CGC
JLF14gip-1(wow3[gfp::gip-1]) III(Sallee et al., 2018)
JLF432spd-2(wow60[spd-2::gfp^3xflag]) IThis study
JLF359spd-5(wow36[tagrfp-t^3xmyc::spd-5]) IThis study
JLF361spd-5(wow52[gfp^3xflag::spd-5]) IThis study
JLF342zif-1 (gk117); mzt-1(wow51[gfp^3xflag::mzt-1]) I(Sallee et al., 2018)
JLF198Zif-1 (gk117); sas-4(wow32[zf^gfp^3xflag::sas-4]) IIIThis study
JLF50zif-1(gk117), outcrossed 6x(Sallee et al., 2018)
JLF427spd-5(wow36[tagrfp-t^3xmyc::spd-5]) I; unc-119(ed3); ruIs57[pie-1p::GFP::tbb/β-tubulin; unc-119(+)]This study/CGC
JLF428spd-5(wow36[tagrfp-t^3xmyc::spd-5]) I; ebp-2(wow47[ebp-2:: gfp^3xflag]) IIThis study/(Sallee et al., 2018)
JLF430spd-5(wow36[tagrfp-t^3xmyc::spd-5]) I; gip-1(wow3[gfp^3xflag::gip-1]) IIIThis study/(Sallee et al., 2018)
JLF426spd-5(wow36[tagrfp-t^3xmyc::spd-5]) I; mzt-1(wow51[gfp^3xflag::mzt-1]) IThis study
JLF425spd-5(wow36[tagrfp-t^3xmyc::spd-5]) I; spd-2(wow60[spd-2:: gfp^3xflag]) IThis study
JLF429zif-1(gk117); spd-5(wow36[tagrfp-t^3xmyc::spd-5]) I; sas-4(wow32[zf^gfp^3xflag::sas-4]) IIIThis study
LP585lin-5(cp288[lin-5::mNG-C1^3xFlag]) IICGC
LP560dhc-1(cp268[dhc-1::mNG-C1^3xFlag]) ICGC
LP563dnc-1(cp271[dnc-1::mNG-C1^3xFlag]) ICGC
OD2425plk-1(it17[plk-1::sgfp]loxp) III(Martino et al., 2017)
JLF158tac-1(wow19[tac::zf^gfp^3xflag]); zif-1(gk117)This study
JLF105zyg-9(wow12[zf::gfp::zyg-9]) II; zif-1(gk117)(Sallee et al., 2018)
JLF518let-92(wow88[let-92::gfp^aid^3xFlag]) IV/nT1This study
JLF216tpxl-1(wow34[zf^gfp^3xflag::tpxl-1) I; zif-1(gk117)(Sallee et al., 2018)
JLF166itSi569(tbg-1::mcherry); air-1(wow14[air-1::zf^gfp^3xflag]) V; zif-1(gk117)(Sallee et al., 2018)
JLF517gip-1(wow3[gfp^3xflag::gip-1]) IIIGIP-1,;
spd-5(wow36[tagrfp-t^3xmyc::spd-5]) I;
ltIs44 [pie-1p::mCherry::
PH(PLC1delta1)+unc-119(+)] V		This study/(Sallee et al., 2018)
JLF8ruIs75(tubulin::gfp); itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV; ltIs44 [pie-1p::mCherry::PH(PLC1delta1)+unc-119(+)] VThis study

CRISPR/Cas9

Request a detailed protocol

Endogenously tagged proteins used in this study were generated using the CRISPR Self Excising Cassette (SEC) method that has been previously described (Dickinson et al., 2015). DNA mixtures (sgRNA and Cas9 containing plasmid and repair template) were injected into young adults, and CRISPR edited worms were selected by treatment with hygromycin followed by visual inspection for appropriate expression and localization (Dickinson et al., 2015). sgRNA and homology arm sequences used to generate lines are as follows:

AllelesgRNA sequenceHomology armSEC used
spd-2
(wow60[spd-2::gfp^3xflag])		cagagaatatttggaaagttagg (pJM31)HA1 Fwd: ttgtaaaacgacggccagtcgccggcaGTGTTGACATTCGCATCGACpDD282
HA1 Rev:
CATCGATGCTCCTGAGGCTCCCGAT
GCTCCCTTTCTATTCGAAAATCTTGTATTGG
HA2 Fwd:
CGTGATTACAAGGATGACGATGACAAGAGATAA
aatcttaagataactttccaaatattc
HA2 Rev:
ggaaacagctatgaccatgttatcg
atttcatcctcaatatgccagatgc
spd-5
(wow36[tagrfp-t^3xmyc::spd-5])		gaaaacttcgcgttaaATGGAGG
(pJM13)		HA1 Fwd: cacgacgttgtaaaacgacggccagtcgacgcaaggaaatcgtcacttpDD286
HA1 Rev:
CTTGATGAGCTCCTCTCCCTTGGAGACCATtt
aacgcgaagttttctg
HA2 Fwd:
GAGCAGAAGTTGATCAGCGAGGAAGA
CTTGGAGGATAATTCTGTGCTCAACG
HA2 Rev:
tcacacaggaaacagctatgaccatgttat
CTTTCCTCCATTGCATGCTT
spd-5
(wow52[gfp^3xflag::spd-5])		HA1 Fwd: acgttgtaaaacgacggccagtcgccggcaacgcaaggaaatcgtcacttpDD282
HA1 Rev:
TCCAGTGAACAATTCTTCTCCTTTACTCAT
ttaacgcgaagttttctg
HA2 Fwd:
CGTGATTACAAGGATGACGATGACAAGA
GAGAGGATAATTCTGTGCTCAACG
HA2 Rev:
tcacacaggaaacagctatgaccatgttat
CTTTCCTCCATTGCATGCTT
tac-1
(wow19[tac-1::zf^gfp^3xflag])		cagagaatatttggaaagttagg (pJF283)HA1 Fwd: ttgtaaaacgacggccagtcgccggcagctttctaggccaactgcacpJF250
HA1 Rev:
ACAAAGTCGCGTTTTGTATTCTGTCGGCAT
ctgaaaatcggatgaatttaatag
HA2 Fwd:
CGTGATTACAAGGATGACGATGACAAG
AGATCGCTCAACACAACCTTCAC
HA2 Rev:
tcacacaggaaacagctatgaccatgttat
ACTCCACGGATGCTctgaat
let-92
(wow88[let-92::gfp^aid^3xflag])		GAAAACGGCGATTTGAACGGAGG (pJM51)HA1 Fwd: ttgtaaaacgacggccagtcgccggcaCCTTCACGGAGGTCTTTCACpJW1583
HA1 Rev:
CATCGATGCTCCTGAGGCTCCCGATGC
TCCCAGGAAGTAGTCAGGCGTTCT
HA2 Fwd:
CGTGATTACAAGGATGACGATGAC
AAGAGATAGatagatacctccgttcaaatcg
HA2 Rev:
ggaaacagctatgaccatgttatcg
atttcgggaagtggtgaaaaggatg
sas-4
(wow32[zf::gfp^3xflag::sas-4])		GGAAAACAACTTTGTTCCAG
(pJF296)		HA1 Fwd: ttgtaaaacgacggccagtcgccggcaaattgtaaaatttggcgccttcaapJF250
HA1 Rev:
CATCGATGCTCCTGAGGCTCCCGATGCTCCT
TTTTTCCATTGAAACAATGTAGTCT
HA2 Fwd:
CGTGATTACAAGGATGACGATGACA
AGAGATGAgaaattccaaccccttt
HA2 Rev:
ggaaacagctatgaccatgttatcgat
ttcaagatgctgctcctggatgt

Image acquisition

Request a detailed protocol

Embryos dissected from one-day old adults were mounted on a pad (3% agarose dissolved in M9) sandwiched between a microscope slide and no. 1.5 coverslip. Time-lapse images were acquired on a Nikon Ti-E inverted microscope (Nikon Instruments) equipped with a 1.5x magnifying lens, a Yokogawa X1 confocal spinning disk head, and an Andor Ixon Ultra back thinned EM-CCD camera (Andor), all controlled by NIS Elements software (Nikon). Images were obtained using a 60x Oil Plan Apochromat (NA = 1.4) or 100x Oil Plan Apochromat (NA = 1.45) objective. Z-stacks were acquired using a 0.5 µm step every minute. Images were adjusted for brightness and contrast using ImageJ software.

Drug treatment

Request a detailed protocol

Drugs treatments were performed as previously described (Yang and Feldman, 2015). Briefly, embryos were mounted between a slide and coverslip, supported with 22.5 uM beads (Whitehouse Scientific), and bathed in an osmotically balanced control buffer (embryonic growth medium – EGM [Shelton and Bowerman, 1996]) supplemented with either 10% DMSO, 30 µM okadaic acid, or 60 µM rubratoxin A, or 200 µM flavopiridol. Embryos were laser permeabilized at appropriate times using a Micropoint dye laser (coumarin 435 nm) mounted on the spinning-disk confocal described above.

Cell fusion experiments

Request a detailed protocol

Embryos were prepared and mounted the same way as described above for image acquisition. ABp and P2 cells were fused using the Micropoint dye laser (coumarin 435 nm) and confocal described above.

RNAi treatment

Request a detailed protocol

RNAi treatment was performed by feeding as previously described using csnk-1(RNAi), gpr-1/2(RNAi), and let-92(RNAi) expressing HT115 bacteria from the Ahringer RNAi library (Ahringer, 2006; Fraser et al., 2000; Kamath et al., 2003). L4 stage worms were grown on RNAi plates (NGM supplemented with IPTG and Ampicillin) at 25°C for 24 h-48h. RNAi plates were seeded with a bacterial culture grown overnight and subsequently grown 48 hr at room temperature protected from light.

Image quantification

PCM volume measurements

Request a detailed protocol

PCM volume was measured from stacks of images taken through the ABp centrosome closest to the coverslip at each timepoint. Image stacks were first processed to eliminate the cytosolic background by subtracting the mean intensity of 10 random points in the cytoplasm at each plane and each timepoint. Image stacks were then thresholded using the Otsu method (ImageJ) to delimit the PCM structure. Volume measurements were performed using the 3D object counter imageJ plugin (Bolte and Cordelières, 2006). Only the volume of PCM that was connected to the centrioles was considered. Individualized packets that were physically separate from the centrioles were manually subtracted from the total PCM volume.

Intensity measurements

Request a detailed protocol

Total intensity was measured by defining an image stack 15 µm wide x 7.5 µm deep around the centrosome for each timepoint. Another stack of the exact same dimensions was generated in the cytoplasm. Both stacks were sum projected and the total intensity was measured by subtracting the total intensity of the cytoplasmic sum projection from the total intensity of the centrosome sum projection. Centrosomal intensity was calculated in the same way, but ROIs were selected manually following initial thresholding to specifically select for the centrosome and not the surrounding packets upon rupture. Only the PCM that was connected to the centrioles was considered in the intensity measurement. Packet intensity was determined by subtracting the intensity measurement for the centriole and contiguous PCM from the total intensity measurement. In Figure 5G, we accounted for the fact that let-92 depletion results in centriole duplication defects in the one cell embryo (Song et al., 2011). In control embryos, we determined the average intensity of each of the two individual centriolar/centrosomal foci of either SPD-2 or SPD-5 at the end of disassembly (t = 5’). We compared this value to the average intensity of the single centrosomes in let-92 depleted embryos at the end of disassembly (t = 15’). This type of measurement was in contrast to the total centriole/centrosome measurement shown in Figure 5E and F, which does not distinguish the two resulting centrioles/centrosomes in control conditions at the end of disassembly.

Timing of events

Request a detailed protocol

The different steps of disassembly were defined based on hallmarks of both volume and intensity measurements. ‘Dissolution’ was defined as the timepoint at which the first decrease in PCM intensity was detected, which corresponded to a decrease in SPD-2 intensity. ‘Rupture’ was defined as the timepoint at which holes first appear in the PCM, which corresponded to a drop in SPD-5 volume. Packet formation was defined as the timepoint at which individualized foci of SPD-5 appeared around the centrioles.

Statistics

Request a detailed protocol

Statistical analyses were performed using R and Prism (GraphPad software, La Jolla, Ca, USA). PCM size reported in Figure 1 were statistically tested using an unpaired t test. All other data were analyzed using an ANOVA analysis followed by Tukey’s multiple comparison test; P-values for the Tukey’s multiple comparison test are reported in corresponding figure legends. To determine the percentage of SPD-5 overlapping with SPD-2, the area under the curve (AUC) of the mean intensity profile of SPD-5 was used. The portion of the SPD-5 overlapping with SPD-2 was defined as the SPD-5 AUC in the region defined by the half-max values of the SPD-2 mean intensity profile. The total portion of SPD-5 was defined as the AUC in the region defined by the half-max values of the SPD-5 mean intensity profiles. The percentage of overlap was then defined as the SPD-5 AUC in SPD-2 half-max interval divided by the SPD-5 AUC in the SPD-5 half-max interval.

Data availability

Data generated or analyzed during this study are included in the manuscript and supporting files.

References

    1. Ahringer J
    (2006)
    WormBook
    Reverse genetics, WormBook,  W. H. Freeman and Company.
    1. Bobinnec Y
    2. Fukuda M
    3. Nishida E
    (2000)
    Identification and characterization of Caenorhabditis elegans gamma-tubulin in dividing cells and differentiated tissues
    Journal of Cell Science 113:3747–3759.
    1. Brenner S
    (1974)
    The genetics of Caenorhabditis elegans
    Genetics 77:71–94.
    1. Godinho SA
    2. Pellman D
    (2014) Causes and consequences of centrosome abnormalities in cancer
    Philosophical Transactions of the Royal Society B: Biological Sciences 369:20130467.
    https://doi.org/10.1098/rstb.2013.0467
    1. Pihan GA
    2. Purohit A
    3. Wallace J
    4. Malhotra R
    5. Liotta L
    6. Doxsey SJ
    (2001)
    Centrosome defects can account for cellular and genetic changes that characterize prostate cancer progression
    Cancer Research 61:2212–2219.
    1. Shelton CA
    2. Bowerman B
    (1996)
    Time-dependent responses to glp-1-mediated inductions in early C. elegans embryos
    Development 122:2043–2050.
    1. Woodruff JB
    2. Wueseke O
    3. Hyman AA
    (2014) Pericentriolar material structure and dynamics
    Philosophical Transactions of the Royal Society B: Biological Sciences 369:20130459.
    https://doi.org/10.1098/rstb.2013.0459

Decision letter

  1. Yukiko M Yamashita
    Reviewing Editor; University of Michigan, United States
  2. Anna Akhmanova
    Senior Editor; Utrecht University, Netherlands

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

[Editors’ note: a previous version of this study was rejected after peer review, but the authors submitted for reconsideration. The first decision letter after peer review is shown below.]

Thank you for submitting your work entitled "A two-step mechanism for the inactivation of microtubule organizing center function at the centrosome" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous.

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

All three reviewers agreed that the present study is of potential interest. However, as you can see from the individual comments of these reviewers, they felt that the progress that has been achieved compared to the existing/published work was not sufficient. The reviewers thus agreed that the revision required for this manuscript to be acceptable for eLife (such as identification of PP2A substrates) is too substantial and beyond the scope of standard revision per eLife's policy, as only revisions with straightforward experiments that can be carried out within approximately two months are encouraged by eLife.

We would be prepared to consider a substantially revised version as a new submission, if the mechanistic part of the paper were significantly extended, for example, by identifying new PP2A substrates or the regulatory details behind the two-step PCM disassembly.

Reviewer #1:

The manuscript by Magescas et al. reports on centrosome disassembly as cells exit mitosis. This process involves the reduction in PCM components and a corresponding reduction in centrosomal microtubules. The authors begin by defining the localization of 4 PCM components relative to the centriole to show a wider and wider distribution in the following order Spd-2, MZT-1, Spd-5 and then GIP-1. The authors then describe two different disassembly modes: Spd-2 and MZT-1 show a gradual disassembly, while Spd-5 and GIP-1 disassemble in "packets". The authors then use RNAi and chemical perturbations to show that centrosome disassembly requires microtubules to pull the packets away from the centrosome, and that PP2A is also required.

The topic is both interesting and important; centrosome disassembly, or dematuration, does not garner anywhere near the attention that centrosome maturation commands. Clearly dematuration is an active process and it is not simply PCM passively falling apart. This study, however, does not provide much new insight into disassembly. I outline this in detail below.

1) Centrosome fragmentation. I was surprise that there was no mention of the study from the Wadsworth lab from 2005 (Rusen and Wadsworth, 2005).. The Wadsworth lab showed the same phenomenon of disassembling the centrosome into packets, or fragments, and their ability to nucleate microtubules. While the previous study was done in another system, observation of packets in of themselves is not particularly novel. Another example that the authors did mention are the flares from Drosophila embryos. Here the authors properly reference the work by Megraw, but they improperly state that the flares are present throughout the cell cycle. Flares form specifically during mitotic exit and they also release packets into the cytoplasm. This was shown in Lerit et al. (2015).

2) The mechanism of centrosome disassembly. While the authors better describe the effects of reducing microtubule pulling forces (via Grp-1/2 loss), inhibition of PP2A function (drug treatment), and loss of Let-92 on centrosome disassembly, all of these experiments were previously reported in Enos et al., 2018. This previous study greatly reduces the enthusiasm for the current results. I think an advance to the field here would require the identification of PP2A targets.

3) Centrosome protein distribution. One exciting result was the finding that Spd-5 and Spd-2 do not occupy the same space in the centrosome. This could have important implications on how we view C. elegans PCM that might differ from current models. I was, however, surprised by the choice of imaging. The use of Structured Illumination Microscopy to define the regions occupied by centrosome protein is standard practice in the centrosome field. A localization study using SIM would be more appropriate, not simply because it is standard practice, but rather because SIM imaging has played a critical role in shaping current models and hypotheses regarding centrosome function.

Reviewer #2:

Magescas and coworkers investigate the regulation of PCM disassembly using dynamic imaging of the C. elegans embryo. The centrosome is the microtubule-nucleating organelle organized into distinct subconcentric domains. The stepwise assembly of the various centrosomal components resulting in the recruitment of γ-TURC complexes is well-studied based on work from a variety of systems.

In this study, the authors describe the macromolecular organization of the C. elegans centrosome, albeit at relatively low resolution compared to similar studies from cell lines and Drosophila embryos. Of note, the authors examine the less understood process of PCM disassembly and the associated role of protein phosphatase PP2A. Their work suggests disassembly of the retinue of PCM proteins by at least 2-steps. First, a slower-acting step, regulated in part by protein dephosphorylation, results in the partial dissolution of the PCM. Second, a faster-acting step involves active forces – presumably acting upon microtubules via protein complexes associated with the cortical membrane ("cortical forces").

This is an informative study that adds mechanistic understanding to the important process of centrosome inactivation via PP2A and cortical pulling forces. However, much of this work appears to largely support the conclusions of Enos et al., 2018 published in Biology Open. Nonetheless, the present work does delineate some differences with respect to the temporal requirement of phosphatases versus forces. Further, the authors describe impaired centriole separation in response to impairing the process of PCM disassembly, thereby adding some physiological significance. However, it is not apparent the present study presents enough of an advance to merit publication in eLife.

1) Would the authors please describe in more detail what they measure for their quantification of centrosome intensity? Is the ROI a defined shape/size? Do the authors include proteins that have ruptured and migrated away from the centriole? As written, the Materials and methods simply state the ROI "was selected manually". This merits a little more detail as a major conclusion is that changes in centrosomal intensity precede changes in volume (that is, dissolution occurs before rupture).

Reviewer #3:

Magescas et al. document the fine structure of the C. elegans centrosomal PCM, and two phases of its disassembly, in early embryonic cells. They show that the PCM consists of an inner core that includes the coiled coil proteins SPD-2 and SPD-5, along with γ-tubulin ring components, and an outer shell that includes SPD-5 and in part one γ-tubulin ring component (GIP-1) with a second γ-tubulin ring component (MTZ-1) extending beyond the inner core but extending only partially into the SPD-5/GIP-1 outer shell. The authors also document a two-step PCM dis-assembly process, with a PP2A phosphatase-dependent dissolution of some PCM components, and a cortical-force dependent rupture of the PCM that completes dis-assembly of the SPD-5 scaffold. These results significantly improve our understanding of C. elegans PCM structure and of PCM dis-assembly. However, before the manuscript can be considered suitable for publication in eLife, the authors need to address the following concerns.

1) In all of the figures, the authors show a dissolution of the PCM components SPD-2 and MTZ-1, without the rupture and packets observed for SPD-5 and GIP-1. However, the later time points do show two strong foci for SPD-2 and MTZ-1. Do these represent duplicated centrioles with associated PCM? The authors never described these foci in the text or figure legends and need to more fully describe the images they present for the reader to fully understand these results.

2) Similarly to the above comment (1), in the graphs showing quantification of packet intensity (Figure 2E), centrosomal intensity (Figure 3D) and volume at the centrosome (Figure 3E), are the authors excluding the bright foci for SPD-2 and MZT-1, or are the included? Because the graphs in some cases show signal levels close to zero, presumably these bright foci are somehow excluded, but the text and figure legends do not refer to this issue. Again, for clarity, the authors should more fully describe the image data in the figure legends and text. The Materials and methods seem to refer to this issue with respect to Figures 5E and 5F, but it is not clear to me exactly how these quantifications were done with respect to the two bright foci detected at later time points.

3) In Figure 2, the authors show that SPD-5 and GIP-1 are both found in packets during dis-assembly. However, Figure 2A shows SPD-5 present only in two foci in the "early packets", while there are several SPD-5 foci in early packets in Figure 2B. Thus the co-localization of SPD-5 and GIP-1 appears very limited early on. The authors do not refer to this in the text or legend. How extensive is the overlap between SPD-5 and GIP-1 in packets? Are there some packets with only one or the other, and some with both, and can the authors quantify this overlap? More information as to the exact nature of their co-localization would be helpful.

4) The authors refer to "rupture" and "packet formation" somewhat interchangeably. In the Figure 3 legend, they define these terms with reference to arrows, but they never refer to specific images that would clarify these terms. The authors should refer to specific images in the figures that show the "holes" in the SPD-5/GIP-1 matrix that constitute rupture, and images that show the appearance of individual packets. While the graphs in Figure 3 indicate rupture occurring at 6 minutes, SPD-5 is clearly fragmented at 5 minutes in Figure 3C, and something like "holes" are apparent at 4 minutes in Figure 3C. I am confused by the use of these two terms that seem to imply distinct phases in dis-assembly but also seem to be simply different stages of the same process. Some clarification of these terms would be helpful.

5) When addressing the cortical forces to promote packet formation/dis-assembly in Figure 4, the text refers to rupture starting at 6 minutes post-NEBD and packets forming at 8 minutes in the control/WT embryos (subsection “Cortical forces mediate the disassembly of the PCM and more specifically SPD-5”, second paragraph). However, the figure only goes to 7 minutes. Moreover, SPD-5 shows distinct puncta at 5 minutes in Figure 1A control, and what seem to be definite packets at 6 minutes. Thus the text description does not seem to be very consistent with what is shown in the figure. This needs clarification.

6) In the second paragraph of the subsection “Cortical forces mediate the disassembly of the PCM and more specifically SPD-5”, the authors refer to SPD-5 intensity and volume being increased or decreased by either grp-1/2 or csnk-1 depletion. What is being increased and what is being decreased, and in what background. I could not understand this sentence as written, and it seemed to me that in Figure 4 the knockdowns led only to increases.

7) In the second paragraph of the Discussion, the authors state that removal of PCM proteins from the inner sphere weakens the remaining PCM, allow for rupture of the outer sphere. This is stated as if it is a clear conclusion, but what data supports this interpretation/conclusion, or is it a model and speculation?

8) The authors cite Enos et al. 2018 as showing the PP2A and cortical forces have been shown to be required for PCM dis-assembly. Thus the two factors that contribute to dis-assembly have already been published. However, Enos et al. examined only SPD-5 and no other PCM components, and did not distinguish between dissolution and dissolution as two distinct processes. They simply refer to PP2A and cortical forces as two independent contributions without assigning them to distinct aspects of dis-assembly. The work by Enos et al. 2018 thus could be viewed as making the results presented here as somewhat incremental and perhaps better suited for publication in a more specialized journal. But Magescas et al. do provide novel findings concerning the layered nature of the PCM in C. elegans and a substantially more in depth analysis of PCM dis-assembly. The authors need to more explicitly address how their analysis goes beyond what was shown by Enos et al., either in the Results or the Discussion. This could be done briefly but it seems to me such a comparison is warranted, given the substantial amount of overlap in the two manuscripts. Similarly, has any evidence for this partial independence of SPD-2 and SPD-5 localization been previously noted?

[Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.]

Thank you for submitting your article "A two-step mechanism for the inactivation of microtubule organizing center function at the centrosome" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Anna Akhmanova as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

As you can see in the individual comments, all reviewers agreed that the newly submitted version of the manuscript has greatly improved over the previous version. Their comments are mostly straightforward and thus can be addressed without the guide of consolidated review.

Thus, we would like to invite you to submit the revision. Please provide point-by-point responses to review comments, such that we can reach the decision in a timely manner, once we receive the revision.

Reviewer #1:

This revised manuscript from Magescas, Zonka and Feldman thoroughly addresses the comments from all three reviewers on the original submission. The authors have added a substantial amount of new data (including centrosomal localization of several more proteins--PLK-1, TAC-1, ZYG-9, LET-92, AIR-1 and TPXL-1); additional inhibitor studies that uncouple the regulation of SPD-2 and SPD-5; and an interesting cell fusion experiments that suggest assembly and disassembly states are stable and resistant to influence from cytoplasms that promote the opposite processes. The authors also now include reference to Megraw et al. from JCB in 2002, in which cell cycle-dependent centrosome fragmentation was observed, and provide a more detailed comparison of their work to a recent publication (Enos et al. in BIology Open in 2018). I agree with the authors that their analysis is substantially more extensive and goes well beyond what has been reported previously, significantly advancing our understanding of centrosome disassembly. In my opinion the revised manuscript warrants publication in eLife.

Reviewer #2:

The manuscript by Magescas et al. is a resubmission/new submission from the Feldman lab on the topic of centrosome disassembly during mitotic exit. The study uses live cell imaging and RNAi in C. elegans to describe a two-step disassembly model of PCM – dissolution followed by rupture. The study shows that some centrosome components such as Spd2 follow the dissolution pathway of disassembly, while others such as Spd5 undergo rupture to generate packets of smaller PCM assemblies that move outward away from the centrioles. Overall, I found the study quite a bit improved over the previous version with addition of new experiments, references and discussion. I am also now convinced that it does goes sufficiently beyond the Enos 2018 study. I have one major comment.

1) Related to the description of spheres and the use of confocal microscopy. An important point in this paper is to define regions of the centrosome occupied by different proteins. The authors describe three regions: the centriole, the inner sphere, and the outer sphere. The description of these regions, along with comparison with other systems in which SIM was used, leaves the reader with the impression that Spd2 (and other proteins) occupies a toroid (donut) area surrounding the centriole with edges of 0.51-1.15, while Spd5 occupies a toroid (donut) with edges of 1.15-1.66. I think that the imaging method and data presented do not support this view. The intensity profiles in Figure 1B suggests that roughly 80-90% of Spd5 is actually found within Spd2 localization area from -1.15 and +1.15. Thus one cannot conclude that the proteins are in distinct locations.

The response by the authors related to the reviewer's comment about why SIM was not used in this study does not acknowledge SIM imaging done in Drosophila embryos (also a live organism) to describe centrosome zones (Lerit et al. 2015) and many publication form the Raff lab (such as Conduit et al. 2014) and even SIM in the worm (PMID: 28103229). I can only conclude that SIM is very much possible and routine. Given that SIM was not performed in this study, the authors' description of these proteins as "distinct localization", “discrete layers”, and "novel protein territories" (rebuttal letter) are not supported by the data. I recommend the following:

- Change the description to 'outer edge of the small spd2 sphere' and 'the outer edge of the larger Spd5 sphere'. That way the author will not misunderstand the localization as toroids.

- Indicate the outer edge measurements on Figure 1D.

- Report the% of total Spd5 that overlaps with Spd2 (between -1.15 and 1.15) and that falls outside of the Spd2 sphere (<-1.15 + >1.15) using the area under the curve. This way the reader will get a better impression that there is actually only a small amount of Spd5 that does not overlap with Spd2.

- Soften the comparison between these measurement and previous SIM reports. The data in this study shows no toroid structure other than TPXL-1 and AIR-1; thus the direct comparison to Cnn, for example, is not supported. A comparison to other systems should be reserved for a future SIM study.

These changes will not impact any of the subsequent results. I think it is even more intriguing that two proteins that mostly occupy the same area (in my estimate from the linescans that 80% of Spd5 overlaps with Spd2) can behave so differently.

Reviewer #3:

Largely through live imaging and quantitative analysis, Magescas and coworkers present a detailed study of PCM disassembly and the unique behaviors of several PCM constituents. In this resubmission, the authors present a more comprehensive localization analysis of endogenously tagged PCM molecules at mitotic centrosomes and corresponding time-lapse imaging of their disassembly. Additional experimentation includes extended pharmacological inhibition to parse apart relative contributions of the pro-maturation kinase CDK1 versus phosphatase activity, which also complement RNAi studies. Elegant cell fusions between mitotic P2 cells and ABp cells undergoing PCM disassembly test the competency of centrosomes to respond to presumptive cytoplasmic cues.

Strengths of the revised work include beautiful, carefully documented imaging which supports the conclusions: (1) PCM disassembly occurs by two distinct steps. First, a slow dissolution step that requires PP2A/phosphatase activity. Next, a more rapid rupturing phase rips the PCM apart in a MT-derived force-dependent manner. (2) The mitotic C. elegans centrosome shows a subconcentric organization consisting of distinct and separable zones, similar to those reported in cultured human and Drosophila cells and Drosophila embryos. (3) Several pieces of evidence support the conclusion that disassembly of Spd2 and Spd5 may be uncoupled. This point is significant given their interdependent localization to the PCM. (4) Analysis of these and other PCM molecules support the overall conclusion that inner zone molecules and outer zone molecules tend to be differentially regulated during the process of PCM disassembly. (5) As previously noted, another strength of the work in the physiological link between timely PCM disassembly and proper centriole separation kinetics.

This work contains several interesting insights and opens up many lines of future investigation; however, in the absence of more mechanistic insight, it is not apparent the present study presents enough of an advance to merit publication in eLife.

https://doi.org/10.7554/eLife.47867.023

Author response

[Editors’ note: the author responses to the first round of peer review follow.]

Reviewer #1:

[…] The topic is both interesting and important; centrosome disassembly, or dematuration, does not garner anywhere near the attention that centrosome maturation commands. Clearly dematuration is an active process and it is not simply PCM passively falling apart. This study, however, does not provide much new insight into disassembly. I outline this in detail below.

1) Centrosome fragmentation. I was surprise that there was no mention of the study from the Wadsworth lab from 2005 (Rusen and Wadsworth, 2005). The Wadsworth lab showed the same phenomenon of disassembling the centrosome into packets, or fragments, and their ability to nucleate microtubules. While the previous study was done in another system, observation of packets in of themselves is not particularly novel. Another example that the authors did mention are the flares from Drosophila embryos. Here the authors properly reference the work by Megraw, but they improperly state that the flares are present throughout the cell cycle. Flares form specifically during mitotic exit and they also release packets into the cytoplasm. This was shown in Lerit et al. 2015.

We thank the reviewer for this recommendation and now cite the Wadsworth paper in multiple places. We have also added a paragraph to our Discussion where we compare and contrast packets, flares, and centrosome fragments. These structures share some interesting similarities but also differ in some ways that we now highlight. In regards to the timing of flares, Megraw et al., 2002, stated that “The number of flares associated with centrosomes varies with the cell cycle. […] The intensity of flares is highest at cleavage telophase/interphase centrosomes and lowest at mitotic centrosomes, especially during metaphase and anaphase. In addition, Cnn appears to be associated with metaphase/anaphase centrosomes more tightly, giving the centrosome a more rounded appearance, with fewer of the projections that spawn flare particles seen on centrosomes at other phases of the cleavage cycle …”. The quantification shown in this paper indicates that flares are present during the entire span of the cell cycle, although the flares decrease in number and intensity in metaphase. In addition, the more recent study by Lerit et al., 2015, showed that flares are present and active throughout interphase. We have changed our statement concerning flares, highlighting the fact that packets are found during disassembly exclusively, while flares are mainly found during interphase and telophase.

2) The mechanism of centrosome disassembly. While the authors better describe the effects of reducing microtubule pulling forces (via Grp-1/2 loss), inhibition of PP2A function (drug treatment), and loss of Let-92 on centrosome disassembly, all of these experiments were previously reported in Enos et al., 2018. This previous study greatly reduces the enthusiasm for the current results. I think an advance to the field here would require the identification of PP2A targets.

We fully agree with the reviewer that we confirm the results that were published by Enos et al., 2017 while our experiments were underway. However, although some of the mechanistic aspects between the two papers appear similar on the surface, our manuscript has several important differences that we feel make it a more complete story of centrosome inactivation that will still appeal to a wide audience:

a) Enos et al. focused entirely on SPD-5, while our manuscript analyzes a more complete repertoire of PCM proteins and finds that SPD-5 removal is preceded by removal of several exclusively inner sphere proteins including SPD-2 and the γ-TuRC component MZT-1. Our data not only paint a more complete picture of centrosome inactivation, but also identify specific regulated steps in the disassembly process,

b) By looking at several PCM components, our study identifies novel protein territories within the C. elegans PCM. That known binding partners apparently localize to distinct regions of the PCM changes the way we think about the nature of PCM assembly and function,

c) We identify important behavioral differences in the manner by which PCM proteins are removed from the centrosome. Through this analysis we discovered a phase of gradual dissolution that precedes the formation of smaller sub-PCM ‘packets’ that retain MTOC potential. As Enos et al. only characterized SPD-5 and did not comment on its disassembly behavior, these modes of disassembly we find are completely novel and point to distinct regulatory mechanisms.

d) Although Enos et al. find a role for phosphatase activity and cortical forces in SPD-5 disassembly, again, we elucidate a more complete picture of how these mechanisms impact overall PCM disassembly. We find that centrosome inactivation is initiated by a dissolution behavior that appears to be controlled by phosphatase activity. This process potentially weakens the PCM, which is then fully cleared by cortical forces. While SPD-5 is dependent on cortical forces for its complete removal, we find that SPD-2 can be removed in the absence of cortical forces and instead relies on phosphatase activity for proper clearance.

e) We identify functional significance for the timely removal of PCM proteins; both subsequent centriole separation and accumulation of the next round of PCM are affected when SPD-5 is not properly cleared from the PCM,

f) Our study uses only endogenously tagged proteins for our analysis, rather than overexpressed transgenes, allowing us to more confidently describe endogenous behaviors and mechanisms.

These points have been added to the Discussion. We have also added additional experiments that further differentiate our paper from that of Enos. et al., 2017 and expand our understanding of PCM disassembly.

1) New localization studies reveal additional aspects of PCM organization and behavior: We imaged endogenously tagged PLK-1, TAC-1, ZYG-9, LET-92, AIR-1, and TPXL-1, measuring their distribution in the PCM (Figure 1 and Figure 1—figure supplement 1) as well as observing their disassembly behavior (Figure 1 and Figure 1—figure supplement 2). We found that these proteins also occupy distinct regions within the inner and outer sphere of PCM, notably with TAC-1 and binding partner ZYG-9 localization being distinguishable in the outer sphere, AIR-1 and TPXL-1 occupying an almost exclusively outer sphere donut localization, and AIR-1 and PLK-1 (two mitotic kinases) adopting complimentary localization patterns within the PCM. PLK-1 and TAC-1 were disassembled by dissolution, while ZYG-9, AIR-1, TPXL-1, and perhaps LET92 ruptured and formed packets. Intriguingly, AIR-1 and TPXL-1 appeared to rupture and spread onto microtubules several minutes before SPD-5 and GIP-1 rupture, suggesting that their reorganization might play key roles in the microtubule network reorganization leading to rupture of the remaining PCM proteins.

2) New inhibitor studies reveal the timing of phosphatase activity, a role for phosphatases in shaping PCM assembly, and uncouple the regulation of SPD-2 and SPD-5:

We wanted to test the model that phosphatase activity is present at the centrosome throughout mitosis and that disassembly is the result of continued phosphatase activity coupled to a decrease in kinase activity (Figure 6). We tested this model by observing the localization of LET-92, which we found to be associated with the centrosome throughout assembly and disassembly. We further tested this model by treating embryos at different times in mitosis with the CDK inhibitor flavopiridol (FP) and the broad-spectrum phosphatase inhibitor okadaic acid (OA). Our previous studies had indicated that FP treatment could force precocious disassembly of g-tubulin. We repeated this experiment in embryos expressing tagRFP::SPD-5; SPD-2::GFP and found that both of these proteins were also precociously disassembled by dissolution in the presence of FP. Notably, this precocious disassembly could be inhibited in the presence of both FP and OA, indicating that CDK activity on PCM assembly is normally opposed by phosphatase activity. Intriguingly, OA treatment alone stabilized the association of SPD-5 with the centrosome, but also forced the precocious removal of SPD-2 at NEBD. This experiment not only suggests that an OA sensitive phosphatase controls SPD-2 maintenance at the centrosome, but also further uncouples the regulation and centrosomal association of SPD-2 and SPD-5: SPD-2 leaves the centrosome without affecting the ability of SPD-5 to remain associated.

3) New cell fusion experiments indicate that the nature of the PCM changes throughout mitosis: PCM disassembly could merely be the exact converse of assembly, i.e. kinases catalyze the addition of PCM and phosphatases catalyze their subtraction. However, we found a role for cortical forces in outer sphere disassembly suggesting that phosphatases are not sufficient to remove total PCM from the centrosome, especially during the disassembly phase. These data as well as recent in vitro data support a model where the nature of the PCM changes throughout mitosis such that assembling and disassembling PCM are different. To test this model, we fused a cell with a disassembling centrosome (ABp) with a cell with an assembling centrosome (P1) to determine whether the cytoplasmic factors promoting either state had an effect on the other (Figure 6). We found PCM assembly and disassembly to be mutually resistant processes whereby the disassembling centrosome kept disassembling and the assembling centrosome kept assembling upon cell fusion. These results indicate that disassembling PCM is resistant to addition of new PCM by mitotic kinase and that assembling PCM is resistant to disassembly by disassembly competent cytoplasm. Intriguingly, once the old PCM was stripped from the disassembling centrosome, new PCM was precociously added in accordance with the influx of mitotic kinases upon cell fusion. These studies provide in vivo evidence for a change in the nature of the PCM throughout mitosis.

Together, these additional studies suggest that assembling PCM is regulated by both kinases and phosphatases that perhaps create a more mobile, fluid PCM state (Figure 7). With time, kinases are naturally inactivated in the cell cycle allowing phosphatase activity to dominate and remove a subset of inner sphere PCM. However, the nature of the PCM also changes such that the outer sphere PCM becomes resistant to removal by phosphoregulation, requiring mechanical disruption by cortical pulling forces for effective clearance.

3) Centrosome protein distribution. One exciting result was the finding that Spd-5 and Spd-2 do not occupy the same space in the centrosome. This could have important implications on how we view C. elegans PCM that might differ from current models. I was, however, surprised by the choice of imaging. The use of Structured Illumination Microscopy to define the regions occupied by centrosome protein is standard practice in the centrosome field. A localization study using SIM would be more appropriate, not simply because it is standard practice, but rather because SIM imaging has played a critical role in shaping current models and hypotheses regarding centrosome function.

We agree that SIM microscopy and other super-resolution techniques have been instrumental and a standard in the characterization of the organization of PCM proteins. To date, these studies have focused on characterizing PCM organization in cell lines, fixed samples, or isolated centrosomes (Fu et al., 2012, Lawo et al., 2012, Sonnen et al., 2012, Mennella et al., 2012). Here, we sought to understand PCM organization in a live organism by observing endogenously tagged proteins. Due to the nature of the sample, we were not able to use SIM microscopy or other super-resolution techniques. However, C. elegans PCM proteins displayed a dramatic difference in organization and behaviors such that we were still able to observe using conventional spinning-disk confocal microscopy. We agree that our conclusions are limited by our choice of imaging technique and have added a statement to this effect in the Discussion (second paragraph).

Reviewer #2:

[…] This is an informative study that adds mechanistic understanding to the important process of centrosome inactivation via PP2A and cortical pulling forces. However, much of this work appears to largely support the conclusions of Enos et al., 2018 published in Biology Open. Nonetheless, the present work does delineate some differences with respect to the temporal requirement of phosphatases versus forces. Further, the authors describe impaired centriole separation in response to impairing the process of PCM disassembly, thereby adding some physiological significance. However, it is not apparent the present study presents enough of an advance to merit publication in eLife.

1) Would the authors please describe in more detail what they measure for their quantification of centrosome intensity? Is the ROI a defined shape/size? Do the authors include proteins that have ruptured and migrated away from the centriole? As written, the Materials and methods simply state the ROI "was selected manually". This merits a little more detail as a major conclusion is that changes in centrosomal intensity precede changes in volume (that is, dissolution occurs before rupture).

We have now added additional details on the quantification of centrosomal intensity in the Materials and methods section (subsection “Intensity measurements”). We defined the ‘centrosomal’ region as the centrioles plus the region of the PCM that was physically connected to the centrioles as determined by our thresholding method. This region was manually selected for both the intensity and volume measurements. During the dissolution period, PCM intensity was effectively all of the imageable PCM as holes were not apparent in the PCM until several minutes later. Once rupture had occurred and holes became apparent, we only included the region of the PCM that was contiguous with the centrioles for intensity and volume measurements. The other non-contiguous regions were considered packets once they were clearly individualized from the centrioles and contiguous PCM.

Reviewer #3:

[…] Before the manuscript can be considered suitable for publication in eLife, the authors need to address the following concerns.

1) In all of the figures, the authors show a dissolution of the PCM components SPD-2 and MTZ-1, without the rupture and packets observed for SPD-5 and GIP-1. However, the later time points do show two strong foci for SPD-2 and MTZ-1. Do these represent duplicated centrioles with associated PCM? The authors never described these foci in the text or figure legends and need to more fully describe the images they present for the reader to fully understand these results.

The two bright foci are indeed the separating centrioles and newly forming centrosomes. We have indicated these structures in the figures with joined double arrows and have added a reference to them in the text (subsection “PCM proteins disassemble with different behaviors”, first paragraph) and figure legends.

2) Similarly to the above comment (1), in the graphs showing quantification of packet intensity (Figure 2E), centrosomal intensity (Figure 3D) and volume at the centrosome (Figure 3E), are the authors excluding the bright foci for SPD-2 and MZT-1, or are the included? Because the graphs in some cases show signal levels close to zero, presumably these bright foci are somehow excluded, but the text and figure legends do not refer to this issue. Again, for clarity, the authors should more fully describe the image data in the figure legends and text. The Materials and methods seem to refer to this issue with respect to Figures 5E and 5F, but it is not clear to me exactly how these quantifications were done with respect to the two bright foci detected at later time points.

Please see our response to Comment 1 of reviewer 2. For centrosomal intensity and volume, we manually measured the centrioles and physically contiguous PCM for our quantifications. Please note that our graphs show arbitrary units x 105 for intensity, so the minimum values are on the order of 20,000. Our volume measurements decrease to <1-2 microns3 but are not zero. This measurement would be the expectation for naked centrioles given their dimensions and the diffraction limited approach we used for our quantifications. Compared to the very large size of the mature centrosomes, this small size is even more exaggerated.

3) In Figure 2, the authors show that SPD-5 and GIP-1 are both found in packets during dis-assembly. However, Figure 2A shows SPD-5 present only in two foci in the "early packets", while there are several SPD-5 foci in early packets in Figure 2B. Thus the co-localization of SPD-5 and GIP-1 appears very limited early on. The authors do not refer to this in the text or legend. How extensive is the overlap between SPD-5 and GIP-1 in packets? Are there some packets with only one or the other, and some with both, and can the authors quantify this overlap? More information as to the exact nature of their co-localization would be helpful.

We had accidentally switched SPD-5 and GIP-1 single panel images in Figure 2A, although they were correctly colored in the merge. The proteins do colocalize in early packets, there is just significantly more SPD-5 than GIP-1 in packets. This co-localization is also short lived as later packets lose GIP-1 as well as microtubule association (Figure 2A and 2B, late packet).

Quantification of the overlap proved difficult due to the relatively dim nature of packets compared to the surrounding cytoplasm, the ephemeral nature of packets, and the mixture of packets with persistent PCM, thus prompting us to look at microtubules and EBP-2/EB1 to further confirm whether packets retain MTOC potential.

4) The authors refer to "rupture" and "packet formation" somewhat interchangeably. In the Figure 3 legend, they define these terms with reference to arrows, but they never refer to specific images that would clarify these terms. The authors should refer to specific images in the figures that show the "holes" in the SPD-5/GIP-1 matrix that constitute rupture, and images that show the appearance of individual packets. While the graphs in Figure 3 indicate rupture occurring at 6 minutes, SPD-5 is clearly fragmented at 5 minutes in Figure 3C, and something like "holes" are apparent at 4 minutes in Figure 3C. I am confused by the use of these two terms that seem to imply distinct phases in dis-assembly but also seem to be simply different stages of the same process. Some clarification of these terms would be helpful.

Rupture is a gradual process that begins with the formation of holes in the PCM and ultimately results in packet formation. We see some variation in when rupture occurs and have included images in the figures that represent the mean timing for clarity. We have also included a more thorough description of what we define as rupture in the text (subsection “PCM proteins disassemble with different behaviors”, last paragraph). We have also eliminated packet formation as an independent step in the figures for clarity as we consider it as part of rupture.

5) When addressing the cortical forces to promote packet formation/dis-assembly in Figure 4, the text refers to rupture starting at 6 minutes post-NEBD and packets forming at 8 minutes in the control/WT embryos (subsection “Cortical forces mediate the disassembly of the PCM and more specifically SPD-5”, second paragraph). However, the figure only goes to 7 minutes. Moreover, SPD-5 shows distinct puncta at 5 minutes in Figure 1A control, and what seem to be definite packets at 6 minutes. Thus the text description does not seem to be very consistent with what is shown in the figure. This needs clarification.

See our response to point 4 above. We have clarified what we mean by rupture in the text and included images in the figures that reflect the mean value for rupture, although there is some variation in the timing of this process. We have eliminated ‘packet formation’ as a discrete step as we see it as part of the process of rupture.

6) In the second paragraph of the subsection “Cortical forces mediate the disassembly of the PCM and more specifically SPD-5”, the authors refer to SPD-5 intensity and volume being increased or decreased by either grp-1/2 or csnk-1 depletion. What is being increased and what is being decreased, and in what background. I could not understand this sentence as written, and it seemed to me that in Figure 4 the knockdowns led only to increases.

We have clarified this admittedly confusing statement to reflect the decrease in SPD-5 intensity following csnk-1 depletion and the increase in SPD-5 intensity following grp-1/2 depletion: “Interestingly, SPD-5 levels at the PCM were increased by gpr-1/2 and decreased by csnk-1 depletion (Figure 4A, Figure 4—figure supplement 1A).”

7) In the second paragraph of the Discussion, the authors state that removal of PCM proteins from the inner sphere weakens the remaining PCM, allow for rupture of the outer sphere. This is stated as if it is a clear conclusion, but what data supports this interpretation/conclusion, or is it a model and speculation?

This statement was indeed meant to be speculation. We have reworked our Discussion considerably and have removed this statement.

8) The authors cite Enos et al., 2018, as showing the PP2A and cortical forces have been shown to be required for PCM dis-assembly. Thus the two factors that contribute to dis-assembly have already been published. However, Enos et al. examined only SPD-5 and no other PCM components, and did not distinguish between dissolution and dissolution as two distinct processes. They simply refer to PP2A and cortical forces as two independent contributions without assigning them to distinct aspects of dis-assembly. The work by Enos et al., 2018 thus could be viewed as making the results presented here as somewhat incremental and perhaps better suited for publication in a more specialized journal. But Magescas et al. do provide novel findings concerning the layered nature of the PCM in C. elegans and a substantially more in depth analysis of PCM dis-assembly. The authors need to more explicitly address how their analysis goes beyond what was shown by Enos et al., either in the Results or the Discussion. This could be done briefly but it seems to me such a comparison is warranted, given the substantial amount of overlap in the two manuscripts. Similarly, has any evidence for this partial independence of SPD-2 and SPD-5 localization been previously noted?

Please see our response to Comment 2 of reviewer 1. We have also modified the Discussion to highlight the differences between our two papers. We are unaware of any other indication in the literature of the partial independence of SPD-2 and SPD-5 and see even more support for this independence in our newly added inhibitor experiments where SPD-2 can be forced from the centrosome with no impact on SPD-5 localization.

[Editors' note: the author responses to the re-review follow.]

Reviewer #2:

[…] 1) Related to the description of spheres and the use of confocal microscopy. An important point in this paper is to define regions of the centrosome occupied by different proteins. The authors describe three regions: the centriole, the inner sphere, and the outer sphere. The description of these regions, along with comparison with other systems in which SIM was used, leaves the reader with the impression that Spd2 (and other proteins) occupies a toroid (donut) area surrounding the centriole with edges of 0.51-1.15, while Spd5 occupies a toroid (donut) with edges of 1.15-1.66. I think that the imaging method and data presented do not support this view. The intensity profiles in Figure 1B suggests that roughly 80-90% of Spd5 is actually found within Spd2 localization area from -1.15 and +1.15. Thus one cannot conclude that the proteins are in distinct locations.

We did not intend to give the impression that SPD-2 and SPD-5 form interlocking toroids, but rather that both SPD-2 and SPD-5 localize to the inner sphere and that only SPD-5 extends into the outer sphere. With our imaging approach, we cannot resolve whether there is a hole in either localization pattern where the centrioles reside. The only toroids we observed was with AIR-1 and TPXL-1, as has been previously reported. As measured by the distance from center at half maximum intensity, SPD-2 falls in a region between -0.575 – 0.575 ± 0.02 and SPD-5 falls in a region between -0.83 – 0.83 ± 0.03 µm. 77.8 ± 0.8% of SPD-5 is found in the SPD-2 delimited region. These values are now reported in the second paragraph of the subsection “C. elegans PCM is organized into an inner and outer sphere”. We have also changed our graph in Figure 1C and our cartoon in Figure 1D to make these points more clear.

The response by the authors related to the reviewer's comment about why SIM was not used in this study does not acknowledge SIM imaging done in Drosophila embryos (also a live organism) to describe centrosome zones (Lerit et al. 2015) and many publication form the Raff lab (such as Conduit et al. 2014) and even SIM in the worm (PMID: 28103229). I can only conclude that SIM is very much possible and routine. Given that SIM was not performed in this study, the authors' description of these proteins as "distinct localization", “discrete layers”, and "novel protein territories" (rebuttal letter) are not supported by the data. I recommend the following:

- Change the description to 'outer edge of the small spd2 sphere' and 'the outer edge of the larger Spd5 sphere'. That way the author will not misunderstand the localization as toroids.

We have changed our description to read:

“SPD-2 and SPD-5 localization at the PCM is co-dependent (Hamill et al., 2002; Kemp et al., 2004; Pelletier et al., 2004), however these proteins displayed distinct outer localization boundaries within the PCM; both SPD-2 and SPD-5 localized to a more proximal region surrounding the centrioles (distance from center at half maximum intensity for SPD-2: -0.575 – 0.575 ± 0.02 µm; 77.8 ± 0.8% of total SPD-5 overlapping with SPD-2 in this region), and SPD-5 extended more distally to a region lacking SPD-2 (distance from center at half maximum intensity for SPD-5: -0.83 – 0.83 ± 0.03 µm; Figure 1B-C). Based on the outer edge of these two matrix proteins, we divide the PCM into an ‘inner’ and ‘outer’ sphere, with the smaller inner sphere defined by the outer edge of SPD-2 localization and the larger outer sphere defined by the outer edge of SPD-5

localization (Figure 1D)”.

- Indicate the outer edge measurements on Figure 1D.

We have now reported this measurement (see above, and Figure 1 legend). We have also changed our graph in Figure 1C to more clearly depict the outer edges of localization (i.e. distance from center at half max intensity).

- Report the% of total Spd5 that overlaps with Spd2 (between -1.15 and 1.15) and that falls outside of the Spd2 sphere (<-1.15 + >1.15) using the area under the curve. This way the reader will get a better impression that there is actually only a small amount of Spd5 that does not overlap with Spd2.

We now report the percent total in the second paragraph of the subsection “C. elegans PCM is organized into an inner and outer sphere” (77.8 ± 0.8% of total SPD-5 overlapping with SPD-2 in this region).

- Soften the comparison between these measurement and previous SIM reports. The data in this study shows no toroid structure other than TPXL-1 and AIR-1; thus the direct comparison to Cnn, for example, is not supported. A comparison to other systems should be reserved for a future SIM study.

We have softened our comparison:

“Although our imaging approach did not allow us to resolve toroidal localization patterns of the majority of the PCM proteins we analyzed, the boundaries of PCM protein localization follows the general pattern of the predicted orthologs in Drosophila and human cells”.

https://doi.org/10.7554/eLife.47867.024

Article and author information

Author details

  1. Jérémy Magescas

    Department of Biology, Stanford University, Stanford, United States
    Contribution
    Conceptualization, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7832-0851

  2. Jenny C Zonka

    Department of Biology, Stanford University, Stanford, United States
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared

  3. Jessica L Feldman

    Department of Biology, Stanford University, Stanford, United States
    Contribution
    Conceptualization, Resources, Supervision, Funding acquisition, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing
    For correspondence
    feldmanj@stanford.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5210-5045

Funding

March of Dimes Foundation (Basil O'Connor Starter Scholar Research Award)

  • Jessica L Feldman

National Institutes of Health (DP2GM119136-01)

  • Jessica L Feldman

American Heart Association (Postdoctoral Fellowship)

  • Jérémy Magescas

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Kevin O’Connell, Jyoti Iyer, Dan Dickinson, and Bob Goldstein for CRISPR advice and protocols. We also thank Tim Stearns, Ariana Sanchez, Maria Sallee, and members of the Feldman lab for helpful discussions about the manuscript. Some of the nematode strains used in this work were provided by the Caenorhabditis Genetic Center, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by a March of Dimes Basil O’Connor Starter Scholar Research Award and an NIH New Innovator Award DP2GM119136-01 awarded to JLF. JM is supported by an American Heart Postdoctoral Fellowship.

Senior Editor

  1. Anna Akhmanova, Utrecht University, Netherlands

Reviewing Editor

  1. Yukiko M Yamashita, University of Michigan, United States

Version history

  1. Received: April 23, 2019
  2. Accepted: June 26, 2019
  3. Accepted Manuscript published: June 27, 2019 (version 1)
  4. Version of Record published: August 6, 2019 (version 2)

Copyright

© 2019, Magescas et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 3,665
    Page views
  • 522
    Downloads
  • 27
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jérémy Magescas
  2. Jenny C Zonka
  3. Jessica L Feldman
(2019)
A two-step mechanism for the inactivation of microtubule organizing center function at the centrosome
eLife 8:e47867.
https://doi.org/10.7554/eLife.47867

Categories and tags

Research organism

Further reading

    1. Cell Biology
    2. Microbiology and Infectious Disease

    Synchronization of oscillatory growth prepares fungal hyphae for fusion

    Valentin Wernet, Marius Kriegler ... Reinhard Fischer
    Research Article Updated

    Communication is crucial for organismic interactions, from bacteria, to fungi, to humans. Humans may use the visual sense to monitor the environment before starting acoustic interactions. In comparison, fungi, lacking a visual system, rely on a cell-to-cell dialogue based on secreted signaling molecules to coordinate cell fusion and establish hyphal networks. Within this dialogue, hyphae alternate between sending and receiving signals. This pattern can be visualized via the putative signaling protein Soft (SofT), and the mitogen-activated protein kinase MAK-2 (MakB) which are recruited in an alternating oscillatory manner to the respective cytoplasmic membrane or nuclei of interacting hyphae. Here, we show that signal oscillations already occur in single hyphae of Arthrobotrys flagrans in the absence of potential fusion partners (cell monologue). They were in the same phase as growth oscillations. In contrast to the anti-phasic oscillations observed during the cell dialogue, SofT and MakB displayed synchronized oscillations in phase during the monologue. Once two fusion partners came into each other’s vicinity, their oscillation frequencies slowed down (entrainment phase) and transit into anti-phasic synchronization of the two cells’ oscillations with frequencies of 104±28 s and 117±19 s, respectively. Single-cell oscillations, transient entrainment, and anti-phasic oscillations were reproduced by a mathematical model where nearby hyphae can absorb and secrete a limited molecular signaling component into a shared extracellular space. We show that intracellular Ca2+ concentrations oscillate in two approaching hyphae, and depletion of Ca2+ from the medium affected vesicle-driven extension of the hyphal tip, abolished the cell monologue and the anti-phasic synchronization of two hyphae. Our results suggest that single hyphae engage in a ‘monologue’ that may be used for exploration of the environment and can dynamically shift their extracellular signaling systems into a ‘dialogue’ to initiate hyphal fusion.

    1. Cell Biology
    2. Microbiology and Infectious Disease

    A CRISPR-based rapid DNA repositioning strategy and the early intranuclear life of HSV-1

    Juan Xiang, Chaoyang Fan ... Pei Xu
    Research Article Updated

    The relative positions of viral DNA genomes to the host intranuclear environment play critical roles in determining virus fate. Recent advances in the application of chromosome conformation capture-based sequencing analysis (3 C technologies) have revealed valuable aspects of the spatiotemporal interplay of viral genomes with host chromosomes. However, to elucidate the causal relationship between the subnuclear localization of viral genomes and the pathogenic outcome of an infection, manipulative tools are needed. Rapid repositioning of viral DNAs to specific subnuclear compartments amid infection is a powerful approach to synchronize and interrogate this dynamically changing process in space and time. Herein, we report an inducible CRISPR-based two-component platform that relocates extrachromosomal DNA pieces (5 kb to 170 kb) to the nuclear periphery in minutes (CRISPR-nuPin). Based on this strategy, investigations of herpes simplex virus 1 (HSV-1), a prototypical member of the human herpesvirus family, revealed unprecedently reported insights into the early intranuclear life of the pathogen: (I) Viral genomes tethered to the nuclear periphery upon entry, compared with those freely infecting the nucleus, were wrapped around histones with increased suppressive modifications and subjected to stronger transcriptional silencing and prominent growth inhibition. (II) Relocating HSV-1 genomes at 1 hr post infection significantly promoted the transcription of viral genes, termed an ‘Escaping’ effect. (III) Early accumulation of ICP0 was a sufficient but not necessary condition for ‘Escaping’. (IV) Subnuclear localization was only critical during early infection. Importantly, the CRISPR-nuPin tactic, in principle, is applicable to many other DNA viruses.

    1. Cell Biology

    Mitochondrial defects caused by PARL deficiency lead to arrested spermatogenesis and ferroptosis

    Enrico Radaelli, Charles-Antoine Assenmacher ... Marco Spinazzi
    Research Article Updated

    Impaired spermatogenesis and male infertility are common manifestations associated with mitochondrial diseases, yet the underlying mechanisms linking these conditions remain elusive. In this study, we demonstrate that mice deficient for the mitochondrial intra-membrane rhomboid protease PARL, a recently reported model of the mitochondrial encephalopathy Leigh syndrome, develop early testicular atrophy caused by a complete arrest of spermatogenesis during meiotic prophase I, followed by degeneration and death of arrested spermatocytes. This process is independent of neurodegeneration. Interestingly, genetic modifications of PINK1, PGAM5, and TTC19 – three major substrates of PARL with important roles in mitochondrial homeostasis – fail to reproduce or modify this severe phenotype, indicating that the spermatogenic arrest arises from distinct molecular pathways. We further observed severe abnormalities in mitochondrial ultrastructure in PARL-deficient spermatocytes, along with prominent electron transfer chain defects, disrupted coenzyme Q (CoQ) biosynthesis, and metabolic rewiring. These mitochondrial defects are associated with a germ cell-specific decrease in GPX4 expression leading arrested spermatocytes to ferroptosis – a regulated cell death modality characterized by uncontrolled lipid peroxidation. Our results suggest that mitochondrial defects induced by PARL depletion act as an initiating trigger for ferroptosis in primary spermatocytes through simultaneous effects on GPX4 and CoQ – two major inhibitors of ferroptosis. These findings shed new light on the potential role of ferroptosis in the pathogenesis of mitochondrial diseases and male infertility warranting further investigation.