Adaptive substitutions underlying cardiac glycoside insensitivity in insects exhibit epistasis in vivo
- Princeton University, United States
- University of Pittsburgh, United States
- University of Pittsburgh School of Medicine, United States
- Columbia University, United States
- Justus-Liebig-Universität Gießen, Germany
Figures
Figure 1 with 4 supplements
Deleterious effects of substitutions at positions 111 and 122 are ameliorated by the permissive substitution A119S.
(A) Patterns of amino acid substitution at sites implicated in CG sensitivity near the H1-H2 transmembrane domain of ATPα1 in representative species from six insect orders (see Supplementary file 1 …
Figure 1—figure supplement 1
Engineering strategy for generating amino acid substitution lines.
A targeted replacement of exons 2-6b with a mini-white gene was generated by ends-out homologous recombination. The mini-white gene was removed using Cre-lox site-specific recombination to create …
Figure 1—figure supplement 2
Phylogeny showing relationships of the sampled species.
In red are species known specialists on CG-containing plants or inferred to be CG-insensitive.
Figure 1—figure supplement 3
Variant sites in ATPα1 most strongly correlated with substitutions with site 119.
Shown is the distribution of P-values for strength of phylogenetic correlation between site 119 and 270 non-singleton amino acid variants in an alignment including 174 ATPα1 sequences representing …
Figure 1—figure supplement 4
Crystal structure of NKA bound to the cardiac glycoside ouabain (PDB:4HYT).
Estimated co-crystal structure of Drosophila melanogaster NKA bound to the cardiac glycoside (CG) ouabain. A homology model was constructed with Swiss-Model (Waterhouse et al., 2018; https://swissmod…
Figure 2 with 3 supplements
A119S ameliorates detrimental effects of CG-insensitivity substitutions on NKA function.
Plotted are relative activity as a function of increasing concentrations of the cardiac glycoside (CG) ouabain. (A) Inhibition curves are plotted for heterozygous individuals to allow comparison of …
Figure 2—figure supplement 1
Biphasic inhibition curve fitting allows the estimation of relative activities of two enzyme forms in a mixture.
(A) Shown in gray is the monophasic curve fit corresponding to observed data (gray points) for the D. melanogaster line one homozygous wild- type (+/+) construct. In black is a hypothetical biphasic …
Figure 2—figure supplement 2
Allele-specific expression (ASE) in heterozygous lines.
Allele-specific expression (ASE) in heterozygous lines. Estimates and 95% confidence intervals are based on Cochran-Mantel-Haenzel framework analysis – that is plotted is ‘relative risk’ of the …
Figure 2—figure supplement 3
Enzyme inhibition curves for Q111V (V) with and without A119S (S).
Following Figure 2, inhibition curves are plotted for heterozygous individuals to allow comparison of the effects of these substitutions in the presence and absence of A119S. Points represent …
Figure 3 with 2 supplements
A119S ameliorates detrimental effects of CG-insensitivity substitutions on neural function.
Plotted are recovery times for individuals (open circles), and means with approximate 95% confidence bounds (solid circles with whiskers), following mechanical over-stimulation (aka, the ‘bang …
Figure 3—figure supplement 1
Bang sensitivity phenotypes of lines with heterozygous substitutions at sites 104, 111 and 122.
Bang sensitivity phenotypes of lines with heterozygous substitutions at sites 104, 111 and 122. Δ2-6b is a loss of function deletion of ATPα1. Red letters indicate substitutions at position 111; …
Figure 3—figure supplement 2
Bang sensitivity phenotypes of substitutions at sites 111 and 122 on the background of A119S.
Bang sensitivity phenotypes of substitutions at sites 111 and 122 on the background of A119S. Δ2-6b is a loss of function deletion of ATPα1. Red letters indicate substitutions at position 111; green …
Figure 4 with 1 supplement
Adult survival upon 7 day exposure to the CG ouabain.
Plotted is the log relative risk for treatments (5, 10 or 20 mM ouabain) relative to no treatment controls (no ouabain) for (A) heterozygous strains and (B) homozygous strains. Estimates (points) …
Figure 4—figure supplement 1
Adult survival of all homozygous strains with A119S upon 7 day exposure to CGs.
Adult survival of homozygous strains with A119S upon 7 day exposure to CGs. Plotted is the log relative risk of treatment, for 5 mM (blue) or 10 mM (red) ouabain, relative to no treatment controls …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Drosophila melanogaster) | ATPalpha1 | NA | FLYB:FBgn0027548 | |
| Strain, strain background (D. melanogaster) | ATPalpha1 △2-6b founder line, w[1118];;ATPa△2-6b attP/TM6B,Tb[1] | this paper | N/A | available on request |
| Strain, strain background (D. melanogaster) | 15 engineered variants of ATPalpha1 | this paper | N/A | See Supplementary file 2, available on request |
| Genetic reagent (D. melanogaster) | y[1], w[67c23], P{y[+mDint2]=Crey}1b;;D[*]/TM3, Sb[1] | Bloomington Drosophila Stock Center | BDSC:851 FLYB:FBst0000851; RRID:BDSC_851 | Source of Cre protein |
| Genetic reagent (D. melanogaster) | w[*];;ry[506] Dr[1]/TM6B, P{w[+mC]=Dfd-EYFP}3, Sb[1],Tb[1],ca[1] | Bloomington Drosophila Stock Center | BDSC:8704 FLYB:FBst0008704; RRID:BDSC_8704 | Balancer, chr 3 |
| Sequence-based reagent | PCR/sequencing primers, Sanger-based sequencing | this paper | N/A | ATPa1 H1-H2 Forward: AAAACTTGGAGCGCGATGGT; ATPa1 H1-H2 Reverse: ATACGGTCGCCGAACTTCAC |
| Sequence-based reagent | PCR/sequencing primers for Illumina-based sequencing | this paper | N/A | ATPa1 H1-H2 Forward 2834: GTCTCGTGGGCTCGGCGCTTTCAGACACATCCCGA; ATPa1 H1-H2 Forward 3185: TCGTCGGCAGCGTCTGAGAAAATGCCCGTCACGA |
| Sequence-based reagent | PCR-added linker primers, Illumina-based sequencing | this paper | N/A | ATPa1 H1-H2 i5: AATGATACGGCGACCACCGAGATCTACACnnnnnnnnTCGTCGGCAGCGTCA; ATPa1 H1-H2 i7: CAAGCAGAAGACGGCATACGAGATnnnnnnnnGTCTCGTGGGCTCGG; where ‘nnnnnnnn’=any sequence index |
| Chemical compound, drug | Ouabain | Sigma | Cat#: O3125 | |
| Chemical compound, drug | Porcine sodium potassium ATPase, cerebral cortex | Millipore-Sigma | Cat#: A7510 | |
| Recombinant DNA reagent | pGX-attB-ATPa2-6b | this paper | N/A | available on request |
| Software, algorithm | PAML v4.8 | PMID: 17483113 | RRID:SCR_014932 | http://abacus.gene.ucl.ac.uk/software/paml.html |
| Software, algorithm | BayesTraits v3.01 | PMID: 16685633 | RRID:SCR_014487 | http://www.evolution.rdg.ac.uk/BayesTraitsV3.0.1/BayesTraitsV3.0.1.html |
| Other | multiple sequence alignment (protein) | this paper | N/A | Supplementary file 3 |
| Other | multiple sequence alignment (nucleotide) | this paper | N/A | Supplementary file 4 |
Additional files
-
Supplementary file 1
Summary of amino acid variation at sites implicated in CG-sensitivity of ATPαone in surveyed species.
Columns correspond to 35 sites implicated in cardenolide-sensitivity with the addition of six additional sites of interest (112, 114, 119, 787, 874, 898). Following convention, position is standardized relative to the sheep (Ovis aries) sequence NM_001009360 minus five amino acid residues from 5'end. The reference sequence refers to the consensus sequence among non-specialist species. A dot indicates identity with the reference sequence and dashes indicate missing data. Species highlighted in green are specialists on cardiac glycoside (CG) containing plants.
- https://doi.org/10.7554/eLife.48224.004
-
Supplementary file 2
Includes sources of sequence data used in this study, references for phylogenetic relationships a list of transgenic strains generated in this study.
- https://doi.org/10.7554/eLife.48224.017
-
Supplementary file 3
Fasta nucleotide sequence alignment of all sequences used in this study.
- https://doi.org/10.7554/eLife.48224.018
-
Supplementary file 4
Fasta amino acid sequence alignment of all sequences used in this study.
- https://doi.org/10.7554/eLife.48224.019
-
Transparent reporting form
- https://doi.org/10.7554/eLife.48224.020
