Figures and data in Native adiponectin in serum binds to mammalian cells expressing T-cadherin, but not AdipoRs or calreticulin

Figures
Tables
Additional files

3 figures, 1 table and 1 additional file

Figures

Figure 1 with 2 supplements

Download asset Open asset

Mouse serum adiponectin binds only to the hek293 cells expressing t-cadherin.

(A) Experimental outline. HEK293 cells were transfected with mammalian expression vectors coding mouse T-cadherin (*mCdh13*), Calreticulin (*mCalr*), or AdipoR1 (*mAdipor1*). (B) Native-page analysis of adiponectin preparations. Adiponectin concentrations were measured by ELISA and the equal amount (50 ng) of adiponectin was analyzed. (C) Absolute copy numbers of mRNA levels of mouse *mCdh13*, *mCalr*, *mAdipor1*, and *mAdipor2* were quantified. (D) Binding of adiponectin to HEK293 cells expressing none (N), mock (M), T-cadherin (T), or AdipoR1 (R1) (E) Dose-response cell-based binding study. Mouse serum (20 μg adiponectin/mL) was diluted and applied to the cells expressing mock or T-cadherin (left). The bound adiponectin was evaluated by blot intensity (right). Cell lysate following binding was separated by SDS-page and native-page. Essentially same results were obtained from more than three independent experiments.

https://doi.org/10.7554/eLife.48675.002

Figure 1—figure supplement 1

Download asset Open asset

Mouse serum adiponectin binding.

(A) Binding of mouse adiponectin in mouse serum to HEK293 cells. Multimer analysis of bound adiponectin by native page. Essentially same results were obtained from more than three independent experiments.

https://doi.org/10.7554/eLife.48675.003

Figure 1—figure supplement 2

Download asset Open asset

Human serum adiponectin binds only to the hek293 cells expressing t-cadherin.

(A) Experimental outline. HEK293 cells were transfected with mammalian expression vectors coding human T-cadherin (*hCDH13*), Calreticulin (*hCALR*), or AdipoR1 (*hADIPOR1*). (B) Absolute copy numbers of mRNA levels of human T-cadherin (*hCDH13*), Calreticulin (*hCALR*), AdipoR1 (*hADIPOR1*), and AdipoR2 (*hADIPOR2*) were quantified. (C) Binding of human adiponectin in human serum to HEK293 cells. (D) Multimer analysis of bound adiponectin by native page. Essentially same results were obtained from more than three independent experiments.

https://doi.org/10.7554/eLife.48675.004

Figure 2

Download asset Open asset

Cell surface expression of adiponectin receptors.

(A) Experimental outline of transient expression in HEK293 cells. (B) Surface protein biotinylation analysis. Cell surface biotinylated proteins trapped on Streptavidin beads were eluted and analyzed in SDS-page in two lanes; x1 and x5 concentrations. Note that PA-tag antibody NZ-1 react with human podoplanin (40 KDa) in addition to PA-tagged proteins. GAPDH; control cytosolic protein. (C) Binding of mouse adiponectin in mouse serum (MS) to HEK293 cells. (D) Experimental outline of stable CHO cells expressing adiponectin receptors. (E) stable expressions detected by NZ-1. (F) Binding of mouse adiponectin in mouse serum to CHO cells. Adiponectin-binding from western blots (left) was calculated and expressed in right graph. Data are mean ± SEM. n = 4 ***p<0.01 (unpaired t-test). (G) Binding of NZ-1 antibody to CHO cells. NZ-1-binding from western blots (left) was calculated and expressed in right graph. Data are mean ± SEM. n = 4 ***p<0.001 (unpaired t-test). (H) Confocal immunofluorescence micrographs of CHO cells stained with anti-PA tag antibody NZ-1 (green). Cell nuclei were counterstained with DAPI (blue). Scale bars = 250 nm.

https://doi.org/10.7554/eLife.48675.005

Figure 3

Download asset Open asset

Knockdown of T-cadherin but not Adipors nor calreticulin affected native adiponectin binding to c2c12 myotubes.

(A) Experimental outline. (B) Absolute expression levels of T-cadherin (*mCdh13*), AdipoR1 (*mAdipor1*), and AdipoR2 (*mAdipor2*) in differentiated C2C12 myotubes. (C) Knockdown efficiencies of adiponectin receptors. Data are mean ± SEM. n = 3 ***p<0.001 (unpaired t-test). (D) Binding of native adiponectin in mouse serum to C2C12 cells. Bound adiponectin was shown in representative western blot with a-tubulin as internal control and T-cadherin. (E) Adiponectin-binding. Data are mean ± SEM. n = 4 ***p<0.001 (unpaired t-test). (F) Amount of T-cadherin protein expression. Data are mean ± SEM. n = 4 ***p<0.001 (unpaired t-test). (G) Correlation between bound adiponectin and T-cadherin protein expression. n = 16 a linear regression r2 = 0.9896.

https://doi.org/10.7554/eLife.48675.006

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Antibody	anti-mouse adiponectin	R and D	AF1119	goat polyclonal WB (1:5000)
Antibody	anti-human adiponectin	R and D	AF1065	goat polyclonal WB (1:5000)
Antibody	anti-T-cadherin	R and D	AF3264	goat polyclonal WB (1:5000)
Antibody	anti-α-tubulin	Cell Signaling	11H10	rabbit polyclonal WB (1:1000)
Antibody	anti-PA-tag (NZ-1)	FUJIFILM	012–25863	rat monoclonal WB (1:1000)
Commercial assay, kit	Cell Surface Biotinylation Kit	Thermo Fisher (Pierce)	89881
Biological sample (Mus musculus)	Serum	CLEA Japan	C57BL6J jcl	Freshly isolated from C57BL6J mice, male
Biological sample (Homo sapiens)	Serum			Freshly isolated from healthy volunteers, male
Peptide, recombinant protein	Full-length mammalian recombinant mouse adiponectin	BioVendor	RD272023100
Peptide, recombinant protein	high-molecular weight purified mouse adiponectin	Fukuda et al., 2017
Sequence-based reagent	mRplp0_Fw	Gene Design		GGCCAATAAGGTGCCAGCT
Sequence-based reagent	mRplp0_Rv	Gene Design		TGATCAGCCCGAAGGAGAAG
Sequence-based reagent	Adipor1_Fw	Gene Design		AATGGGGCTCCTTCTGGTAAC
Sequence-based reagent	Adipor1_Rv	Gene Design		GGATGACTCTCCAACGTCCCT
Sequence-based reagent	Adipor2_Fw	Gene Design		GGAGTGTTCGTGGGCTTAGG
Sequence-based reagent	Adipor2_Rv	Gene Design		GCAGCTCCGGTGATATAGAGG
Sequence-based reagent	mCdh13_Fw	Gene Design		GCCCTCGTGAGCCTTCTTC
Sequence-based reagent	mCdh13_Rv	Gene Design		CACCCTGAGGTCCGTGATGT
Sequence-based reagent	mCalr_Fw	Gene Design		AAGATGCCCGATTTTACGCAC
Sequence-based reagent	mCalr_Rv	Gene Design		CCCACAGTCGATATTCTGCTC
Sequence-based reagent	hRPLP0_Fw	Gene Design		GGCGACCTGGAAGTCCAACT
Sequence-based reagent	hRPLP0_Rv	Gene Design		CCATCAGCACCACAGCCTTC
Sequence-based reagent	hCDH13_F	Gene Design		AGTGTTCCATATCAATCAGCCAG
Sequence-based reagent	hCDH13_R	Gene Design		CGAGACCTCATAGCGTAGCTT
Sequence-based reagent	hADIPOR1_F	Gene Design		TCCTGCCAGTAACAGGGAAG
Sequence-based reagent	hADIPOR1_R	Gene Design		GGTTGGCGATTACCCGTTTG
Sequence-based reagent	hADIPOR2_F	Gene Design		CTGGATGGTACACGAAGAGGT
Sequence-based reagent	hADIPOR2_R	Gene Design		TGGGCTTGTAAGAGAGGGGAC
Sequence-based reagent	hCALR_Fw	Gene Design		CTCTGTCGGCCAGTTTCGAG
Sequence-based reagent	hCALR_Rv	Gene Design		TGTATTCTGAGTCTCCGTGCAT
Cell line (Homo sapiens)	HEK293 cells	ATCC	CRL-1573 RRID:CVCL_0045	DMEM+10%FBS
Cell line (Cricetulus griseus)	CHO cells	ATCC	CCL-61 RRID:CVCL_0214	Ham's F12+10%FBS
Cell line (Homo sapiens)	Plat-E cells	Cosmobio	RV-101 RRID:CVCL_B488	Ecotropic retrovirus packaging DMEM+10%FBS
Cell line (Mus musculus)	C2C12 cells	RIKEN cell bank	RCB0987 RRID:CVCL_0188	C2C12 sleletal myoblast DMEM+10%FBS
Recomninant DNA reagent	mCdh13	This paper		Materials and methods: plasmids
Recomninant DNA reagent	mCalr	This paper		Materials and methods: plasmids
Recomninant DNA reagent	mAdipor1	This paper		Materials and methods: plasmids
Recomninant DNA reagent	hCDH13	This paper		Materials and methods: plasmids
Recomninant DNA reagent	hCALR	This paper		Materials and methods: plasmids
Recomninant DNA reagent	hADIPOR1	This paper		Materials and methods: plasmids
Recomninant DNA reagent	mCat1	This paper		Materials and methods: plasmids