Native adiponectin in serum binds to mammalian cells expressing T-cadherin, but not AdipoRs or calreticulin

Version of Record

Accepted for publication after peer review and revision.

Download
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

Version of Record published: October 31, 2019 (This version)
Accepted Manuscript published: October 24, 2019 (Go to version)
Accepted: October 13, 2019
Received: May 22, 2019

1. Of interest
Regulation of defective mitochondrial DNA accumulation and transmission in C. elegans by the programmed cell death and aging pathways

Sagen Flowers, Rushali Kothari ... Joel H Rothman

Research Article Oct 2, 2023
Further reading

Abstract
Introduction
Results and discussion
Materials and methods
Data availability
References
Decision letter
Author response
Article and author information
Metrics

Abstract

Adiponectin is an adipocyte-derived atypically abundant circulating factor that protects various organs and tissues through its receptors, AdipoRs, calreticulin, and T-cadherin. To identify the major binding partner of circulating native adiponectin, we expressed these receptors on the surface of HEK293 cells. Adiponectin, either that in mouse or human serum, purified from serum, or produced by mammalian cells, bound to cells expressing T-cadherin, but not to those expressing AdipoR1 or calreticulin. The stable introduction of T-cadherin and AdipoR1 into CHO cells resulted in the cell surface localization of these receptors. Native adiponectin in serum bound to cells expressing T-cadherin, not to those expressing AdipoR1. The knockdown of T-cadherin, but not AdipoRs resulted in the significant attenuation of native adiponectin binding to C2C12 myotubes. Therefore, native adiponectin binding depended on the amount of T-cadherin expressed in HEK293 cells, CHO cells, and C2C12 myotubes. Collectively, our mammalian cell-based studies suggest that T-cadherin is the major binding partner of native adiponectin in serum.

https://doi.org/10.7554/eLife.48675.001

Introduction

Adiponectin is a circulating factor that is secreted from adipocytes (Hu et al., 1996; Maeda et al., 1996; Nakano et al., 1996; Scherer et al., 1995). Three types of receptors have been identified for this uniquely abundant circulating protein: AdipoRs, calreticulin, and T-cadherin.

AdipoR1 was discovered by expression cloning from a C2C12 myotube cDNA library through evaluations of the binding of biotin-labeled globular adiponectin produced in E. coli as bait (Yamauchi et al., 2003). It belongs to the PAQR receptor family, which has a 7-transmembrane domain with an opposite topology to the GPCR family (Tang et al., 2005).

Calreticulin is an endoplasmic reticulum (ER) luminal Ca2+-buffering chaperone that exists in the ER of cells (Mendlov and Conconi, 2010; Michalak et al., 2009). Cell surface exposure to calreticulin was initially reported to initiate the clearance of viable or apoptotic cells through binding to LRP on phagocytes (Gardai et al., 2005). A subsequent study demonstrated that adiponectin opsonized apoptotic cells, and the phagocytosis of cell corpses was mediated by the binding of adiponectin expressed in insect cells or E. coli to calreticulin on the macrophage cell surface (Takemura et al., 2007).

T-Cadherin was discovered by expression cloning from a C2C12 myotube cDNA library through evaluations of cell binding to coated recombinant adiponectin produced in HEK293 mammalian cells (Hug et al., 2004). It is classified as a member of the classical cadherins, such as E-cadherin and N-cadherin, due to its high homology of five extracellular cadherin repeats (Hulpiau and van Roy, 2009). However, T-cadherin is a unique cadherin with a glycosylphosphatidylinositol (GPI) anchor on its C terminus and does not possess the transmembrane or intracellular domain generally required for signaling, which may hinder the function of T-cadherin as an adiponectin receptor.

The adiponectin protein accumulates in tissues, such as the heart, muscle, and vascular endothelium, through binding with T-cadherin (Denzel et al., 2010; Fujishima et al., 2017; Matsuda et al., 2015; Parker-Duffen et al., 2013; Tanaka et al., 2019). In T-cadherin null mice, the accumulation of the adiponectin protein was completely absent in these tissues, and, thus, HMW multimer adiponectin accumulated in blood (Denzel et al., 2010; Matsuda et al., 2015; Parker-Duffen et al., 2013). These findings were in contrast to the lack of significant changes in plasma adiponectin levels in AdipoR1- and R2-double knockout mice (Yamauchi et al., 2007). Human SNP studies including GWAS also indicated the importance of T-cadherin, but not AdipoRs or calreticulin, for plasma adiponectin levels, cardiovascular diseases, and glucose homeostasis (Buniello et al., 2019; Chung et al., 2011; Dastani et al., 2012; Kitamoto et al., 2016; Morisaki et al., 2012).

Numerous studies have attributed the functions of adiponectin to either of these receptors by showing a decrease in their functions via the genetic loss or mRNA knockdown of their receptors, including AdipoRs (Straub and Scherer, 2019; Yamauchi et al., 2014; Yamauchi et al., 2003; Yamauchi et al., 2007), calreticulin (Takemura et al., 2007), and T-cadherin (Denzel et al., 2010; Fujishima et al., 2017; Parker-Duffen et al., 2013; Tanaka et al., 2019). However, the direct binding of native adiponectin in biological fluids, such as serum, to its receptor warrants further study.

We herein demonstrated that native adiponectin in serum bound to cells expressing T-cadherin, but not to those expressing AdipoRs or calreticulin.

Results and discussion

We investigated the binding of native adiponectin in serum to three adiponectin receptors by transiently overexpressing the cDNA of each receptor in HEK293 cells (Figure 1A). We directly examined mouse serum as the ligand solution, including the most native adiponectin, purified adiponectin from mouse serum (Fukuda et al., 2017), and full-length recombinant adiponectin produced in HEK293 cells. Native-PAGE showed differences in the distribution of molecular species between serum or purified adiponectin and recombinant adiponectin (Figure 1B). Recombinant adiponectin contained a lower amount of HMW multimer adiponectin than mouse serum and purified adiponectin from serum (Figure 1B). Transient transfection resulted in the successful overexpression of each receptor based on their expression levels quantified by RT-qPCR (Figure 1C). The treatment of cells with different preparations of adiponectin at 4°C for 1 hr resulted in the binding of prepared adiponectin only to cells expressing mouse T-cadherin (Figure 1D). Mouse serum and purified adiponectin showed similar binding, whereas recombinant adiponectin containing a lower amount of 6-mer and the HMW multimer exhibited markedly weaker binding (Figure 1D). The results of a native-PAGE analysis showed that more than 6-mer of multimeric adiponectin specifically bound to cells expressing mouse T-cadherin (Figure 1—figure supplement 1), which is consistent with previous findings (Fukuda et al., 2017; Hug et al., 2004). The dose-response study revealed the specific and saturable binding of native adiponectin in serum to cells expressing T-cadherin (Figure 1E).

Figure 1 with 2 supplements see all

Download asset Open asset

Mouse serum adiponectin binds only to the hek293 cells expressing t-cadherin.

(A) Experimental outline. HEK293 cells were transfected with mammalian expression vectors coding mouse T-cadherin (*mCdh13*), Calreticulin (*mCalr*), or AdipoR1 (*mAdipor1*). (B) Native-page analysis of adiponectin preparations. Adiponectin concentrations were measured by ELISA and the equal amount (50 ng) of adiponectin was analyzed. (C) Absolute copy numbers of mRNA levels of mouse *mCdh13*, *mCalr*, *mAdipor1*, and *mAdipor2* were quantified. (D) Binding of adiponectin to HEK293 cells expressing none (N), mock (M), T-cadherin (T), or AdipoR1 (R1) (E) Dose-response cell-based binding study. Mouse serum (20 μg adiponectin/mL) was diluted and applied to the cells expressing mock or T-cadherin (left). The bound adiponectin was evaluated by blot intensity (right). Cell lysate following binding was separated by SDS-page and native-page. Essentially same results were obtained from more than three independent experiments.

https://doi.org/10.7554/eLife.48675.002

Similar results were obtained when human cDNAs were overexpressed and the binding of adiponectin in human serum was assessed (Figure 1—figure supplement 2A–D). We previously reported that purified recombinant T-cadherin bound purified adiponectin with an affinity of KD = 1.0 nM (Fukuda et al., 2017). The present results showed the saturable binding of native adiponectin in serum to cells expressing T-cadherin, which is consistent with previous findings (Fukuda et al., 2017). Regarding AdipoR1 and calreticulin, three possibilities have been proposed: they were not effectively translated, were not effectively presented on the cell surface, or did not support the binding of native adiponectin in serum to cells.

To confirm that all receptors were effectively translated and presented on the cell surface, we expressed affinity-tagged receptors in HEK293 cells (Figure 2A). We added a high-affinity PA tag (Fujii et al., 2014) to the N termini of T-cadherin (Ciatto et al., 2010) and calreticulin (Mendlov and Conconi, 2010) and to the C terminus of AdipoR1 (Yamauchi et al., 2014) such that each receptor exposed the PA tag outside of the cell. Transiently expressing cells were surface-biotinylated, and lysates were applied to streptavidin beads. Total cell lysates (Figure 2B Total) and streptavidin-captured cell-surface proteins (Figure 2B Cell surface) were analyzed by Western blotting. The anti-PA-tag antibody NZ-1 detected similar levels of all receptors in total cell lysates and cell surface fractions, indicating that these receptors were successfully translated and expressed on the cell surface. Although AdipoR1 poorly migrated on the SDS-PAGE gel, this may have been due to heat-induced protein crosslinking or aggregate formation during sample processing (Tanford and Reynolds, 1976). The correct sorting of this protein to the cell surface suggested that AdipoR1 was expressed with the correct conformation on the cell surface. Under these conditions, a binding study with mouse serum revealed the dose-dependent binding of native adiponectin to cells expressing PA-tagged T-cadherin, but not to those expressing PA-tagged calreticulin or AdipoR1 (Figure 2C). Taken together with the results of the overexpression study (Figure 1), native adiponectin in serum bound to cells expressing T-cadherin, but not those expressing calreticulin or AdipoR1.

Figure 2

Download asset Open asset

Cell surface expression of adiponectin receptors.

(A) Experimental outline of transient expression in HEK293 cells. (B) Surface protein biotinylation analysis. Cell surface biotinylated proteins trapped on Streptavidin beads were eluted and analyzed in SDS-page in two lanes; x1 and x5 concentrations. Note that PA-tag antibody NZ-1 react with human podoplanin (40 KDa) in addition to PA-tagged proteins. GAPDH; control cytosolic protein. (C) Binding of mouse adiponectin in mouse serum (MS) to HEK293 cells. (D) Experimental outline of stable CHO cells expressing adiponectin receptors. (E) stable expressions detected by NZ-1. (F) Binding of mouse adiponectin in mouse serum to CHO cells. Adiponectin-binding from western blots (left) was calculated and expressed in right graph. Data are mean ± SEM. n = 4 ***p<0.01 (unpaired t-test). (G) Binding of NZ-1 antibody to CHO cells. NZ-1-binding from western blots (left) was calculated and expressed in right graph. Data are mean ± SEM. n = 4 ***p<0.001 (unpaired t-test). (H) Confocal immunofluorescence micrographs of CHO cells stained with anti-PA tag antibody NZ-1 (green). Cell nuclei were counterstained with DAPI (blue). Scale bars = 250 nm.

https://doi.org/10.7554/eLife.48675.005

We then generated stably expressing CHO cells (Figure 2D). The successful expression of the receptors in these cells was confirmed by Western blotting (Figure 2E). Serum adiponectin binding was only observed on cells expressing PA-tagged T-cadherin (Figure 2F). In contrast, the binding of the PA tag antibody NZ-1 to intact cells was detected on cells expressing PA-tagged T-cadherin and AdipoR1 (Figure 2G). These results demonstrated that AdipoR1 was stably expressed on the cell surface with the expected topology of the PA tag outside of cells, but did not induce the binding of native adiponectin in serum. Calreticulin was not recognized by NZ-1 in the binding study (Figure 2G), suggesting that the PA tag at the N terminus of calreticulin was not accessible by NZ-1.

This may have been due to some steric hindrance because calreticulin with the N-terminal PA tag was detected on Western blots (Figure 2E) and immunostaining of fixed and permeabilized cells by NZ-1 (Figure 2H). Calreticulin is essentially an ER-resident protein (Gardai et al., 2005; Takemura et al., 2007). Therefore, stably expressed calreticulin in CHO cells may not have been sorted to the cell surface.

Based on these different approaches, we concluded that the expression of AdipoR1 may not promote native adiponectin binding. We also concluded that if calreticulin is expressed on the cell surface, it may not promote native adiponectin binding. The present results demonstrated that only the expression of T-cadherin on the cell surface may increase the binding of native adiponectin.

Since the above studies employed artificial expression systems, and AdipoR1 and T-cadherin were both identified from the C2C12 cDNA library (Hug et al., 2004; Yamauchi et al., 2003), we examined native adiponectin binding to C2C12 myotubes (Figure 3A). The absolute expression level of T-cadherin mRNA in differentiated C2C12 myotubes was markedly higher than that of AdipoRs (Figure 3B). We investigated the knockdown effects of these receptors on the binding of serum-containing adiponectin in C2C12 myotubes (Figure 3C,D). The introduction of RNAi before differentiation resulted in the effective knockdown of T-cadherin, AdipoR1, or AdipoR1 and R2 after 3 days of differentiation (Figure 3C). The knockdown of T-cadherin resulted in significant reductions in adiponectin binding (Figure 3D,E). The knockdown of AdipoR1 or both AdipoR1 and R2 did not significantly reduce adiponectin binding (Figure 3D,E). Although slight decreases were observed in adiponectin binding by the knockdown of AdipoR1 or both AdipoR1 and R2, the strong correlation (R² = 0.9896) between T-cadherin expression and adiponectin binding at all experimental points suggested that these changes were due to the decreased expression of T-cadherin (Figure 3F,G). Collectively, these results indicated that native adiponectin binding also depends on the amount of T-cadherin expressed in C2C12 myotubes.

Figure 3

Download asset Open asset

Knockdown of T-cadherin but not Adipors nor calreticulin affected native adiponectin binding to c2c12 myotubes.

(A) Experimental outline. (B) Absolute expression levels of T-cadherin (*mCdh13*), AdipoR1 (*mAdipor1*), and AdipoR2 (*mAdipor2*) in differentiated C2C12 myotubes. (C) Knockdown efficiencies of adiponectin receptors. Data are mean ± SEM. n = 3 ***p<0.001 (unpaired t-test). (D) Binding of native adiponectin in mouse serum to C2C12 cells. Bound adiponectin was shown in representative western blot with a-tubulin as internal control and T-cadherin. (E) Adiponectin-binding. Data are mean ± SEM. n = 4 ***p<0.001 (unpaired t-test). (F) Amount of T-cadherin protein expression. Data are mean ± SEM. n = 4 ***p<0.001 (unpaired t-test). (G) Correlation between bound adiponectin and T-cadherin protein expression. n = 16 a linear regression r2 = 0.9896.

https://doi.org/10.7554/eLife.48675.006

Here, we simultaneously compared three adiponectin receptors. The expression of T-cadherin gave adiponectin binding, which is consistent with our previous finding showing that recombinant T-cadherin binds HMW adiponectin in a 1: one ratio with high affinity (Fukuda et al., 2017). There was no detectable binding of adiponectin on the AdipoR or calreticulin. AdipoR was discovered by expression cloning. The overexpression of AdipoR was expected to promote ligand binding. The initial discovery of AdipoRs also indicated that HEK293 cells overexpressing AdipoRs bound E. coli recombinant globular adiponectin (Yamauchi et al., 2003). Therefore, difficulties are associated with speculating about the much weaker affinity or the requirement for some ‘accessory’ proteins to confer adiponectin binding activity to AdipoRs.

Since numerous studies indicated that AdipoRs mediate adiponectin signaling in a number of cell types, an additional activating mechanism for AdipoRs by adiponectin, that is, the reductive or proteolytic generation of the trimer, monomer, and/or globular adiponectin, may exist. The results of the present study, which focused on the direct binding of native HMW adiponectin, may indicate the activation of AdipoRs by low-molecular-weight (LMW) forms. On the other hand, in the case of calreticulin, this was evidenced by a neutralizing antibody treatment inhibiting the adiponectin interaction with cells (Takemura et al., 2007). Therefore, some ‘accessory’ proteins may be required to confer adiponectin binding activity to calreticulin.

T-cadherin binds clinically important HMW multimer adiponectin with high affinity (Fukuda et al., 2017) and mediates adiponectin-induced exosome biogenesis and ceramide efflux to exosomes (Obata et al., 2018). Such exosome-effect required T-cadherin, but not AdipoRs. The exosome mediates cell-cell communication by transferring signaling components such as microRNAs, bioactive lipids, and proteins in addition to its role in waste disposal (Kita et al., 2019; van Niel et al., 2018). The stimulation of exosome biogenesis by adiponectin was the first demonstration of a secreted factor modulating exosome biogenesis and secretion (Obata et al., 2018). Adiponectin in serum or purified native adiponectin together with T-cadherin accumulated inside multivesicular bodies, the site of exosome generation, both in cultured endothelial cells and the in vivo wild-type mouse aorta (Obata et al., 2018). The systemic level of exosomes in blood was decreased by approximately 50% following the genetic loss of adiponectin or T-cadherin, but was increased by the overexpression of adiponectin in mice (Obata et al., 2018). The molecular mechanisms by which adiponectin stimulates exosome biogenesis are currently under investigation. We speculate that native HMW adiponectin with its multimeric structure may cause the higher-order clustering of T-cadherin, a membrane-anchored protein that resides in lipid rafts, and, thus, may stimulate exosome biogenesis. Adiponectin-induced increases in exosome biogenesis were not restricted to cultured endothelial cells because they were also observed in C2C12-differentiated myotubes (Tanaka et al., 2019) These findings support T-cadherin mediating adiponectin functions as a receptor for native HMW multimer adiponectin (Kita et al., 2019). The present results may further contribute to clarifying the activating mechanism of AdipoRs by LMW adiponectin, generated by reduction or proteolytic cleavage, followed by HMW adiponectin binding to cell surface T-cadherin.

Materials and methods

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Antibody	anti-mouse adiponectin	R and D	AF1119	goat polyclonal WB (1:5000)
Antibody	anti-human adiponectin	R and D	AF1065	goat polyclonal WB (1:5000)
Antibody	anti-T-cadherin	R and D	AF3264	goat polyclonal WB (1:5000)
Antibody	anti-α-tubulin	Cell Signaling	11H10	rabbit polyclonal WB (1:1000)
Antibody	anti-PA-tag (NZ-1)	FUJIFILM	012–25863	rat monoclonal WB (1:1000)
Commercial assay, kit	Cell Surface Biotinylation Kit	Thermo Fisher (Pierce)	89881
Biological sample (Mus musculus)	Serum	CLEA Japan	C57BL6J jcl	Freshly isolated from C57BL6J mice, male
Biological sample (Homo sapiens)	Serum			Freshly isolated from healthy volunteers, male
Peptide, recombinant protein	Full-length mammalian recombinant mouse adiponectin	BioVendor	RD272023100
Peptide, recombinant protein	high-molecular weight purified mouse adiponectin	Fukuda et al., 2017
Sequence-based reagent	mRplp0_Fw	Gene Design		GGCCAATAAGGTGCCAGCT
Sequence-based reagent	mRplp0_Rv	Gene Design		TGATCAGCCCGAAGGAGAAG
Sequence-based reagent	Adipor1_Fw	Gene Design		AATGGGGCTCCTTCTGGTAAC
Sequence-based reagent	Adipor1_Rv	Gene Design		GGATGACTCTCCAACGTCCCT
Sequence-based reagent	Adipor2_Fw	Gene Design		GGAGTGTTCGTGGGCTTAGG
Sequence-based reagent	Adipor2_Rv	Gene Design		GCAGCTCCGGTGATATAGAGG
Sequence-based reagent	mCdh13_Fw	Gene Design		GCCCTCGTGAGCCTTCTTC
Sequence-based reagent	mCdh13_Rv	Gene Design		CACCCTGAGGTCCGTGATGT
Sequence-based reagent	mCalr_Fw	Gene Design		AAGATGCCCGATTTTACGCAC
Sequence-based reagent	mCalr_Rv	Gene Design		CCCACAGTCGATATTCTGCTC
Sequence-based reagent	hRPLP0_Fw	Gene Design		GGCGACCTGGAAGTCCAACT
Sequence-based reagent	hRPLP0_Rv	Gene Design		CCATCAGCACCACAGCCTTC
Sequence-based reagent	hCDH13_F	Gene Design		AGTGTTCCATATCAATCAGCCAG
Sequence-based reagent	hCDH13_R	Gene Design		CGAGACCTCATAGCGTAGCTT
Sequence-based reagent	hADIPOR1_F	Gene Design		TCCTGCCAGTAACAGGGAAG
Sequence-based reagent	hADIPOR1_R	Gene Design		GGTTGGCGATTACCCGTTTG
Sequence-based reagent	hADIPOR2_F	Gene Design		CTGGATGGTACACGAAGAGGT
Sequence-based reagent	hADIPOR2_R	Gene Design		TGGGCTTGTAAGAGAGGGGAC
Sequence-based reagent	hCALR_Fw	Gene Design		CTCTGTCGGCCAGTTTCGAG
Sequence-based reagent	hCALR_Rv	Gene Design		TGTATTCTGAGTCTCCGTGCAT
Cell line (Homo sapiens)	HEK293 cells	ATCC	CRL-1573 RRID:CVCL_0045	DMEM+10%FBS
Cell line (Cricetulus griseus)	CHO cells	ATCC	CCL-61 RRID:CVCL_0214	Ham's F12+10%FBS
Cell line (Homo sapiens)	Plat-E cells	Cosmobio	RV-101 RRID:CVCL_B488	Ecotropic retrovirus packaging DMEM+10%FBS
Cell line (Mus musculus)	C2C12 cells	RIKEN cell bank	RCB0987 RRID:CVCL_0188	C2C12 sleletal myoblast DMEM+10%FBS
Recomninant DNA reagent	mCdh13	This paper		Materials and methods: plasmids
Recomninant DNA reagent	mCalr	This paper		Materials and methods: plasmids
Recomninant DNA reagent	mAdipor1	This paper		Materials and methods: plasmids
Recomninant DNA reagent	hCDH13	This paper		Materials and methods: plasmids
Recomninant DNA reagent	hCALR	This paper		Materials and methods: plasmids
Recomninant DNA reagent	hADIPOR1	This paper		Materials and methods: plasmids
Recomninant DNA reagent	mCat1	This paper		Materials and methods: plasmids

Plasmids

General PCR techniques were used for the construction of plasmids. All primers were purchased from GeneDesign, Inc. The full-length cDNAs of human and mouse T-cadherin (mCdh13), AdipoR1 (mAdipor1), and calreticulin (mCalr) were cloned into pcDNA mammalian expression plasmid vectors. The PA tag sequence (GVAMPGAEDDVV) was attached to the N termini of mouse T-cadherin and calreticulin and the C terminus of AdipoR1. Mouse mCat1 cDNA was cloned into a pcDNA mammalian expression plasmid vector.

Cell lines

Request a detailed protocol

Mammalian cell lines were obtained from the American Type Culture Collection or RIKEN BRC CELL BANK. All cell lines negative for mycoplasma contamination were maintained under conditions indicated in Key resources table.

Stably expressing CHO cells

Request a detailed protocol

PA-tagged receptor cDNAs were subcloned into the retrovirus packaging vector pMXs-neo, and the resultant vectors were used to transfect Plat-E cells, thereby generating recombinant retroviruses. CHO cells were transfected with a mouse mCat plasmid, and after 48 hr, the resultant cells were infected with recombinant retroviruses. G418 at 800 μg/mL was used to select stably introduced cells.

Antibodies

The following primary antibodies were used: goat polyclonal anti-mouse adiponectin (AF1119, R and D), goat polyclonal anti-human adiponectin (AF1065, R and D), goat polyclonal anti-T-cadherin (AF3264, R and D), rabbit monoclonal anti-α-tubulin (11H10, Cell Signaling), rat monoclonal anti-PA-tag (human podoplanin PLAG sequence) (012–25863, FUJIFILM), and rabbit monoclonal anti-GPADH (14C10, Cell Signaling Technology).

Animal

Request a detailed protocol

Mouse serum was obtained from male and female C57BL6J jcl mice. Mice were maintained at 22°C under a 12:12 hr light-dark cycle (lights on from 8:00 AM to 8:00 PM). The experimental protocol was approved as No. 28-072-023 by the Ethics Review Committee for Animal Experimentation of Osaka University School of Medicine. This study also conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health.

Binding study

Request a detailed protocol

Adiponectin binding studies were performed using serum as the source of adiponectin in situ without any processing. Cells were treated with the indicated concentrations of serum in serum-free DMEM at 4°C for 1 hr and then washed with serum-free DMEM three times. NZ-1 binding was performed by incubating cells with 1.0 μg/mL NZ-1 in DMEM containing 0.2%BSA at 4°C for 1 hr and washed with serum-free DMEM three times. Cell lysates were combined with Laemmli sample buffer for SDS-PAGE and heated at 98°C for 5 min or combined with native-page buffer (Suzuki et al., 2007).

Adiponectin concentration

Request a detailed protocol

Adiponectin concentrations in sample preparations were measured by ELISA (Otsuka Pharmaceutical Co.).

Western blotting

Request a detailed protocol

Whole cell lysates were loaded onto 4–20% gradient SDS-PAGE gels (Bio-Rad) and transferred to nitrocellulose membranes. Membranes were blocked with PVDF Blocking Reagent for the Can Get signal (TOYOBO), incubated with primary antibodies using Can Get signal solution 1 (TOYOBO) at 4°C overnight, and then incubated with secondary antibodies conjugated with HRP using Can Get signal solution 2 (TOYOBO) at room temperature (RT) for 60 min. Chemiluminescence signals developed with Chemi-Lumi One Super (Nacalai Tesque) were visualized by ChemiDoc Touch and quantitated using Image Lab software (Bio-Rad). A native-PAGE analysis of the multimer composition of adiponectin was performed according to the method described (Suzuki et al., 2007).

Cell surface protein biotinylation

Request a detailed protocol

Cell surface protein biotinylation and subsequent isolation were performed using the Cell Surface Biotinylation Kit (Pierce) according to the instructions provided by the manufacturer.

Immunofluorescence staining

Request a detailed protocol

Cells on coverslips were fixed with periodate-lysine-paraformaldehyde (PLP) for 30 min and incubated with 3% w/v BSA and 0.3% w/v Triton X-100 in Dulbecco’s phosphate-buffered saline without calcium or magnesium (PBS) for 60 min. Cells were then incubated with 10 μg/mL NZ-1 at 4°C overnight and then incubated with an Alexa-Fluor 488 secondary antibody at RT for 60 min. Cell nuclei were counterstained with DAPI. A microscopy analysis was performed using an Olympus FV1000D confocal laser scanning microscope system (Olympus).

Statistical analysis

Request a detailed protocol

Values were expressed as the mean ± SEM. Differences between variables were compared using the Student’s t-test. The probability (P) values of <0.05 were considered to be significant.

Data and software availability

Request a detailed protocol

All data were deposited in Dryad at https://doi.org/10.5061/dryad.82557c0.

Data availability

All data were deposited in Dryad at https://doi.org/10.5061/dryad.82557c0.

The following data sets were generated

1. Kita S
2. Fukuda S
3. Maeda N
4. Shimomura I
(2019) Dryad Digital Repository
Data from: Native adiponectin in serum binds to cells expressing T-cadherin, but not AdipoRs or calreticulin.
https://doi.org/10.5061/dryad.82557c0

References

1. Buniello A
2. MacArthur JAL
3. Cerezo M
4. Harris LW
5. Hayhurst J
6. Malangone C
7. McMahon A
8. Morales J
9. Mountjoy E
10. Sollis E
11. Suveges D
12. Vrousgou O
13. Whetzel PL
14. Amode R
15. Guillen JA
16. Riat HS
17. Trevanion SJ
18. Hall P
19. Junkins H
20. Flicek P
21. Burdett T
22. Hindorff LA
23. Cunningham F
24. Parkinson H
(2019) The NHGRI-EBI GWAS catalog of published genome-wide association studies, targeted arrays and summary statistics 2019
Nucleic Acids Research 47:D1005–D1012.
https://doi.org/10.1093/nar/gky1120
- PubMed
- Google Scholar
1. Chung CM
2. Lin TH
3. Chen JW
4. Leu HB
5. Yang HC
6. Ho HY
7. Ting CT
8. Sheu SH
9. Tsai WC
10. Chen JH
11. Lin SJ
12. Chen YT
13. Pan WH
(2011) A genome-wide association study reveals a quantitative trait locus of adiponectin on CDH13 that predicts cardiometabolic outcomes
Diabetes 60:2417–2423.
https://doi.org/10.2337/db10-1321
- PubMed
- Google Scholar
1. Ciatto C
2. Bahna F
3. Zampieri N
4. VanSteenhouse HC
5. Katsamba PS
6. Ahlsen G
7. Harrison OJ
8. Brasch J
9. Jin X
10. Posy S
11. Vendome J
12. Ranscht B
13. Jessell TM
14. Honig B
15. Shapiro L
(2010) T-cadherin structures reveal a novel adhesive binding mechanism
Nature Structural & Molecular Biology 17:339–347.
https://doi.org/10.1038/nsmb.1781
- PubMed
- Google Scholar
1. Dastani Z
2. Hivert MF
3. Timpson N
4. Perry JR
5. Yuan X
6. Scott RA
7. Henneman P
8. Heid IM
9. Kizer JR
10. Lyytikäinen LP
11. Fuchsberger C
12. Tanaka T
13. Morris AP
14. Small K
15. Isaacs A
16. Beekman M
17. Coassin S
18. Lohman K
19. Qi L
20. Kanoni S
21. Pankow JS
22. Uh HW
23. Wu Y
24. Bidulescu A
25. Rasmussen-Torvik LJ
26. Greenwood CM
27. Ladouceur M
28. Grimsby J
29. Manning AK
30. Liu CT
31. Kooner J
32. Mooser VE
33. Vollenweider P
34. Kapur KA
35. Chambers J
36. Wareham NJ
37. Langenberg C
38. Frants R
39. Willems-Vandijk K
40. Oostra BA
41. Willems SM
42. Lamina C
43. Winkler TW
44. Psaty BM
45. Tracy RP
46. Brody J
47. Chen I
48. Viikari J
49. Kähönen M
50. Pramstaller PP
51. Evans DM
52. St Pourcain B
53. Sattar N
54. Wood AR
55. Bandinelli S
56. Carlson OD
57. Egan JM
58. Böhringer S
59. van Heemst D
60. Kedenko L
61. Kristiansson K
62. Nuotio ML
63. Loo BM
64. Harris T
65. Garcia M
66. Kanaya A
67. Haun M
68. Klopp N
69. Wichmann HE
70. Deloukas P
71. Katsareli E
72. Couper DJ
73. Duncan BB
74. Kloppenburg M
75. Adair LS
76. Borja JB
77. Wilson JG
78. Musani S
79. Guo X
80. Johnson T
81. Semple R
82. Teslovich TM
83. Allison MA
84. Redline S
85. Buxbaum SG
86. Mohlke KL
87. Meulenbelt I
88. Ballantyne CM
89. Dedoussis GV
90. Hu FB
91. Liu Y
92. Paulweber B
93. Spector TD
94. Slagboom PE
95. Ferrucci L
96. Jula A
97. Perola M
98. Raitakari O
99. Florez JC
100. Salomaa V
101. Eriksson JG
102. Frayling TM
103. Hicks AA
104. Lehtimäki T
105. Smith GD
106. Siscovick DS
107. Kronenberg F
108. van Duijn C
109. Loos RJ
110. Waterworth DM
111. Meigs JB
112. Dupuis J
113. Richards JB
114. Voight BF
115. Scott LJ
116. Steinthorsdottir V
117. Dina C
118. Welch RP
119. Zeggini E
120. Huth C
121. Aulchenko YS
122. Thorleifsson G
123. McCulloch LJ
124. Ferreira T
125. Grallert H
126. Amin N
127. Wu G
128. Willer CJ
129. Raychaudhuri S
130. McCarroll SA
131. Hofmann OM
132. Segrè AV
133. van Hoek M
134. Navarro P
135. Ardlie K
136. Balkau B
137. Benediktsson R
138. Bennett AJ
139. Blagieva R
140. Boerwinkle E
141. Bonnycastle LL
142. Boström KB
143. Bravenboer B
144. Bumpstead S
145. Burtt NP
146. Charpentier G
147. Chines PS
148. Cornelis M
149. Crawford G
150. Doney AS
151. Elliott KS
152. Elliott AL
153. Erdos MR
154. Fox CS
155. Franklin CS
156. Ganser M
157. Gieger C
158. Grarup N
159. Green T
160. Griffin S
161. Groves CJ
162. Guiducci C
163. Hadjadj S
164. Hassanali N
165. Herder C
166. Isomaa B
167. Jackson AU
168. Johnson PR
169. Jørgensen T
170. Kao WH
171. Kong A
172. Kraft P
173. Kuusisto J
174. Lauritzen T
175. Li M
176. Lieverse A
177. Lindgren CM
178. Lyssenko V
179. Marre M
180. Meitinger T
181. Midthjell K
182. Morken MA
183. Narisu N
184. Nilsson P
185. Owen KR
186. Payne F
187. Petersen AK
188. Platou C
189. Proença C
190. Prokopenko I
191. Rathmann W
192. Rayner NW
193. Robertson NR
194. Rocheleau G
195. Roden M
196. Sampson MJ
197. Saxena R
198. Shields BM
199. Shrader P
200. Sigurdsson G
201. Sparsø T
202. Strassburger K
203. Stringham HM
204. Sun Q
205. Swift AJ
206. Thorand B
207. Tichet J
208. Tuomi T
209. van Dam RM
210. van Haeften TW
211. van Herpt T
212. van Vliet-Ostaptchouk JV
213. Walters GB
214. Weedon MN
215. Wijmenga C
216. Witteman J
217. Bergman RN
218. Cauchi S
219. Collins FS
220. Gloyn AL
221. Gyllensten U
222. Hansen T
223. Hide WA
224. Hitman GA
225. Hofman A
226. Hunter DJ
227. Hveem K
228. Laakso M
229. Morris AD
230. Palmer CN
231. Rudan I
232. Sijbrands E
233. Stein LD
234. Tuomilehto J
235. Uitterlinden A
236. Walker M
237. Watanabe RM
238. Abecasis GR
239. Boehm BO
240. Campbell H
241. Daly MJ
242. Hattersley AT
243. Pedersen O
244. Barroso I
245. Groop L
246. Sladek R
247. Thorsteinsdottir U
248. Wilson JF
249. Illig T
250. Froguel P
251. van Duijn CM
252. Stefansson K
253. Altshuler D
254. Boehnke M
255. McCarthy MI
256. Soranzo N
257. Wheeler E
258. Glazer NL
259. Bouatia-Naji N
260. Mägi R
261. Randall J
262. Elliott P
263. Rybin D
264. Dehghan A
265. Hottenga JJ
266. Song K
267. Goel A
268. Lajunen T
269. Doney A
270. Cavalcanti-Proença C
271. Kumari M
272. Timpson NJ
273. Zabena C
274. Ingelsson E
275. An P
276. O'Connell J
277. Luan J
278. Elliott A
279. McCarroll SA
280. Roccasecca RM
281. Pattou F
282. Sethupathy P
283. Ariyurek Y
284. Barter P
285. Beilby JP
286. Ben-Shlomo Y
287. Bergmann S
288. Bochud M
289. Bonnefond A
290. Borch-Johnsen K
291. Böttcher Y
292. Brunner E
293. Bumpstead SJ
294. Chen YD
295. Chines P
296. Clarke R
297. Coin LJ
298. Cooper MN
299. Crisponi L
300. Day IN
301. de Geus EJ
302. Delplanque J
303. Fedson AC
304. Fischer-Rosinsky A
305. Forouhi NG
306. Franzosi MG
307. Galan P
308. Goodarzi MO
309. Graessler J
310. Grundy S
311. Gwilliam R
312. Hallmans G
313. Hammond N
314. Han X
315. Hartikainen AL
316. Hayward C
317. Heath SC
318. Hercberg S
319. Hillman DR
320. Hingorani AD
321. Hui J
322. Hung J
323. Kaakinen M
324. Kaprio J
325. Kesaniemi YA
326. Kivimaki M
327. Knight B
328. Koskinen S
329. Kovacs P
330. Kyvik KO
331. Lathrop GM
332. Lawlor DA
333. Le Bacquer O
334. Lecoeur C
335. Li Y
336. Mahley R
337. Mangino M
338. Martínez-Larrad MT
339. McAteer JB
340. McPherson R
341. Meisinger C
342. Melzer D
343. Meyre D
344. Mitchell BD
345. Mukherjee S
346. Naitza S
347. Neville MJ
348. Orrù M
349. Pakyz R
350. Paolisso G
351. Pattaro C
352. Pearson D
353. Peden JF
354. Pedersen NL
355. Pfeiffer AF
356. Pichler I
357. Polasek O
358. Posthuma D
359. Potter SC
360. Pouta A
361. Province MA
362. Rayner NW
363. Rice K
364. Ripatti S
365. Rivadeneira F
366. Rolandsson O
367. Sandbaek A
368. Sandhu M
369. Sanna S
370. Sayer AA
371. Scheet P
372. Seedorf U
373. Sharp SJ
374. Shields B
375. Sigurðsson G
376. Sijbrands EJ
377. Silveira A
378. Simpson L
379. Singleton A
380. Smith NL
381. Sovio U
382. Swift A
383. Syddall H
384. Syvänen AC
385. Tönjes A
386. Uitterlinden AG
387. van Dijk KW
388. Varma D
389. Visvikis-Siest S
390. Vitart V
391. Vogelzangs N
392. Waeber G
393. Wagner PJ
394. Walley A
395. Ward KL
396. Watkins H
397. Wild SH
398. Willemsen G
399. Witteman JC
400. Yarnell JW
401. Zelenika D
402. Zethelius B
403. Zhai G
404. Zhao JH
405. Zillikens MC
406. Borecki IB
407. Meneton P
408. Magnusson PK
409. Nathan DM
410. Williams GH
411. Silander K
412. Bornstein SR
413. Schwarz P
414. Spranger J
415. Karpe F
416. Shuldiner AR
417. Cooper C
418. Serrano-Ríos M
419. Lind L
420. Palmer LJ
421. Hu FB
422. Franks PW
423. Ebrahim S
424. Marmot M
425. Kao WH
426. Pramstaller PP
427. Wright AF
428. Stumvoll M
429. Hamsten A
430. Buchanan TA
431. Valle TT
432. Rotter JI
433. Penninx BW
434. Boomsma DI
435. Cao A
436. Scuteri A
437. Schlessinger D
438. Uda M
439. Ruokonen A
440. Jarvelin MR
441. Peltonen L
442. Mooser V
443. Sladek R
444. Musunuru K
445. Smith AV
446. Edmondson AC
447. Stylianou IM
448. Koseki M
449. Pirruccello JP
450. Chasman DI
451. Johansen CT
452. Fouchier SW
453. Peloso GM
454. Barbalic M
455. Ricketts SL
456. Bis JC
457. Feitosa MF
458. Orho-Melander M
459. Melander O
460. Li X
461. Li M
462. Cho YS
463. Go MJ
464. Kim YJ
465. Lee JY
466. Park T
467. Kim K
468. Sim X
469. Ong RT
470. Croteau-Chonka DC
471. Lange LA
472. Smith JD
473. Ziegler A
474. Zhang W
475. Zee RY
476. Whitfield JB
477. Thompson JR
478. Surakka I
479. Spector TD
480. Smit JH
481. Sinisalo J
482. Scott J
483. Saharinen J
484. Sabatti C
485. Rose LM
486. Roberts R
487. Rieder M
488. Parker AN
489. Pare G
490. O'Donnell CJ
491. Nieminen MS
492. Nickerson DA
493. Montgomery GW
494. McArdle W
495. Masson D
496. Martin NG
497. Marroni F
498. Lucas G
499. Luben R
500. Lokki ML
501. Lettre G
502. Launer LJ
503. Lakatta EG
504. Laaksonen R
505. Kyvik KO
506. König IR
507. Khaw KT
508. Kaplan LM
509. Johansson Å
510. Janssens AC
511. Igl W
512. Hovingh GK
513. Hengstenberg C
514. Havulinna AS
515. Hastie ND
516. Harris TB
517. Haritunians T
518. Hall AS
519. Groop LC
520. Gonzalez E
521. Freimer NB
522. Erdmann J
523. Ejebe KG
524. Döring A
525. Dominiczak AF
526. Demissie S
527. Deloukas P
528. de Faire U
529. Crawford G
530. Chen YD
531. Caulfield MJ
532. Boekholdt SM
533. Assimes TL
534. Quertermous T
535. Seielstad M
536. Wong TY
537. Tai ES
538. Feranil AB
539. Kuzawa CW
540. Taylor HA
541. Gabriel SB
542. Holm H
543. Gudnason V
544. Krauss RM
545. Ordovas JM
546. Munroe PB
547. Kooner JS
548. Tall AR
549. Hegele RA
550. Kastelein JJ
551. Schadt EE
552. Strachan DP
553. Reilly MP
554. Samani NJ
555. Schunkert H
556. Cupples LA
557. Sandhu MS
558. Ridker PM
559. Rader DJ
560. Kathiresan S
561. DIAGRAM+ Consortium
562. MAGIC Consortium
563. GLGC Investigators
564. MuTHER Consortium
565. DIAGRAM Consortium
566. GIANT Consortium
567. Global B Pgen Consortium
568. Procardis Consortium
569. MAGIC investigators
570. GLGC Consortium
(2012) Novel loci for adiponectin levels and their influence on type 2 diabetes and metabolic traits: a multi-ethnic meta-analysis of 45,891 individuals
PLOS Genetics 8:e1002607.
https://doi.org/10.1371/journal.pgen.1002607
- PubMed
- Google Scholar
(2010) T-cadherin is critical for adiponectin-mediated cardioprotection in mice
Journal of Clinical Investigation 120:4342–4352.
https://doi.org/10.1172/JCI43464
- PubMed
- Google Scholar
1. Fujii Y
2. Kaneko M
3. Neyazaki M
4. Nogi T
5. Kato Y
6. Takagi J
(2014) PA tag: a versatile protein tagging system using a super high affinity antibody against a dodecapeptide derived from human podoplanin
Protein Expression and Purification 95:240–247.
https://doi.org/10.1016/j.pep.2014.01.009
- PubMed
- Google Scholar
1. Fujishima Y
2. Maeda N
3. Matsuda K
4. Masuda S
5. Mori T
6. Fukuda S
7. Sekimoto R
8. Yamaoka M
9. Obata Y
10. Kita S
11. Nishizawa H
12. Funahashi T
13. Ranscht B
14. Shimomura I
(2017) Adiponectin association with T-cadherin protects against neointima proliferation and atherosclerosis
The FASEB Journal 31:1571–1583.
https://doi.org/10.1096/fj.201601064R
- PubMed
- Google Scholar
1. Fukuda S
2. Kita S
3. Obata Y
4. Fujishima Y
5. Nagao H
6. Masuda S
7. Tanaka Y
8. Nishizawa H
9. Funahashi T
10. Takagi J
11. Maeda N
12. Shimomura I
(2017) The unique prodomain of T-cadherin plays a key role in adiponectin binding with the essential extracellular cadherin repeats 1 and 2
Journal of Biological Chemistry 292:7840–7849.
https://doi.org/10.1074/jbc.M117.780734
- PubMed
- Google Scholar
(2005) Cell-surface calreticulin initiates clearance of viable or apoptotic cells through trans-activation of LRP on the phagocyte
Cell 123:321–334.
https://doi.org/10.1016/j.cell.2005.08.032
- PubMed
- Google Scholar
(1996) AdipoQ is a novel adipose-specific gene dysregulated in obesity
Journal of Biological Chemistry 271:10697–10703.
https://doi.org/10.1074/jbc.271.18.10697
- PubMed
- Google Scholar
1. Hug C
2. Wang J
3. Ahmad NS
4. Bogan JS
5. Tsao TS
6. Lodish HF
(2004) T-cadherin is a receptor for hexameric and high-molecular-weight forms of Acrp30/adiponectin
PNAS 101:10308–10313.
https://doi.org/10.1073/pnas.0403382101
- PubMed
- Google Scholar
1. Hulpiau P
2. van Roy F
(2009) Molecular evolution of the cadherin superfamily
The International Journal of Biochemistry & Cell Biology 41:349–369.
https://doi.org/10.1016/j.biocel.2008.09.027
- PubMed
- Google Scholar
(2019) Interorgan communication by exosomes, adipose tissue, and adiponectin in metabolic syndrome
Journal of Clinical Investigation 129:4041–4049.
https://doi.org/10.1172/JCI129193
- PubMed
- Google Scholar
1. Kitamoto A
2. Kitamoto T
3. Nakamura T
4. Matsuo T
5. Nakata Y
6. Hyogo H
7. Ochi H
8. Kamohara S
9. Miyatake N
10. Kotani K
11. Mineo I
12. Wada J
13. Ogawa Y
14. Yoneda M
15. Nakajima A
16. Funahashi T
17. Miyazaki S
18. Tokunaga K
19. Masuzaki H
20. Ueno T
21. Chayama K
22. Hamaguchi K
23. Yamada K
24. Hanafusa T
25. Oikawa S
26. Sakata T
27. Tanaka K
28. Matsuzawa Y
29. Hotta K
(2016) CDH13 polymorphisms are associated with adiponectin levels and metabolic syndrome traits independently of visceral fat mass
Journal of Atherosclerosis and Thrombosis 23:309–319.
https://doi.org/10.5551/jat.31567
- PubMed
- Google Scholar
(1996) cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (AdiPose most abundant gene transcript 1)
Biochemical and Biophysical Research Communications 221:286–289.
https://doi.org/10.1006/bbrc.1996.0587
- PubMed
- Google Scholar
1. Matsuda K
2. Fujishima Y
3. Maeda N
4. Mori T
5. Hirata A
6. Sekimoto R
7. Tsushima Y
8. Masuda S
9. Yamaoka M
10. Inoue K
11. Nishizawa H
12. Kita S
13. Ranscht B
14. Funahashi T
15. Shimomura I
(2015) Positive feedback regulation between adiponectin and T-cadherin impacts adiponectin levels in tissue and plasma of male mice
Endocrinology 156:934–946.
https://doi.org/10.1210/en.2014-1618
- PubMed
- Google Scholar
1. Mendlov F
2. Conconi M
(2010)
Calreticulin: a multifaceted protein

Nature Education 4:1.
- Google Scholar
1. Michalak M
2. Groenendyk J
3. Szabo E
4. Gold LI
5. Opas M
(2009) Calreticulin, a multi-process calcium-buffering chaperone of the endoplasmic reticulum
Biochemical Journal 417:651–666.
https://doi.org/10.1042/BJ20081847
- PubMed
- Google Scholar
1. Morisaki H
2. Yamanaka I
3. Iwai N
4. Miyamoto Y
5. Kokubo Y
6. Okamura T
7. Okayama A
8. Morisaki T
(2012) CDH13 gene coding T-cadherin influences variations in plasma adiponectin levels in the japanese population
Human Mutation 33:402–410.
https://doi.org/10.1002/humu.21652
- PubMed
- Google Scholar
1. Nakano Y
2. Tobe T
3. Choi-Miura NH
4. Mazda T
5. Tomita M
(1996) Isolation and characterization of GBP28, a novel gelatin-binding protein purified from human plasma
Journal of Biochemistry 120:803–812.
https://doi.org/10.1093/oxfordjournals.jbchem.a021483
- PubMed
- Google Scholar
1. Obata Y
2. Kita S
3. Koyama Y
4. Fukuda S
5. Takeda H
6. Takahashi M
7. Fujishima Y
8. Nagao H
9. Masuda S
10. Tanaka Y
11. Nakamura Y
12. Nishizawa H
13. Funahashi T
14. Ranscht B
15. Izumi Y
16. Bamba T
17. Fukusaki E
18. Hanayama R
19. Shimada S
20. Maeda N
21. Shimomura I
(2018) Adiponectin/T-cadherin system enhances exosome biogenesis and decreases cellular ceramides by exosomal release
JCI Insight 3:.
https://doi.org/10.1172/jci.insight.99680
- PubMed
- Google Scholar
1. Parker-Duffen JL
2. Nakamura K
3. Silver M
4. Kikuchi R
5. Tigges U
6. Yoshida S
7. Denzel MS
8. Ranscht B
9. Walsh K
(2013) T-cadherin is essential for adiponectin-mediated revascularization
Journal of Biological Chemistry 288:24886–24897.
https://doi.org/10.1074/jbc.M113.454835
- PubMed
- Google Scholar
(1995) A novel serum protein similar to C1q, produced exclusively in adipocytes
Journal of Biological Chemistry 270:26746–26749.
https://doi.org/10.1074/jbc.270.45.26746
- PubMed
- Google Scholar
1. Straub LG
2. Scherer PE
(2019) Metabolic messengers: adiponectin
Nature Metabolism 1:334–339.
https://doi.org/10.1038/s42255-019-0041-z
- Google Scholar
1. Suzuki S
2. Wilson-Kubalek EM
3. Wert D
4. Tsao TS
5. Lee DH
(2007) The oligomeric structure of high molecular weight adiponectin
FEBS Letters 581:809–814.
https://doi.org/10.1016/j.febslet.2007.01.046
- PubMed
- Google Scholar
1. Takemura Y
2. Ouchi N
3. Shibata R
4. Aprahamian T
5. Kirber MT
6. Summer RS
7. Kihara S
8. Walsh K
(2007) Adiponectin modulates inflammatory reactions via calreticulin receptor-dependent clearance of early apoptotic bodies
Journal of Clinical Investigation 117:375–386.
https://doi.org/10.1172/JCI29709
- PubMed
- Google Scholar
1. Tanaka Y
2. Kita S
3. Nishizawa H
4. Fukuda S
5. Fujishima Y
6. Obata Y
7. Nagao H
8. Masuda S
9. Nakamura Y
10. Shimizu Y
11. Mineo R
12. Natsukawa T
13. Funahashi T
14. Ranscht B
15. Fukada SI
16. Maeda N
17. Shimomura I
(2019) Adiponectin promotes muscle regeneration through binding to T-cadherin
Scientific Reports 9:16.
https://doi.org/10.1038/s41598-018-37115-3
- PubMed
- Google Scholar
1. Tanford C
2. Reynolds JA
(1976) Characterization of membrane proteins in detergent solutions
Biochimica Et Biophysica Acta (BBA) - Reviews on Biomembranes 457:133–170.
https://doi.org/10.1016/0304-4157(76)90009-5
- Google Scholar
1. Tang YT
2. Hu T
3. Arterburn M
4. Boyle B
5. Bright JM
6. Emtage PC
7. Funk WD
(2005) PAQR proteins: a novel membrane receptor family defined by an ancient 7-transmembrane pass motif
Journal of Molecular Evolution 61:372–380.
https://doi.org/10.1007/s00239-004-0375-2
- PubMed
- Google Scholar
(2018) Shedding light on the cell biology of extracellular vesicles
Nature Reviews Molecular Cell Biology 19:213–228.
https://doi.org/10.1038/nrm.2017.125
- PubMed
- Google Scholar
1. Yamauchi T
2. Kamon J
3. Ito Y
4. Tsuchida A
5. Yokomizo T
6. Kita S
7. Sugiyama T
8. Miyagishi M
9. Hara K
10. Tsunoda M
11. Murakami K
12. Ohteki T
13. Uchida S
14. Takekawa S
15. Waki H
16. Tsuno NH
17. Shibata Y
18. Terauchi Y
19. Froguel P
20. Tobe K
21. Koyasu S
22. Taira K
23. Kitamura T
24. Shimizu T
25. Nagai R
26. Kadowaki T
(2003) Cloning of adiponectin receptors that mediate antidiabetic metabolic effects
Nature 423:762–769.
https://doi.org/10.1038/nature01705
- PubMed
- Google Scholar
1. Yamauchi T
2. Nio Y
3. Maki T
4. Kobayashi M
5. Takazawa T
6. Iwabu M
7. Okada-Iwabu M
8. Kawamoto S
9. Kubota N
10. Kubota T
11. Ito Y
12. Kamon J
13. Tsuchida A
14. Kumagai K
15. Kozono H
16. Hada Y
17. Ogata H
18. Tokuyama K
19. Tsunoda M
20. Ide T
21. Murakami K
22. Awazawa M
23. Takamoto I
24. Froguel P
25. Hara K
26. Tobe K
27. Nagai R
28. Ueki K
29. Kadowaki T
(2007) Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions
Nature Medicine 13:332–339.
https://doi.org/10.1038/nm1557
- PubMed
- Google Scholar
(2014) Adiponectin receptors: a review of their structure, function and how they work
Best Practice & Research Clinical Endocrinology & Metabolism 28:15–23.
https://doi.org/10.1016/j.beem.2013.09.003
- PubMed
- Google Scholar

Decision letter

Olga Boudker

Senior Editor; Weill Cornell Medicine, United States
David E James

Reviewing Editor; The University of Sydney, Australia
Morris Birnbaum

Reviewer; University of Pennsylvania, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

[Editors’ note: this article was originally rejected after discussions between the reviewers, but the authors were invited to resubmit after an appeal against the decision.]

Thank you for submitting your work entitled "Native adiponectin existing in serum binds with T-cadherin, but not with AdipoRs nor Calreticulin" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Morris Birnbaum (Reviewer #3).

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

This study focused on elucidating the physiological binding partner(s) for native adiponectin. With cell culture based studies, they have revealed that serum adiponectin exclusively bound to T-cadherin, but not to the "classical" AdipoR receptors nor Calreticulin. The strength of the study is that they have shown binding of "native" adiponectin to T-cadherin as this has not been shown before. However, the study has several weaknesses which preclude publication in eLife. First, the binding system used is somewhat "dirty" limiting careful biochemical analyses. Second, the overall advance of the study is unclear as it has already been shown that adiponectin binds to T-cadherin. Third, all reviewers highlighted weaknesses with the binding assay pinpointing the inability of the authors to reach saturation binding, an essential criterion for a receptor-ligand interaction. Finally, as highlighted by reviewer 1, much more work is required to prove a lack of interaction between adiponectin and the other receptor systems.

Reviewer #1:

This manuscript presents data showing serum adiponectin binds to T-cadherin overexpressed in HEK293 cells as well as endogenous T-cadherin in C2C12 cells. These findings are solid and convincing since in such experiments adiponectin is in native forms and being adsorbed directly in such forms. The claim that T-cadherin is a "receptor" for adiponectin is justified by these data and conforms to other solid papers in the field. These data do not add much to the literature as it is already established that adiponectin binds to T-cadherin, although this is a new way of demonstrating the phenomenon. But the claim is convincing.

On the other hand, the failure to show binding of serum adiponectin to other purported receptor molecules (R1 and R2 as well as Calreticulin) is more difficult to interpret. The claim that these are not true receptors could be true, but it is impossible to prove a negative. What if there are "accessory" proteins required to confer binding activity to these other putative receptors? Expression of the receptors alone would not be sufficient to display binding in that case. Normally, ligand-receptor interactions are quantified by binding of pure ligand with pure receptor, which allows binding constants to be calculated. This is not the case here, since the ligand is in a complex mixture (serum) and the "receptor" is also within a complex structure (cell membrane). These complications raise concerns about the conclusion, and have caused other groups to use gene KO mice to interrogate putative "receptor" function.

On balance, this paper should be published since it raises an important question for the field. Publication would also highlight the need to determine binding affinities for the putative receptors. However, the study doesn't add mechanistic information to the field, and doesn't define why dysfunction of adiponectin occurs when the R1/R2 receptors are deleted in mice. For those reasons, it could be argued that this paper belongs in a specialty journal.

One other point is that careful editing of this manuscript for proper English usage would be mandatory prior to publication.

Reviewer #2:

In this study, Kita et al. have focused on the elucidation of physiological binding partner(s) for native adiponectin. With cell culture based studies, they have revealed that serum adiponectin exclusively bound to T-cadherin, but not to AdipoR nor Calreticulin. While this study contains potential interests, several issues need to be properly addressed to enhance the significance of this study.

1) Due to molecular structure of T-cadherin protein, it remains elusive to guess the mode(s) of action for adiponectin signaling. More discussion and/or speculation would be more helpful for general readers to understand adiponectin action and signaling.

2) Along the same line, it is unclear whether T-cadherin might behave as a typical receptor protein for adiponectin. For example, typical receptors are saturated by ligands. However, provided data (Figures 1, 2 and 3) did not show any saturation pattern nor dose response. This issue needs to be properly addressed by experimental data.

3) The authors demonstrated that native adiponectin bound to T-cadherin. Have you compared the binding affinity with native and recombinant adiponectin proteins to three potential receptors? If there is any difference, it needs to be described and discussed.

Reviewer #3:

In spite of the identification of adiponectin quite a number of years ago, the nature of its receptors remains controversial. The rationale for the current study is that the major criterion for evaluating a potential receptor should be that it binds native adiponectin and not just recombinant product. This seems quite reasonable and therefore the strength of the paper is that it seeks to accomplish that. The weakness is that the nature of the protocol involves performing the binding study on a very complex, on might say "dirty" system, in which it is challenging to infer the actual biochemical even being measured. At a minimum, the authors' need to be much more precise in their language and judicious in what they claim the data show. For example, the authors state "These results clearly indicate that T-cadherin can bind native adiponectin." This is a gross overinterpretation of this experiment. What the authors show is that overexpression of T-cadherin in cells allows them to bind increased amounts of adiponectin. There is no information to indicated that the adiponectin is binding directly to T-cadherin or, for that matter, that T-cadherin is involved in the binding of hormone. This interpretation might be plausible, but it is far from proven.

The authors do demonstrate that the binding is concentration dependent, which is important for true receptor binding, but they do not establish saturability, which is essential to arguing the physiological relevance of the event being measured. Thus, it would add to the weight of the argument of they could show a full binding curve up to the point of saturability. It is relatively straightforward to vary expression to make sure the receptor level is low enough that it can be saturated with the adiponectin levels present in serum.

[Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.]

Congratulations, we are pleased to inform you that your article, "Native adiponectin in serum binds to cells expressing T-cadherin, but not AdipoRs or calreticulin", has been accepted for publication in eLife as a Short Report article.

While the reviewers still identified some shortcomings with your study, it was generally considered that your paper makes an important contribution to the field. In particular, there is an abundance of evidence in the literature to show that adiponectin signals via the ADIPOR1 and 2 receptors. Your work questions the breadth of this conclusion and shows that as a minimum the field needs to carefully consider the role of this alternate adiponectin receptor, T cadherin. This paper clearly shows that adiponectin binds to T-cadherin with considerable affinity under somewhat physiological conditions. As to whether the origin or nature of the ligand influences the binding specificity is unclear but this is certainly something important to consider that this work highlights. While, as pointed out by two of the reviewers, there is a long way to go to ascertain how the adiponectin-T-cadherin interaction signals in cells this is perhaps something for a future study.

Please address as best you can each of the points raised by the reviewers as noted below. Also I noted that some restructuring of your figures is necessary to consolidate space and to improve the presentation of the data. Furthermore, I still believe you could shorten the article without loss of clarity.

Reviewer #1:

This paper provides data supporting the view that binding of adiponectin to cells is through T-cadherin rather than other purported receptor types. There are three issues that diminish the impact of the paper:

1) The first paragraph is an overly long "stream of consciousness" type of Introduction that should be heavily edited and organized into multiple paragraphs around the several discrete ideas.

2) The major impact of this study would be that bio-effects of adiponectin are mediated through T-cadherin, not the other putative receptors, but unfortunately no bio-effects are studied in these experiments. While the results are very interesting and certainly provocative, a definitive experiment on this key point showing that T-cadherin but not the other receptors mediates important bio-effects is missing.

3) The cell biology/microscopy data are too limited. Multiple fields should be shown and appropriate controls with null signal. The data should be quantified from many fields as well.

Reviewer #2:

In this work, Kita et al. have demonstrated that native adiponectin would exclusively bind to T-cadherin. With cell culture model, they showed that serum or purified adiponectin preferentially bound to T-cadherin but not to AdipoR nor Calreticulin. Although they provided more data and tried to strengthen Discussion part in the resubmitted manuscript, it still has technical limitations to reach the firm conclusion.

1) Although it has been reported that adiponectin binds to AdipoRs, calreticulin, and T-cadherin, they argued that the major binding protein for native adiponectin is T-cadherin. If the binding affinity of native adiponectin to adipoRs or calreticulin would be much weaker than T-cadherin, it seems that the experimental condition in this study might be too harsh to detect weak interaction with others. They have to adopt alternative methods to affirm the extent of protein interactions. Along the same line, they need to measure/compare binding affinity of recombinant adiponectin with other proteins including AdipoR and Calreticulin.

2) To convince that native adiponectin exclusively binds to T-cadherin, it is crucial to provide positive control data.

3) It has been suggested to examine intracellular signaling cascades such as phospho-AMPK and phospho-p38 upon the interaction between native adiponectin and potential receptors.

Reviewer #3:

I was ambivalent about this manuscript the first time around and the authors have only improved it with the additional experiments. In all honesty, this will never be the cleanest study and will not have the highest level of impact due to lack of mechanism, whatever the authors do to address the issues. However, I continue to believe that it brings up a valid point about the ambiguity of the true adiponectin receptor and the data are strong enough to provide a valid challenge to the dogma. On balance, I recommend acceptance.

https://doi.org/10.7554/eLife.48675.011

Author response

[Editors’ note: the author responses to the first round of peer review follow.]

This study focused on elucidating the physiological binding partner(s) for native adiponectin. With cell culture based studies, they have revealed that serum adiponectin exclusively bound to T-cadherin, but not to the "classical" AdipoR receptors nor Calreticulin. The strength of the study is that they have shown binding of "native" adiponectin to T-cadherin as this has not been shown before.

However, the study has several weaknesses which preclude publication in eLife. First, the binding system used is somewhat "dirty" limiting careful biochemical analyses.

We used HMW adiponectin purified from serum (Fukuda et al., 2017, PMID: 28325833) and full-length recombinant adiponectin produced by HEK293 cells in our revised manuscript, and they gave essentially the same results. Furthermore, we would like to emphasize that the ligand in serum is the most natural ligand that maintains its ability to interact with the physiological binding partner. Numerous constituents, including a large number of proteins, exert adequate blocking effects to investigate whether the interaction between the physiological ligand and binding protein is specific. Moreover, the use of a recombinant ligand may make the experiment unreproducible because the same recombinant ligand cannot be made at another site. The ligand-receptor interaction in a more purified system can have mean if the ligand can bind with the receptor in a more physiological situation like in serum as our experiment. The results of our new experiment indicate that recombinant adiponectin has a limited affinity to T-cadherin due to the presence of less of the HMW form.

The results obtained were shown in Figure 1B and 1D. We added the following sentences.

Results and Discussion

“We directly examined mouse serum as the ligand solution, including the most native adiponectin, purified adiponectin from mouse serum (Fukuda et al., 2017), and full-length recombinant adiponectin produced in HEK293 cells. […] Recombinant adiponectin contained a lower amount of HMW multimer adiponectin than mouse serum and purified adiponectin from serum (Figure 1B).

Results and Discussion

“The treatment of cells with different preparations of adiponectin at 4°C for 1 hr resulted in the binding of prepared adiponectin only to cells expressing mouse T-cadherin (Figure 1D). Mouse serum and purified adiponectin showed similar binding, whereas recombinant adiponectin containing a lower amount of 6-mer and the HMW multimer exhibited markedly weaker binding (Figure 1D).”

Second, the overall advance of the study is unclear as it has already been shown that adiponectin binds to T-cadherin.

The binding of HMW recombinant adiponectin to T-cadherin was initially discovered in 2004 (Hug C et al., 2004); however, it has not been investigated in detail because it lacks an intracellular domain. We previously reported a molecular interaction between serum derived purified HMW adiponectin and Fc-fusion purified T-cadherin with high affinity (KD=1.0 nM) (Fukuda et al., 2017). Moreover, we demonstrated that T-cadherin mediated the exosome-stimulating function of adiponectin (Obata et al., 2018). However, as discussed in the Abstract, reported receptors for adiponectin have not yet been simultaneously examined on their adiponectin binding under equal conditions. The present study established by WB that native HMW (> 6mer) adiponectin in serum and highly purified serum-derived multimer adiponectin bound to cells expressing T-cadherin, but not to those expressing AdipoRs or calreticulin. An important issue in the present study is that native HMW adiponectin, either in serum or highly purified, did not appear to bind to cells expressing AdipoRs or calreticulin, but did bind to those expressing T-cadherin in the same set of experiments. Based on these results, we speculate that AdipoRs and/or calreticulin may function as adiponectin receptors for LMW forms such as globular adiponectin, possibly on the site of cells after HMW adiponectin binding to cell-surface T-cadherin is cleaved. We discussed this possibility in our response to comment 4 by the Editor.

Third, all reviewers highlighted weaknesses with the binding assay pinpointing the inability of the authors to reach saturation binding, an essential criterion for a receptor-ligand interaction.

We showed the saturable binding of native adiponectin in serum in Figure 1E. The binding isotherm obtained is consistent with the high-affinity interaction we reported previously using purified HMW adiponectin with purified T-cadherin (Fukuda et al., 2017).

The results obtained were shown in Figure 1E. We added the following sentence.

Results and Discussion

“The dose-response study revealed the specific and saturable binding of native adiponectin in serum to cells expressing T-cadherin (Figure 1E).”

Finally, as highlighted by reviewer 1, much more work is required to prove a lack of interaction between adiponectin and the other receptor systems.

We simultaneously compared the candidate receptors. The expression of T-cadherin gave a strong band of bound adiponectin, which is consistent with our previous finding showing that recombinant T-cadherin binds HMW adiponectin in a 1: 1 ratio with high affinity. If the receptor has meaningful affinity, it will bind and give a visible band on WB, similar to that of T-cadherin. However, there was no detectable band on the AdipoR or calreticulin lane. Furthermore, AdipoR was discovered by expression cloning. Therefore, the ectopic introduction of AdipoRs promotes adiponectin binding. The Nature study also showed that HEK293 cells overexpressing AdipoRs bound E. coli recombinant globular adiponectin (Supplementary Figure 2A and 2B, Yamauchi et al., 2003). Therefore, difficulties are associated with speculating about the requirement for “accessory” proteins to confer adiponectin binding activity to AdipoRs.

Numerous studies have indicated that AdipoRs mediate adiponectin signaling. Therefore, there may be additional activating mechanisms of AdipoRs by adiponectin, i.e., reductive or proteolytic generation of the trimer, monomer, and/or globular adiponectin. The present study focused on the direct binding of native HMW adiponectin (more than a hexamer) and the results obtained suggest the activation of AdipoRs by these LMW forms, possibly on the site of cells after HMW adiponectin binding to cell surface T-cadherin is cleaved.

On the other hand, in the case of calreticulin, this was evidenced by a neutralizing antibody treatment inhibiting the adiponectin interaction with cells (Takemura et al., 2007). Therefore, “accessory” proteins may be required to confer adiponectin binding activity to calreticulin. We also revised our discussion on this point to keep the possibility of calreticulin mediating the adiponectin interaction with cells.

We added a detailed discussion on this important assumption as follows.

Results and Discussion

“Adiponectin is an atypically abundant circulating factor that is exclusively secreted from adipocytes as a trimer, hexamer, and HMW multimer. […] Therefore, some “accessory” proteins may be required to confer adiponectin binding activity to calreticulin.”

We also revised the Abstract as follows.

“Adiponectin is an adipocyte-derived atypically abundant circulating factor that protects various organs and tissues through its receptors, AdipoRs, calreticulin, and T-cadherin. […] Collectively, these results suggest that T-cadherin is the major binding partner of native adiponectin in serum.”

We also revised conclusive sentences at the bottom of the Results and Discussion sections as follows.

“The present results may further contribute to clarifying the activating mechanism of AdipoRs by LMW adiponectin, generated by reduction or proteolytic cleavage, followed by HMW adiponectin binding to cell surface T-cadherin.”

Reviewer #1:

This manuscript presents data showing serum adiponectin binds to T-cadherin overexpressed in HEK293 cells as well as endogenous T-cadherin in C2C12 cells. These findings are solid and convincing since in such experiments adiponectin is in native forms and being adsorbed directly in such forms. The claim that T-cadherin is a "receptor" for adiponectin is justified by these data and conforms to other solid papers in the field. These data do not add much to the literature as it is already established that adiponectin binds to T-cadherin, although this is a new way of demonstrating the phenomenon. But the claim is convincing.

The binding of HMW recombinant adiponectin to T-cadherin was initially discovered in 2004 (Hug C et al., 2004); however, it has not been investigated in detail because it lacks an intracellular domain. We previously reported a molecular interaction between serum-derived purified HMW adiponectin and Fc-fusion purified T-cadherin with high affinity (KD=1.0 nM) (Fukuda et al., 2017). Moreover, we demonstrated that T-cadherin mediated the exosome-stimulating function of adiponectin (Obata et al., 2018). However, as discussed in the Abstract, reported receptors for adiponectin have not yet been simultaneously examined under equal conditions on their adiponectin binding. The present study established by WB that native HMW (> 6mer) adiponectin in serum and highly purified serum derived multimer adiponectin bound to cells expressing T-cadherin, but not to those expressing AdipoRs or calreticulin. An important issue in the present study is that native HMW adiponectin, either in serum or highly purified, did not appear to bind to cells expressing AdipoRs or calreticulin, but did bind to those expressing T-cadherin in the same set of experiments. Based on these results, we speculate that AdipoRs and/or calreticulin may function as adiponectin receptors for LMW forms such as globular adiponectin, possibly on the site of cells after HMW adiponectin binding to cell surface T-cadherin is cleaved. We discussed this possibility in our response to reviewer #1’s comment 3.

On the other hand, the failure to show binding of serum adiponectin to other purported receptor molecules (R1 and R2 as well as Calreticulin) is more difficult to interpret. The claim that these are not true receptors could be true, but it is impossible to prove a negative. What if there are "accessory" proteins required to confer binding activity to these other putative receptors? Expression of the receptors alone would not be sufficient to display binding in that case. Normally, ligand-receptor interactions are quantified by binding of pure ligand with pure receptor, which allows binding constants to be calculated. This is not the case here, since the ligand is in a complex mixture (serum) and the "receptor" is also within a complex structure (cell membrane). These complications raise concerns about the conclusion, and have caused other groups to use gene KO mice to interrogate putative "receptor" function.

We appreciate the valuable comment. In the revised manuscript, we compared the binding of native adiponectin in serum, purified native adiponectin, and recombinant full-length adiponectin produced in HEK293 cells. The results obtained indicated that only cells expressing T-cadherin and not the other receptors bound these preparations of adiponectin. However, recombinant adiponectin with a lower amount of HMW multimer adiponectin showed weak binding at a physiological concentration (20 µg/mL) of adiponectin. The results obtained were shown in Figure 1B and 1D. We added the following sentences.

Results and Discussion

Furthermore, we would like to emphasize that the ligand in serum is the most natural ligand that maintains its ability to interact with the physiological binding partner. Numerous constituents, including a large number of proteins, exert adequate blocking effects to investigate whether the interaction between the physiological ligand and binding protein is specific. Moreover, the use of a recombinant ligand may make the experiment unreproducible because the same recombinant ligand cannot be made at another site. The ligand-receptor interaction in a more purified system can have mean if the ligand can bind with the receptor in a more physiological situation like in serum as our experiment The results of our new experiment indicate that recombinant adiponectin has a limited affinity to T-cadherin due to the presence of less of the HMW form.

The expression of T-cadherin gave a strong band of bound adiponectin, which is consistent with our previous finding showing that recombinant T-cadherin binds HMW adiponectin in a 1: 1 ratio with high affinity. If the receptor has meaningful affinity, it will bind and give a visible band on WB, similar to that of T-cadherin. However, there was no detectable band on the AdipoR or calreticulin lane. Furthermore, AdipoR was discovered by expression cloning. Therefore, the ectopic introduction of AdipoRs promotes adiponectin binding. The Nature study also showed that HEK293 cells overexpressing AdipoRs bound E. coli recombinant globular adiponectin (Supplementary Figure 2A and 2B, Yamauchi et al., 2003). Therefore, difficulties are associated with speculating about the requirement for “accessory” proteins to confer adiponectin binding activity to AdipoRs.

On the other hand, in the case of calreticulin, this was evidenced by a neutralizing antibody treatment inhibiting the adiponectin interaction with cells (Takemura Y et al., 2007). Therefore, “accessory” proteins may be required to confer adiponectin binding activity to calreticulin. We also revised our discussion on this point to keep the possibility of calreticulin mediating the adiponectin interaction with cells.

We added a detailed discussion on this important assumption as follows.

Results and Discussion

“We simultaneously compared three adiponectin receptors. The expression of T-cadherin gave a strong band of bound adiponectin, which is consistent with our previous finding showing that recombinant Tcadherin binds HMW adiponectin in a 1: 1 ratio with high affinity (Fukuda et al., 2017). […] Therefore, difficulties are associated with speculating about the requirement for some “accessory” proteins to confer adiponectin binding activity to AdipoRs.”

Results and Discussion

“On the other hand, in the case of calreticulin, this was evidenced by a neutralizing antibody treatment inhibiting the adiponectin interaction with cells (Takemura et al., 2007). Therefore, some “accessory” proteins may be required to confer adiponectin binding activity to calreticulin.”

On balance, this paper should be published since it raises an important question for the field. Publication would also highlight the need to determine binding affinities for the putative receptors. However, the study doesn't add mechanistic information to the field, and doesn't define why dysfunction of adiponectin occurs when the R1/R2 receptors are deleted in mice. For those reasons, it could be argued that this paper belongs in a specialty journal.

We appreciate the valuable comment. Numerous studies indicated that AdipoRs mediate adiponectin signaling. Therefore, there may be additional activating mechanisms of AdipoRs by adiponectin, i.e., reductive or proteolytic generation of the trimer, monomer, and/or globular adiponectin. The present study focused on the direct binding of native HMW adiponectin (more than hexamer) and the results obtained suggest the activation of AdipoRs by these LMW forms, possibly on the site of cells after HMW adiponectin binding to cell-surface T-cadherin is cleaved. We added a detailed discussion on this important assumption as follows.

Results and Discussion

“Since numerous studies indicated that AdipoRs mediate adiponectin signaling in a number of cell types, an additional activating mechanism for AdipoRs by adiponectin, i.e., the reductive or proteolytic generation of the trimer, monomer, and/or globular adiponectin, may exist. The results of the present study, which focused on the direct binding of native HMW adiponectin, may indicate the activation of AdipoRs by low-molecular-weight (LMW) forms.”

We also revised the Abstract as follows.

We also revised conclusive sentences at the bottom of the Results and Discussion sections as follows.

One other point is that careful editing of this manuscript for proper English usage would be mandatory prior to publication.

The revised manuscript was proofread by a native speaker of English.

Reviewer #2:

In this study, Kita et al. have focused on the elucidation of physiological binding partner(s) for native adiponectin. With cell culture based studies, they have revealed that serum adiponectin exclusively bound to T-cadherin, but not to AdipoR nor Calreticulin. While this study contains potential interests, several issues need to be properly addressed to enhance the significance of this study.

1) Due to molecular structure of T-cadherin protein, it remains elusive to guess the mode(s) of action for adiponectin signaling. More discussion and/or speculation would be more helpful for general readers to understand adiponectin action and signaling.

We appreciate the valuable comment. We added a detailed discussion on the mode of action of adiponectin through T-cadherin as below.

Results and Discussion

“T-cadherin binds clinically important HMW multimer adiponectin with high affinity (Fukuda et al., 2017) and mediates adiponectin-induced exosome biogenesis and ceramide efflux to exosomes (Obata et al., 2018). […] These findings support Tcadherin mediating adiponectin functions as a receptor for native HMW multimer adiponectin (Kita et al., 2019).”

2) Along the same line, it is unclear whether T-cadherin might behave as a typical receptor protein for adiponectin. For example, typical receptors are saturated by ligands. However, provided data (Figures 1, 2 and 3) did not show any saturation pattern nor dose response. This issue needs to be properly addressed by experimental data.

We appreciate the valuable comment. We demonstrated the saturable binding of native adiponectin in serum. The binding isotherm obtained is consistent with the high-affinity interaction we reported previously using purified HMW adiponectin with purified T-cadherin (Fukuda et al., 2017). The results obtained were shown in Figure 1D. The following sentences were added.

Results and Discussion

“The dose-response study revealed the specific and saturable binding of native adiponectin in serum to cells expressing T-cadherin (Figure 1E).”

3) The authors demonstrated that native adiponectin bound to T-cadherin. Have you compared the binding affinity with native and recombinant adiponectin proteins to three potential receptors? If there is any difference, it needs to be described and discussed.

The results obtained were shown in Figure 1B and 1D. The following sentences were added.

Results and Discussion

Once again, we are sincerely grateful to reviewer #2 for the constructive suggestions, which have improved the quality of the revised manuscript.

Reviewer #3:

In spite of the identification of adiponectin quite a number of years ago, the nature of its receptors remains controversial. The rationale for the current study is that the major criterion for evaluating a potential receptor should be that it binds native adiponectin and not just recombinant product. This seems quite reasonable and therefore the strength of the paper is that it seeks to accomplish that. The weakness is that the nature of the protocol involves performing the binding study on a very complex, on might say "dirty" system, in which it is challenging to infer the actual biochemical even being measured.

We appreciate the valuable comment. We compared the binding of native adiponectin in serum, purified native adiponectin, and recombinant full-length adiponectin produced in HEK293 cells. The results obtained indicated that only cells expressing T-cadherin and not the other receptors bound these preparations of adiponectin. However, recombinant adiponectin with lower amounts of HMW multimer adiponectin showed weak binding at a physiological concentration (20 μg/mL) of adiponectin. These results were shown in Figure 1B and 1D. We added the following sentences.

Results and Discussion

Furthermore, we would like to emphasize that the ligand in serum is the most natural ligand that maintains its ability to interact with the physiological binding partner. Numerous constituents, including a large number of proteins, exert adequate blocking effects to investigate whether the interaction between the physiological ligand and binding protein is specific. Moreover, the use of a recombinant ligand may make the experiment unreproducible because the same recombinant ligand cannot be made at another site. The ligand-receptor interaction in a more purified system can have mean if the ligand can bind with the receptor in a more physiological situation like in serum as our experiment The results of our new experiment indicate that recombinant adiponectin has limited affinity to T-cadherin due to the presence of less of the HMW form.

At a minimum, the authors' need to be much more precise in their language and judicious in what they claim the data show. For example, the authors state "These results clearly indicate that T-cadherin can bind native adiponectin." This is a gross overinterpretation of this experiment. What the authors show is that overexpression of T-cadherin in cells allows them to bind increased amounts of adiponectin. There is no information to indicated that the adiponectin is binding directly to T-cadherin or, for that matter, that T-cadherin is involved in the binding of hormone. This interpretation might be plausible, but it is far from proven.

We appreciate the valuable comment. The revised manuscript was proofread by a native English speaker.

Since we previously reported a serum-derived purified APN interaction with purified Fc-fusion Tcadherin (JBC, 2017), the statement “These results clearly indicate that T-cadherin can bind native adiponectin”was replaced as follows.

Results and Discussion

“We previously reported that purified recombinant T-cadherin bound purified adiponectin with an affinity of KD=1.0 nM (Fukuda et al., 2017). The present results showed the saturable binding of native adiponectin in serum to cells expressing T-cadherin, which is consistent with previous findings (Fukuda et al., 2017).”

The authors do demonstrate that the binding is concentration dependent, which is important for true receptor binding, but they do not establish saturability, which is essential to arguing the physiological relevance of the event being measured. Thus, it would add to the weight of the argument of they could show a full binding curve up to the point of saturability. It is relatively straightforward to vary expression to make sure the receptor level is low enough that it can be saturated with the adiponectin levels present in serum.

Results and Discussion

“The dose-response study revealed the specific and saturable binding of native adiponectin in serum to cells expressing T-cadherin (Figure 1E).”

[Editors’ note: the author responses to the re-review follow.]

Reviewer #1:

This paper provides data supporting the view that binding of adiponectin to cells is through T-cadherin rather than other purported receptor types. There are three issues that diminish the impact of the paper:

1) The first paragraph is an overly long "stream of consciousness" type of Introduction that should be heavily edited and organized into multiple paragraphs around the several discrete ideas.

We reorganized Introduction section according to your kind advice as follows.

“Adiponectin is a circulating factor that is secreted from adipocytes (Hu et al., 1996; Maeda et al., 1996; Nakano et al., 1996; Scherer et al., 1995). […] We herein demonstrated that native adiponectin in serum bound to cells expressing T-cadherin, but not to those expressing AdipoRs or calreticulin.”

2) The major impact of this study would be that bio-effects of adiponectin are mediated through T-cadherin, not the other putative receptors, but unfortunately no bio-effects are studied in these experiments. While the results are very interesting and certainly provocative, a definitive experiment on this key point showing that T-cadherin but not the other receptors mediates important bio-effects is missing.

Thank you for pointing the most important point to be addressed. It is well known that adiponectin stimulates intracellular signaling cascades such as phospho-AMPK and phospho-p38. And the loss of AdipoRs was shown to decrease these signaling. One explanation will be the generation of low molecular weight form of adiponectin such as globular form after binding to T-cadherin. However, it was recently reported that the primary cellular function of AdipoR1 and AdipoR2 is to maintain membrane fluidity (Ruiz M et al., J Lipid Res. 2019 May;60(5):995-1004). Loss of them might disturb membrane fluidity and thereby decrease signaling. Another explanation may be intracellular signaling by HMW-adiponectin internalization through binding to T-cadherin without interaction with AdipoRs. In future studies, we will carefully examine whether HMW-adiponectin stimulates such signaling or not and whether endocytosis of adiponectin through T-cadherin is required or not.

3) The cell biology/microscopy data are too limited. Multiple fields should be shown and appropriate controls with null signal. The data should be quantified from many fields as well.

We appreciate the valuable comment. The fluorescent microscopy data (Figure 2H) only indicate that the tagged receptors are correctly expressed, together with Western blotting data (Figure 2E). At this moment, it seems kind of reasonable to us that quantification by microscopy data may not be required because we have more accurate quantified data by Western blots.

Reviewer #2:

In this work, Kita et al. have demonstrated that native adiponectin would exclusively bind to T-cadherin. With cell culture model, they showed that serum or purified adiponectin preferentially bound to T-cadherin but not to AdipoR nor Calreticulin. Although they provided more data and tried to strengthen Discussion part in the resubmitted manuscript, it still has technical limitations to reach the firm conclusion.

1) Although it has been reported that adiponectin binds to AdipoRs, calreticulin, and T-cadherin, they argued that the major binding protein for native adiponectin is T-cadherin. If the binding affinity of native adiponectin to adipoRs or calreticulin would be much weaker than T-cadherin, it seems that the experimental condition in this study might be too harsh to detect weak interaction with others. They have to adopt alternative methods to affirm the extent of protein interactions. Along the same line, they need to measure/compare binding affinity of recombinant adiponectin with other proteins including AdipoR and Calreticulin.

Thank you for pointing an important discussion point in this study. As discussed in the Results and Discussion section (ninth paragraph), in the case of calreticulin, the interaction with adiponectin was evidenced by a neutralizing antibody treatment inhibiting the adiponectin interaction with cells expressing calreticulin (Takemura et al., 2007). So, possibilities of the requirement of calreticulin for adiponectin binding such as the requirement of some accessory protein may exist. In the case of AdipoRs, AdipoR was discovered by expression cloning, as discussed in the Results and Discussion section (eighth paragraph). Expression cloning requires repeated washing steps before separation by FACS. Therefore, the overexpression of AdipoR is expected to promote firm ligand binding. The initial discovery of AdipoRs also indicated that HEK293 cells overexpressing AdipoRs bound E. coli recombinant globular adiponectin (Yamauchi et al., 2003). Therefore, difficulties are associated with speculating about the much weaker binding affinity or requirement for some “accessory” proteins to confer adiponectin binding activity to AdipoRs. Rather, HMW-adiponectin may not bind to AdipoRs, but the globular form may do.

2) To convince that native adiponectin exclusively binds to T-cadherin, it is crucial to provide positive control data.

We appreciate the valuable comment. We previously reported and established HMW-adiponectin binding to T-cadherin in several ways including Biacore analysis and loss of tissue accumulation of adiponectin in T-cadherin KO mice (Fukuda et al., 2017, Matsuda et al., 2015). Therefore in this sense, T-cadherin can be thought of as positive control. Based on nearly the same amounts of receptors expressed on the cell surface as judged by PA-tag expression outside of the cells, native adiponectin bound to the cells expressing T-cadherin but not to the cells expressing AdipoR1.

3) It has been suggested to examine intracellular signaling cascades such as phospho-AMPK and phospho-p38 upon the interaction between native adiponectin and potential receptors.

Thank you for pointing the most important point to be addressed. It has been shown that adiponectin stimulates intracellular signaling cascades such as phospho-AMPK and phospho-p38. And the loss of AdipoRs decreases these signaling. One explanation will be the generation of low molecular weight form of adiponectin such as globular form after binding to T-cadherin. However, it was recently reported that the primary cellular function of AdipoR1 and AdipoR2 is to maintain membrane fluidity (Ruiz M et al., J Lipid Res. 2019 May;60(5):995-1004). Loss of them might disturb membrane fluidity and thereby decrease signaling. Another explanation may be intracellular signaling by HMW-adiponectin internalization through binding to T-cadherin without interaction with AdipoRs. In our future studies, we will carefully examine whether HMW-adiponectin stimulates such signaling or not and whether endocytosis of adiponectin through T-cadherin is required or not.

Reviewer #3:

I was ambivalent about this manuscript the first time around and the authors have only improved it with the additional experiments. In all honesty, this will never be the cleanest study and will not have the highest level of impact due to lack of mechanism, whatever the authors do to address the issues. However, I continue to believe that it brings up a valid point about the ambiguity of the true adiponectin receptor and the data are strong enough to provide a valid challenge to the dogma. On balance, I recommend acceptance.

Thank you very much for evaluating the significance of our study. Regarding the mechanism, how adiponectin input intracellular signaling, it must be the next important study. It is well known that adiponectin stimulates intracellular signaling cascades such as phospho-AMPK and phospho-p38. And the loss of AdipoRs decreases these signaling. One explanation will be the generation of low molecular weight form of adiponectin such as globular form after binding to T-cadherin. However, it was recently reported that the primary cellular function of AdipoR1 and AdipoR2 is to maintain membrane fluidity (Ruiz M et al., J Lipid Res. 2019 May;60(5):995-1004). Loss of them might disturb membrane fluidity and thereby decrease signaling. Another explanation may be intracellular signaling by HMW-adiponectin internalization through binding to T-cadherin without interaction with AdipoRs. In our future studies, we will carefully examine whether HMW-adiponectin stimulates such signaling or not and whether endocytosis of adiponectin through T-cadherin is required or not.

https://doi.org/10.7554/eLife.48675.012

Article and author information

Author details

Shunbun Kita
1. Department of Metabolic Medicine, Graduate School of Medicine, Osaka University, Osaka, Japan
2. Department of Adipose Management, Graduate School of Medicine, Osaka University, Osaka, Japan
Contribution
Conceptualization, Resources, Software, Formal analysis, Funding acquisition, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing, Performed biochemical and cellular experiments

For correspondence
shunkita@endmet.med.osaka-u.ac.jp

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-8937-0053
Shiro Fukuda

Department of Metabolic Medicine, Graduate School of Medicine, Osaka University, Osaka, Japan

Contribution
Resources, Data curation, Software, Validation, Visualization, Methodology, Writing—review and editing, Cloned the cDNAs of adiponectin receptors

Competing interests
No competing interests declared
Norikazu Maeda
1. Department of Metabolic Medicine, Graduate School of Medicine, Osaka University, Osaka, Japan
2. Department of Metabolism and Atherosclerosis, Graduate School of Medicine, Osaka University, Osaka, Japan
Contribution
Data curation, Supervision, Funding acquisition, Writing—review and editing

Competing interests
No competing interests declared
Iichiro Shimomura

Department of Metabolic Medicine, Graduate School of Medicine, Osaka University, Osaka, Japan

Contribution
Data curation, Supervision, Funding acquisition, Project administration, Writing—review and editing

Competing interests
No competing interests declared

Funding

Japan Science and Technology Agency (#16K09802)

Shunbun Kita

Japan Science and Technology Agency (#16K09801)

Norikazu Maeda

Japan Science and Technology Agency (#15H04853)

Iichiro Shimomura

CREST

Iichiro Shimomura

The Uehara Memorial Foundation

Iichiro Shimomura

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

The authors thank the staff of the Center of Medical Research and Education, Graduate School of Medicine Osaka University, for their excellent technical support. This work was supported in part by a Grant-in-Aid for Scientific Research (C) #16K09802 (to SK), a Grant-in-Aid for Scientific Research (C) #16K09801 (to NM), and a Grant-in-Aid for Scientific Research (B) #15H04853 (to IS), the Uehara Memorial Foundation, as well as CREST and JST (to IS). The funders had no role in study design, data collection, and analysis, the decision to publish, or preparation of the manuscript.

Ethics

Animal experimentation: The experimental protocol was approved as No. 28-072-023 by the Ethics Review Committee for Animal Experimentation of Osaka University School of Medicine. This study also conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health.

Senior Editor

Olga Boudker, Weill Cornell Medicine, United States

Reviewing Editor

David E James, The University of Sydney, Australia

Reviewer

Morris Birnbaum, University of Pennsylvania, United States

Version history

Received: May 22, 2019
Accepted: October 13, 2019
Accepted Manuscript published: October 24, 2019 (version 1)
Version of Record published: October 31, 2019 (version 2)

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.