1. Immunology and Inflammation
  2. Medicine

Soluble Fas ligand drives autoantibody-induced arthritis by binding to DR5/TRAIL-R2

  1. Dongjin Jeong
  2. Hye Sung Kim
  3. Hye Young Kim
  4. Min Jueng Kang
  5. Hyeryeon Jung
  6. Yumi Oh
  7. Donghyun Kim
  8. Jaemoon Koh
  9. Sung-Yup Cho
  10. Yoon Kyung Jeon
  11. Eun Bong Lee
  12. Seung Hyo Lee
  13. Eui-Cheol Shin
  14. Ho Min Kim
  15. Eugene C Yi
  16. Doo Hyun Chung  Is a corresponding author
  1. Department of Pathology, Seoul National University College of Medicine, Republic of Korea
  2. Laboratory of Immune Regulation in Department of Biomedical Sciences, Seoul National University College of Medicine, Republic of Korea
  3. Department of Biomedical Sciences, Seoul National University College of Medicine, Republic of Korea
  4. Department of Molecular Medicine and Biopharmaceutical Sciences, School of Convergence Science, Republic of Korea
  5. Technology and College of Medicine or College of Pharmacy, Seoul National University, Republic of Korea
  6. Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Republic of Korea
  7. Department of Internal Medicine, Seoul National University College of Medicine, Republic of Korea
  8. Graduate School of Medical Science and Engineering, Korean Advanced Institute of Science and Technology (KAIST), Republic of Korea
https://doi.org/10.7554/eLife.48840
Share this article
Cite this article
  1. Dongjin Jeong
  2. Hye Sung Kim
  3. Hye Young Kim
  4. Min Jueng Kang
  5. Hyeryeon Jung
  6. Yumi Oh
  7. Donghyun Kim
  8. Jaemoon Koh
  9. Sung-Yup Cho
  10. Yoon Kyung Jeon
  11. Eun Bong Lee
  12. Seung Hyo Lee
  13. Eui-Cheol Shin
  14. Ho Min Kim
  15. Eugene C Yi
  16. Doo Hyun Chung
(2021)
Soluble Fas ligand drives autoantibody-induced arthritis by binding to DR5/TRAIL-R2
eLife 10:e48840.
https://doi.org/10.7554/eLife.48840
  2. Download BibTeX
  3. Download .RIS

Abstract

To date, no study has demonstrated that soluble Fas ligand (sFasL)-mediated inflammation is regulated via interaction with Fas in vivo. We found that FasL interacts specifically with tumor necrosis factor receptor superfamily (TNFRSF)10B, also known as death receptor (DR)5. Autoantibody-induced arthritis (AIA) was attenuated in FasL (Faslgld/gld)- and soluble FasL (FaslΔs/Δs)-deficient mice, but not in Fas (Faslpr/lpr and Fas–/–)- or membrane FasL (FaslΔm/Δm)-deficient mice, suggesting sFasL promotes inflammation by binding to a Fas-independent receptor. Affinity purification mass spectrometry analysis using human (h) fibroblast-like synovial cells (FLSCs) identified DR5 as one of several proteins that could be the elusive Fas-independent FasL receptor. Subsequent cellular and biochemical analyses revealed that DR5 interacted specifically with recombinant FasL–Fc protein, although the strength of this interaction was approximately 60-fold lower than the affinity between TRAIL and DR5. A microarray assay using joint tissues from mice with arthritis implied that the chemokine CX3CL1 may play an important downstream role of the interaction. The interaction enhanced Cx3cl1 transcription and increased sCX3CL1 production in FLSCs, possibly in an NF-κB-dependent manner. Moreover, the sFasL–DR5 interaction-mediated CX3CL1–CX3CR1 axis initiated and amplified inflammation by enhancing inflammatory cell influx and aggravating inflammation via secondary chemokine production. Blockade of FasL or CX3CR1 attenuated AIA. Therefore, the sFasL–DR5 interaction promotes inflammation and is a potential therapeutic target.

Introduction

The Fas/Fas ligand (FasL) pathway is a major regulator of cell-mediated apoptosis and immune-privileged status in the eyes and testes (Bellgrau et al., 1995; Griffith et al., 1995) and plays a pivotal role in maintaining immune tolerance to autoantigens. Membrane-bound FasL (mFasL) can be proteolytically cleaved by matrix metalloproteinases (MMPs), generating soluble FasL (sFasL) (Kayagaki et al., 1995). mFasL is essential for triggering Fas-induced apoptosis (O' Reilly et al., 2009). By contrast, sFasL regulates non-apoptotic processes (Seino et al., 1998) but stimulates apoptosis in fibroblast-like synovial cells (FLSCs) of patients with rheumatoid arthritis in a dose-dependent manner (Kim et al., 2007). Therefore, mFasL and sFasL have different functions in vivo that are not completely understood (O' Reilly et al., 2009).

FasL-mediated apoptotic and non-apoptotic cellular pathways regulate biological processes via interaction with Fas. Several studies have demonstrated that sFasL acts as a Fas-dependent chemotactic agent for neutrophils in non-apoptotic pathways (Ottonello et al., 1999; Seino et al., 1998), and sFasL levels are increased in patients with autoimmune diseases, graft-versus host disease, and cancer (Das et al., 1999; Hashimoto et al., 1998; Murayama et al., 1999). Therefore, sFasL may be involved in stimulating inflammation. However, whether sFasL-mediated inflammation is regulated via interaction with Fas in vivo and how this regulates inflammation in various microenvironments remains unclear. We identified a Fas-independent membrane-bound receptor for FasL and investigated its function. In this study, we demonstrate that death receptor (DR)five is a Fas-independent membrane-bound receptor for FasL and that the sFasL-DR5 interaction increases inflammation via the CX3XL1–CX3CR1 axis.

Results

DR5 is a Fas-independent receptor for sFasL that promotes arthritis

To investigate the Fas-independent function of FasL in the arthritis model, we injected wild-type (WT), Faslpr/lpr, Faslgld/gld, and Fas–/– mice with K/BxN serum (Ji et al., 2001). The WT, Faslpr/lpr, and Fas–/– mice developed autoantibody-induced arthritis (AIA), whereas the Faslgld/gld mice exhibited attenuation of joint swelling and expression of Il6, Tnfa, Il1b, Ccl2, and Ccl3 (Figure 1A, Figure 1—figure supplement 1A–C). In addition, anti-FasL antibody, but not anti-Fas antibodies, attenuated AIA and joint pro-inflammatory cytokine expression in WT mice (Figure 1—figure supplement 1D,E). K/BxN serum transfer increased sFasL in the synovial fluid of WT and FaslΔm/Δm, but not FaslΔs/Δs mice (Figure 1—figure supplement 1F). FaslΔs/Δs and Faslgld/gld, but not FaslΔm/Δm, mice exhibited minimal joint swelling and cytokine expression. Administration of recombinant (r) sFasL induced joint inflammation in FaslΔs/Δs and Faslgld/gld mice (Figure 1B–D, Figure 1—figure supplement 1G–I). Furthermore, rsFasL injection aggravated joint inflammation in both Fas–/– mice and WT mice (Figure 1—figure supplement 1J). Adoptive transfer of splenocytes from WT, but not Faslgld/gld, mice also induced arthritis in Faslgld/gld mice (Figure 1—figure supplement 1K). Taken together, these findings suggest that sFasL generation in hematopoietic cells might be a possible biological candidate to promote AIA by binding to a Fas-independent receptor. Consequently, we performed affinity purification–mass spectrometry (AP-MS) analyses using human (h) FLSCs (Figure 1—figure supplement 2A,B; Table 1). The results imply that DR5, which is encoded by the tumor necrosis factor receptor superfamily (TNFRSF)10B gene, may be a Fas-independent FasL receptor (Figure 1E). DR5 was expressed in synovial non-immune cells in mice with AIA, rather than in leukocytes, in mice with AIA. DR5 was also expressed in hFLSCs and was more abundant in joint tissues from patients with rheumatoid arthritis than in tissues from healthy control subjects (Figure 1F,G, Figure 1—figure supplement 2C and D). In addition, biotinylated recombinant hFasL bound to EL4 mouse T cells expressing hDR5. This interaction was blocked by anti–hDR5 antibodies or recombinant human (h) TNF-related apoptosis-inducing ligand (TRAIL). Biotinylated hTRAIL bound to EL4 mouse T cells expressing hDR5 but not to those expressing hFas (Figure 1H, Figure 1—figure supplement 2F–I). Furthermore, an anti-Fas or anti-DR5 antibody blockade partially inhibited the binding of hFasL–Fc protein to the cell surface of hFLSCs (Figure 1—figure supplement 2E). Anti-DR5 and Fas antibodies did not show cross-reactivity between human and mouse DR5 and Fas, respectively (Figure 1—figure supplement 3A–D). Binding of hFasL–Fc protein to the cell surface was completely inhibited by knockdown of TNFRSF10B and FAS, but not other TNFRSFs such as TNFRSF1A (TNFR1), TNFRSF10A (DR4), and TNFRSF12 (DR3) in the presence of anti-Fas antibodies (Figure 1—figure supplement 4A,B). Furthermore, knockout (KO) of the FAS or TNFRSF10B gene in hFLSCs by CRISPR/Cas9 gene editing (Figure 1—figure supplement 4C,D) decreased binding of biotinylated sFasL to cell surfaces (Figure 1I), and binding was completely abolished in FAS and TNFRSF10B double knockout (DKO) hFLSCs. Re-expression of DR5 gene in DKO hFLSCs rescued biotinylated sFasL and sTRAIL binding to these cells, whereas biotinylated sFasL, but not biotinylated sTRAIL, bound to DKO cells re-expressing the FAS gene (Figure 1I, Figure 1—figure supplement 4D,E). Furthermore, specific binding of DR5 to FasL was confirmed by surface plasmon resonance (KD: 1.23 × 10−12 M for DR5–FasL versus 6.01 × 10−13 M for DR5–TRAIL; Figure 1—figure supplement 4F,G) and immunoprecipitation of lysates from sFasL-treated hFLSCs using anti-DR5 antibodies or anti-His antibodies to His-tagged sFasL (Figure 1J, Figure 1—figure supplement 4H). Meanwhile, rhDR5–Fc protein binding to EL4 cells expressing WT hFasL was inhibited by treatment with recombinant hTRAIL, anti-hDR5, or anti-hFasL antibodies, indicating that DR5 can interact with both mFasL and sFasL (Figure 1K, Figure 1—figure supplement 4I–L). Collectively, these findings indicate that DR5 is a Fas-independent receptor for both mFasL and sFasL.

Figure 1 with 4 supplements see all
Download asset Open asset
Death receptor (DR5) is a Fas-independent receptor for soluble Fas ligand (sFasL) that promotes arthritis.

(A) Joint swelling and clinical scores in wild-type (WT), Faslpr/lpr, Faslgld/gld, and Fas–/– mice (n = 6 per group). (B) Joint swelling and clinical scores in WT, FaslΔm/Δm, FaslΔs/Δs, and FaslΔs/Δs mice injected with sFasL (n = 6 per group). (C, D) Gross and microscopic examination of arthritis (magnified 10× in the upper panel and 200× in the lower panel). Scale bars: 1 cm (C), 200 μm (D, upper panel), and 100 μm (D, lower panel). (E) Tandem mass spectra of unique DR5 peptides. (F) Transcript levels of Tnfrsf10b in synovial CD45+ immune cells and CD45– non-immune cells from WT mice with or without AIA. (G) Immunohistochemistry of DR5 expression in joint tissue from a healthy control subject and a patient with rheumatoid arthritis (n = 3; magnified 400×, scale bar: 50 μm). (H) Flow cytometric analysis of biotinylated protein binding to EL4 cells transfected with human WT TNFRSF10B preincubated with recombinant hTRAIL, or simultaneously incubated with anti-FasL, or anti-DR5 antibodies. (I) Flow cytometric analysis of biotinylated FasL binding on hFLSCs with FAS and/or TNFRSF10B knockout, and TNFRSF10B and/or FAS overexpression in FAS and TNFRSF10B double knockout (DKO) cells. (J) hLFSCs were preincubated with TNF-α (as a negative control), FasL, or TRAIL and cross–linked with BS3. Lysates from these cells were immunoprecipitated with anti–DR5 or control IgG antibody and immunoblotted with anti-DR5, TNF-α, FasL, or TRAIL antibodies. (K) Flow cytometric analysis of DR5–Fc binding on EL4 cells transfected with human WT FASLG in the presence of recombinant hTRAIL, anti-DR5, or FasL antibodies. Data were pooled from three (A, B, and D–G) or four (H, K) independent experiments and are presented as mean ± standard error of the mean (SEM). *p<0.05; **p<0.01; ***p<0.005. Data were analyzed using one-way analysis of variance (ANOVA).

Figure 1—source data 1

Numerical data obtained during experiments represented in Figure 1, Figure 1—figure supplements 1, 3, and 4.

https://cdn.elifesciences.org/articles/48840/elife-48840-fig1-data1-v1.xlsx
Table 1
The list of proteins obtained from AP-MS experiment.
GeneDescriptionLocationFamily
 JUPJunction plakoglobinPlasma MembraneOther
 HBA1/HBA2Hemoglobin, alpha 1Extracellular SpaceTransporter
 FASLGFas ligand (TNF superfamily, member 6)Extracellular SpaceCytokine
 AFPAlpha-fetoproteinExtracellular SpaceTransporter
 PKP1Plakophilin 1Plasma MembraneOther
 TNFRSF10BTumor necrosis factor receptor superfamily, member 10bPlasma MembraneTransmembrane receptor
 LAMA3Laminin, alpha 3Extracellular SpaceOther
 EPHA4EPH receptor A4Plasma MembraneKinase
 LTFLactotransferrinExtracellular SpacePeptidase
 ABCB1ATP-binding cassette, sub-family B (MDR/TAP), member 1Plasma MembraneTransporter
 LRP2Low-density lipoprotein receptor-related protein 2Plasma MembraneTransporter
 RIMS1Regulating synaptic membrane exocytosis 1Plasma MembraneOther
 PTPRDProtein tyrosine phosphatase, receptor type, DPlasma MembranePhosphatase
 ATRNAttractinExtracellular SpaceOther
 ADAM30ADAM metallopeptidase domain 30Plasma MembranePeptidase
 HLA-B*Major histocompatibility complex, class I, BPlasma MembraneTransmembrane receptor
 KCNC2Potassium voltage-gated channel, Shaw-related subfamily, member 2Plasma MembraneIon channel
 SPPL2ASignal peptide peptidase like 2APlasma MembranePeptidase
 BSNBassoon presynaptic cytomatrix proteinPlasma MembraneOther
 PTPRGProtein tyrosine phosphatase, receptor type, GPlasma MembranePhosphatase
 LRRC23Leucine-rich repeat containing 23Plasma MembraneOther
 LTBP3Latent transforming growth factor beta binding protein 3Extracellular SpaceOther
 PLA2R1Phospholipase A2 receptor 1, 180 kDaPlasma MembraneTransmembrane receptor
 OGFROpioid growth factor receptorPlasma MembraneOther
 METMET proto-oncogene, receptor tyrosine kinasePlasma MembraneKinase
 NLGN2Neuroligin 2Plasma MembraneEnzyme
 CD70CD70 moleculeExtracellular SpaceCytokine
 HLA-A*Major histocompatibility complex, class I, APlasma MembraneOther
 SPTBN1*Spectrin, beta, non-erythrocytic 1Plasma MembraneOther

FasL and TRAIL compete for DR5 binding and exert similar effects on cell death

TRAIL (TNFSF10) is a specific ligand for DR5 (Walczak et al., 1997). Preincubation with rhFasL, but not rhTRAIL, decreased rhFasL–Fc protein binding to EL4 cells expressing hFas (Figure 2A, Figure 1—figure supplement 2G), whereas preincubation with rhTRAIL or rhFasL inhibited rhFasL–Fc protein binding to hFLSCs and hDR5-expressing EL4 cells (Figure 2B, Figure 1—figure supplement 2F and J). Incubation with excess sTRAIL or sFasL inhibited the sFasL–DR5 (lanes 2 and 3) and sTRAIL–DR5 (lanes 5 and 6) interactions in hFLSCs treated with low concentrations of sFasL or sTRAIL, respectively. (Figure 2—figure supplement 1A). These findings indicate that TRAIL and FasL compete for binding to DR5. The crystal structures of the FasL/DcR3 (Protein Data Bank: 4 MSV) and TRAIL/DR5 (1D4V and 1DU3) complexes show that FasL forms a trimer similar to other tumor necrosis factor ligands, and DcR3 or DR5 binds to the interface formed by two adjacent FasL or TRAIL monomers stoichiometrically in a ratio of 3:3 (FasL:DcR3 or TRAIL:DR5; Figure 2—figure supplement 1B; Cha et al., 2000; Liu et al., 2016; Mongkolsapaya et al., 1999). Moreover, superimposition of these two complexes demonstrates that the interactions are similar. To test whether the binding mechanisms of FasL and TRAIL to DR5 are similar, we mutated amino acids in cysteine-rich domains (CRDs) 2 and 3 of DR5, which are critical for the TRAIL–DR5 interaction (Figure 2C, Figure 2—figure supplement 1C). In contrast to WT hDR5, the rhFasL–Fc protein did not bind to EL4 cells expressing hDR5 with mutations in CRD2 or CRD3 (Figure 2D), although the expression levels of WT and mutant hDR5 were similar (Figure 2—figure supplement 1D). Moreover, rhDR5–Fc protein binding was abolished in EL4 cells expressing mutated FasL, which inhibited the interaction between FasL and DcR3 (Figure 2E, Figure 2—figure supplement 1E). Collectively, these findings indicate that the regions of DR5 that bind to hFasL overlap with those that bind to hTRAIL and that FasL binds to DcR3 and DR5 by similar mechanisms, although the precise sites of interaction between hFasL and hDR5 remain unclear. Moreover, the sFasL–DR5 and sTRAIL–DR5 interactions induced apoptosis and necroptosis in hFLSCs, but cell death was inhibited by NSCI (caspase three inhibitor) and GSK’872 (receptor-interacting serine/threonine-protein kinase three inhibitor), respectively. FasL-induced apoptosis and necroptosis were partially inhibited in Fas or DR5 gene KO hFLSCs and almost abolished in Fas plus DR5 DKO hFLSCs. These findings indicate that FasL–DR5 and FasL–Fas interactions induce apoptosis and necroptosis (Figure 2F,G, Figure 2—figure supplement 2A–D). However, administration of Z-VAD-FMK, a caspase inhibitor, did not alter AIA in WT or Faslgld/gld mice injected with sFasL, although cell death of immune cells in the joints was inhibited in WT mice with arthritis (Figure 2H, Figure 2—figure supplement 3A–B). This indicates that sFasL–DR5 interaction-induced apoptosis has little effect on AIA. Taken together, these results imply that FasL and TRAIL compete for DR5 binding and exert similar effects on cell death.

Figure 2 with 3 supplements see all
Download asset Open asset
FasL and TRAIL compete for DR5 binding and exert similar effects on cell death.

(A, B) FasL–Fc binding to hFLSCs or EL4 cells transfected with human FAS, or TNFRSF10B after preincubation with human sTRAIL or sFasL. (C) Model of FasL and DR5 derived from the crystal structure of the FasL/DcR3 complex (Protein Data Bank: 4 MSV) and TRAIL/DR5 complex (Protein Data Bank: 1D4V). (D, E) Flow cytometric analysis of FasL–Fc or DR5–Fc binding to EL4 cells transfected with human WT or mutated TNFRSF10B or FASLG. (F, G) Comparison of the effects of sFasL and sTRAIL on (F) apoptosis and (G) necroptosis in hFLSCs. (H) Joint swelling and clinical scores in Faslgld/gld mice injected with Z–VAD–FMK and/or sFasL (n = 6 per group). Data were pooled from four (A, B, and D–G) or three (H) independent experiments and are presented as mean ± SEM. *p<0.05; **p<0.01; ***p<0.005. Data were analyzed using one-way ANOVA.

Figure 2—source data 1

Numerical data obtained during experiments represented in Figure 2, Figure 2—figure supplement 3.

https://cdn.elifesciences.org/articles/48840/elife-48840-fig2-data1-v1.xlsx

sFasL–DR5 interaction enhances CX3CL1 expression in human and mouse FLSCs

To explore the non-apoptotic mechanism by which sFasL exacerbates AIA, we performed a microarray assay using joint tissues from WT, Faslpr/lpr, and Faslgld/gld mice with AIA. Gene expression patterns were similar in joint tissues from WT and Faslpr/lpr mice, but they differed in WT and Faslgld/gld mice with AIA (Figure 3A). Among the chemokines, CX3CL1 expression in joint tissues differed the most between WT or Faslpr/lpr and Faslgld/gld mice with AIA (Figure 3B). Consistently, Cx3cl1 expression was low in joint tissues from Faslgld/gld or Tnfrsf10 KO mice with AIA, whereas expression was high in joint tissues from WT, Faslpr/lpr, and Fas–/– mice (Figure 3C). CX3CL1 is expressed by macrophages and FLSCs in the synovial tissue of patients with rheumatoid arthritis and plays a critical role in animal models of arthritis (Blaschke et al., 2003; Nanki et al., 2002; Nanki et al., 2004; Ruth et al., 2001). CX3CL1 also functionally acts as two distinct forms; sCX3CL1 is generated via cleavage of mCX3CL1 (Garton et al., 2001; Hundhausen et al., 2003). Both sFasL and FasL–Fc stimulation increased the levels of CX3CL1 transcripts and sCX3CL1 protein in culture supernatants from human and mouse FLSCs, but not in culture supernatants from mouse joint leukocytes (Figure 3D, Figure 3—figure supplement 1A–C). Anti-DR5 antibody treatment or DR5-deficiency (e.g., siRNA-mediated knockdown, CRISPR/Cas9-mediated or in vivo KO of TNFRSF10B or Tnfrsf10b in human or mouse FLSCs, respectively) inhibited sFasL-mediated expression of CX3CL1 or Cx3cl1 transcripts and sCX3CL1 protein production in culture supernatants from human and mouse synovial fibroblasts. In contrast, knockdown or KO of FAS, TNFRSF10A, or other members of the tumor necrosis factor receptor superfamily, as well as anti-Fas antibodies did not alter CX3CL1 expression (Figure 3E–G, Figure 3—figure supplement 1D–K). These findings imply that the sFasL–DR5 interaction increases CX3CL1 and Cx3cl1 transcripts and sCX3CL1 protein production in human and mouse FLSCs.

Figure 3 with 2 supplements see all
Download asset Open asset
The sFasL–DR5 interaction enhances CX3CL1 expression by human and mouse FLSCs.

(A, B) Microarray assay using joint tissues from WT, Faslpr/lpr, and Faslgld/gld mice with arthritis. (C) Cx3cl1 transcript levels estimated in joint tissues from WT, Faslpr/lpr, Fas–/–, Faslgld/gld, FaslΔs/Δs, and Tnfrsf10b KO mice with arthritis. (D) Cx3cl1 expression in CD45+ immune and CD45– non–immune cells from the joints of WT mice with arthritis after sFasL treatment. (E, F) CX3CL1 transcript levels estimated in hFLSCs in the presence of anti-Fas and/or anti-DR5 antibodies (E) and FAS (Fas), TNFSF10B (DR5), or FAS, and TNFRSF10B DKO, or TNFRSF10B and FAS overexpression in DKO hFLSCs (F). (G) Cx3cl1 expression in synovial fibroblasts from WT, Faslpr/lpr, Fas–/–, or Tnfrsf10b KO mice in the presence or absence of sFasL. (H, I) CX3CL1 transcript levels estimated after sFasL stimulation in hFLSCs in the presence of MEK (U0126), ERK (PD980259), p38 kinase (SB203580), and NF-κB (MG132 and BMS345541) inhibitors (H) or transfection with control, RELA, CHUK (IKKa), or IKBKB (IKKb) siRNA (I). (J) Synovial fibroblasts obtained from WT mice with arthritis were incubated with sFasL or sTRAIL and CX3CL1 levels were measured using ELISA. (K) hFLSCs were stimulated with sFasL after preincubation with various concentrations of sTRAIL for 30 min and CX3CL1 levels were measured in the culture supernatant. Data were pooled from three (C–G and K) or four (H–J) independent experiments and are presented as mean ± SEM (n = 4 for C–K). *p<0.05; **p<0.01; ***p<0.005. Data were analyzed using one-way ANOVA.

Figure 3—source data 1

Numerical data obtained during experiments represented in Figure 3, Figure 3—figure supplements 1 and 2.

https://cdn.elifesciences.org/articles/48840/elife-48840-fig3-data1-v1.xlsx

In addition, sFasL-mediated increases in CX3CL1 transcripts and sCX3CL1 protein production were suppressed by administration of IKK (BMS345541) or proteasome (NF-κB) inhibitor (MG132) but not by administration of MEK (U0126), ERK (PD980259), or p38 kinase (SB203580) inhibitors (Figure 3H, Figure 3—figure supplement 1L). Knockdown of RELA, CHUK, or IKBKB inhibited sFasL-mediated increases in CX3CL1 transcripts and sCX3CL1 protein production in hFLSCs (Figure 3I and Figure 3—figure supplement 1M). Furthermore, sFasL treatment increased phosphorylated (p)-p65 and p-IκΒα, but decreased total IκΒα in hFLSCs (Figure 3—figure supplement 1N). Inhibition of caspase activity did not affect the levels of CX3CL1 transcripts and CX3CL1 protein production (Figure 3—figure supplement 1O,P). These findings indicate that sFasL–DR5 interaction mediates stimulation of CX3CL1 transcription and sCX3CL1 protein production in hFLSCs, and this may be dependent on the NF-κB signaling pathway.

In contrast to sFasL, sTRAIL did not alter the expression of CX3CL1 transcripts or sCX3CL1 protein in hFLSCs and mouse synovial cells. However, preincubation with sTRAIL inhibited sFasL-mediated CX3CL1 transcript accumulation and sCX3CL1 protein production in a dose-dependent manner (Figure 3J,K, Figure 3—figure supplement 2A and B). Furthermore, administration of sFasL, but not sTRAIL, exacerbated AIA and the expression of Cx3cl1, as well as pro-inflammatory cytokines and chemokines in the joints of WT or Faslgld/gld mice (Figure 3—figure supplement 2C–F). These findings indicate that sFasL and sTRAIL have differential effects on the expression of CX3CL1 transcripts and sCX3CL1 protein production by FLSCs.

The sFasL–DR5 interaction promotes joint inflammation via the CX3CL1–CX3CR1 axis

To investigate the effects of the sFasL–DR5 interaction on AIA, we administered anti-DR5 or anti-Fas antibodies to WT or Faslgld/gld mice given sFasL. Anti-DR5, but not anti-Fas, antibodies attenuated AIA (Figure 4A, Figure 4—figure supplement 1A,B). AIA was attenuated in Tnfrsf10b KO mice like as Faslgld/gld and FaslΔs/Δs mice (Figure 4B,C). Moreover, administration of sFasL increased AIA in WT mice, whereas it did not in Tnfrsf10b KO mice. Injection of sFasL increased Cx3cl1 transcript levels in the joints of WT, FaslΔs/Δs, and FaslΔm/Δm mice, but not in the joints of Tnfrsf110b KO mice (Figure 4D). Injection of sCX3CL1 induced AIA in Faslgld/gld, FaslΔs/Δs, and Tnfrsf110b KO mice and increased the expression levels of Ccl2, Ccl3, and Cxcl10 in joint tissues compared to control mice (Figure 4E,F, Figure 4—figure supplement 1C–F). Furthermore, AIA was attenuated more in Cx3cr1 KO than in WT mice, but was not exacerbated by sFasL administration (Figure 4G). Among the inflammatory cells in the joints, macrophages and T cells expressed CX3CR1, whereas neutrophils and eosinophils did not (Figure 5A, Figure 5—figure supplement 1). CX3CL1 stimulation increased the migration and production of CCL2, CCL3, and CXCL10 in human and mouse CX3CR1+ cells. This was inhibited by CX3CR1 blockade in mouse cells, whereas sFasL did not alter the migration of these cells (Figure 5B–E). These findings suggest that the sFasL–DR5 interaction may initiate and amplify inflammation via the CX3CL1–CX3CR1 axis. Thus, we injected anti-FasL or anti-CX3CR1 antibodies into mice with AIA to investigate any therapeutic effects on arthritis. We found that blockade of FasL or CX3CR1 at different phases of AIA significantly attenuated arthritis and chemokine production in the joints (Figure 6A–F, Figure 6—figure supplement 1A–F). Taken together, these findings indicate that the sFasL–DR5 interaction promotes arthritis by regulating the CX3CL1–CX3CR1 axis, which increases CCL2, CCL3, and CXCL10 production by CX3CR1+ immune cells.

Figure 4 with 1 supplement see all
Download asset Open asset
The sFasL–DR5 interaction promotes joint inflammation via the CX3CL1–CX3CR1 axis.

(A) Joint swelling and clinical scores in WT mice injected with anti-DR5 or anti-Fas antibodies to measure AIA (n = 5 per group). (B, C) Joint swelling and clinical scores in WT and Tnfrsf10b KO mice injected with sFasL or phosphate-buffered saline (PBS) to measure AIA (n = 5 per group). (D) Cx3cl1 transcript levels in the joints were estimated in WT, Tnfrsf10b KO, FaslΔs/Δs, and FaslΔm/Δm mice injected with sFasL or PBS to measure AIA (n = 5). (E, F) Joint swelling and clinical scores (E), and transcript levels of various cytokines and chemokines in joint tissues of Tnfrsf10b KO mice injected with CX3CL1 or PBS to measure AIA (F) (n = 6 per group). (G) Joint swelling and clinical scores of WT and Cx3cr1 KO mice in the presence or absence of sFasL to measure AIA (n = 6 per group). Data were pooled from three independent experiments and are presented as mean ± SEM. *p<0.05; **p<0.01; ***p<0.005. Data were analyzed using one-way ANOVA.

Figure 4—source data 1

Numerical data obtained during experiments represented in Figure 4, Figure 4—figure supplement 1.

https://cdn.elifesciences.org/articles/48840/elife-48840-fig4-data1-v1.xlsx
Figure 5 with 1 supplement see all
Download asset Open asset
CX3CL1 stimulation increases the migration and production of chemokines in human and mouse CX3CR1+ cells.

(A) Flow cytometric analysis of CX3CR1 expression in immune cells from arthritic joint tissues. (B) Migration assay for synovial CX3CR1+ or CX3CR1– immune cells upon stimulation with CX3CL1 in the presence or absence of anti-CX3CR1 antibodies (green) and CD45+ immune cells stimulated with sFasL (blue; n = 5). (C) Ccl2, Ccl3, and Cxcl10 transcript levels in synovial macrophages after stimulation with CX3CL1 (n = 6). (D) Levels of chemokines in supernatants of synovial leukocyte cultures from patients with rheumatoid arthritis, measured using ELISA after treatment with CX3CL1 (n = 6). (E) Migration assay of synovial leukocytes from patients with rheumatoid arthritis after stimulation with sFasL or CX3CL1 (n = 4). Data were pooled from three (A, C, and D) or four (B, E) independent experiments and are presented as mean ± SEM of independent experiments. *p<0.05; **p<0.01; ***p<0.005. Data were analyzed using one-way ANOVA.

Figure 5—source data 1

Numerical data obtained during experiments represented in Figure 5.

https://cdn.elifesciences.org/articles/48840/elife-48840-fig5-data1-v1.xlsx
Figure 6 with 1 supplement see all
Download asset Open asset
Blockade of FasL or CX3CR1 at different phases of AIA-attenuated joint inflammation.

(A–F) Ankle thicknesses of WT mice injected with anti-FasL or anti-CX3CR1 antibodies (10 μg per mouse daily) on days 0–9 (A, D), days 5–9 (B, E), and days 8–10 (C, F) to measure AIA (A–C, n = 6; D–F, n = 4). The arrows in the diagrams indicate the day on which antibodies were first injected. Data were pooled from three independent experiments and are presented as mean ± SEM. *p<0.05, **p<0.01, ***p<0.005. Data were analyzed using one-way ANOVA.

Figure 6—source data 1

Numerical data obtained during experiments represented in Figure 6, Figure 6—figure supplement 1.

https://cdn.elifesciences.org/articles/48840/elife-48840-fig6-data1-v1.xlsx

Discussion

To date, the overwhelming majority of studies have demonstrated that FasL stimulates various biological processes by interacting with Fas because Fas is reportedly a receptor for FasL (Guégan and Legembre, 2018). In contrast, we demonstrated that DR5 is a Fas-independent membrane-bound receptor for FasL that promotes inflammation. DR5 (TRAIL–R2) is one of the four membrane receptors that bind TRAIL and is expressed in cancer cells and various tissues (Wilson et al., 2009). After binding to TRAIL, DR5 recruits an adaptor molecule via death domain interactions and induces the formation of the death-inducing signaling complex, resulting in cellular apoptosis (Wilson et al., 2009). The TRAIL–DR5 interaction also simulates cell activation, maturation, motility, and proliferation (Cullen and Martin, 2015). Similarly, our experiments showed that the sFasL–DR5 interaction induced apoptosis and non-apoptotic responses in FLSCs, implying that the biological effects of sFasL in vitro and in vivo may be attributable to interaction with either Fas or DR5. Soluble DcR3 also bind to FasL, inhibiting the function of FasL in vivo (Pitti et al., 1998). Furthermore, several studies have demonstrated that endogenous DcR3 attenuates the Th1 response and skews the differentiation of tumor-associated macrophages, whereas DcR3–Fc modulates dendritic cell maturation from CD14+ monocytes (Hsu et al., 2002; Hsu et al., 2005; Tai et al., 2012). These findings suggest that sFasL-mediated inflammation in mice is attributable to sFasL–DcR3 interaction. However, this is impossible because DcR3 is expressed in humans, but not in mice (Lin and Hsieh, 2011). We suggest that FasL plays both DR5- and Fas-dependent roles in regulating various biological events in vivo, which is a paradigm shift in the biology of the classic Fas–FasL pathway.

TNFRSF proteins enhance the production of various pro-inflammatory cytokines and chemokines in an NF-κB-dependent manner (Cullen and Martin, 2015). Similarly, sTRAIL treatment or overexpression of DR5 or DR4 induces the secretion of inflammatory cytokines (Tang et al., 2009a; Tang et al., 2009b). However, no report has described the effect of DR5 on CX3CL1 production. CX3CL1, which is expressed in endothelial cells and FLSCs, promotes cell survival, adhesion, chemotaxis, and migration via secondary chemokines (Nanki et al., 2017). In our experiments, sFasL–DR5 interaction enhanced Cx3cl1 transcription and sCX3CL1 protein production by FLSCs in mice and humans, possibly in an NF-κB dependent manner, whereas sTRAIL–DR5 interaction did not. Thus, the sFasL–DR5 interaction, but not sTRAIL–DR5 interaction, is a potent inducer of CX3CL1 expression in FLSCs. Furthermore, sFasL–DR5 interaction-mediated CX3CL1 production by FLSCs triggers the migration and chemokine production of joint leukocytes in a CX3CR1-dependent manner, resulting in joint inflammation. Several studies have demonstrated that sFasL acts as a potent chemotactic agent for human and mouse neutrophils at concentrations incapable of inducing cell apoptosis (Ottonello et al., 1999; Seino et al., 1998). However, our experiments demonstrated that sFasL promoted AIA via its interaction with DR5 by producing mediators, rather than acting as a chemoattractant. Thus, the sFasL–DR5 interaction may be an initiating event that amplifies inflammation via CX3CL1 production through two steps: the CX3CL1-mediated influx of inflammatory cells to target sites and the production of secondary chemokines such as CCL2, CCL3, and CXCL10 by CX3CR1+ immune cells. Moreover, antibody blockade of FasL or CX3CR1 attenuated AIA in mice, suggesting that sFasL–DR5 interaction and CX3CL1–CX3CR1 axis could be therapeutic targets for controlling inflammation. In several studies, DR5 KO mice exhibited increases in tumor metastases and inflammation (Finnberg et al., 2008; Zhu et al., 2014), which is difficult to understand whether the sFasL–DR5 interaction stimulates inflammation. However, DR5 and FasL are expressed in various cell types (O'Brien et al., 2005; O'Connell, 2000; Yuan et al., 2018), and the sFasL–DR5 interaction likely regulates tumor surveillance and inflammation via a complex signaling network involving various biological effects that require further investigation.

The sFasL–DR5 and sTRAIL–DR5 interactions similarly induced apoptosis and necroptosis in FLSCs, and the regions of DR5 that bound FasL overlapped with those that bound TRAIL. However, sFasL binds DR5, but not DR4, whereas sTRAIL binds both DR4 and DR5, suggesting that the three-dimensional structures and binding mechanisms of interaction of sFasL and sTRAIL may differ. Therefore, although the effector functions, structures, signal transduction pathways, and downstream mechanisms involved may be similar, the two interactions may exhibit some differences. Furthermore, differences in CX3CL1 production may be attributable to differences in binding affinity, critical amino acids in DR5, or signal strength. Increasing evidence indicates that clustering of death receptors in lipid rafts plays a critical role in optimal DR5-mediated signal transduction (Holland, 2014). Thus, understanding how the sFasL–DR5 interaction is fine-tuned to optimize CX3CL1 expression may be necessary for identifying therapeutic targets to decrease inflammation.

In contrast to our current results, previous studies found that FasL-mediated apoptosis attenuated joint inflammation in murine arthritis models (Guéry et al., 2000; Hsu et al., 2001; Zhang et al., 1997). Therefore, FasL may regulate joint inflammation by different mechanisms in different arthritis models, possibly due to the distinct microenvironments of each (Ji et al., 2002). The K/BxN serum transfer model used in our experiments is confined to the terminal effector inflammatory responses induced by the T and B cell-independent deposition of antibodies in the joints (Ji et al., 2002). Thus, sFasL-mediated induction of joint inflammation may occur in the effector phase rather than the inductive phase of inflammation, although it is unclear whether this sFasL-mediated regulation is involved in the inductive phase of rheumatoid arthritis, which is dependent on T and B cells. Moreover, we did not investigate the distinct functions of sFasL versus mFasL in joint inflammation and unique functions for mFasL and sFasL may produce divergent inflammatory responses. We found that neither mFasL deficiency nor treatment with a caspase inhibitor substantially affected sFasL-mediated joint inflammation in mice. Perhaps mFasL regulates the function of leukocytes via activation-induced cell death during the inductive phase of rheumatoid arthritis, whereas an sFasL-mediated non-apoptotic mechanism promotes joint inflammation during the effector phase. In conclusion, our experiments demonstrate that DR5 is a Fas-independent membrane-bound receptor for FasL and that sFasL–DR5 interaction promotes inflammation by regulating the CX3CL1–CX3CR1 axis, which enhances production of secondary chemokines by CX3CR1+ immune cells.

Materials and methods

Mice

The KRN TCR transgenic mouse (Kouskoff et al., 1996) was kindly provided by Dr. Diane Mathis and Dr. Christophe Benoist of Harvard Medical School (Boston, MA) and maintained in a C57BL/6 (B6) background (K/B). Arthritic mice (K/BxN) were obtained by crossing K/B mice with NOD (N) mice (The Jackson Laboratory, Farmington, CT). Faslpr/lpr and Faslgld/gld mice were obtained from Japan SLC (Hamamatsu, Japan). Fas–/– (B6.129-Fas < tm1Osa>/OsaRbrc) cryopreserved embryos were provided by the RIKEN BRC (Tsukuba, Japan) via the National BioResource Project of MEXT/AMED (Tokyo, Japan) (Adachi et al., 1995). The embryos were thawed and recovered at the Korea Research Institute of Bioscience and Biotechnology (KRIBB) (Ochang, Republic of Korea). Cx3cr1-deficient mice (B6.129-Cx3cr1tm1Zm) were purchased from Taconic (Rensselaer, NY). FaslΔs/Δs and FaslΔm/Δm mice were a generous gift from Dr. Andreas Strasser and Dr. Lorraine O’Reilly (Walter and Eliza Hall Institute of Medical Research, Parkville, Australia). Tnfrsf10b KO mice were obtained from the Mutant Mouse Resource and Research Center (MMRRC, strain #030532-MU). C57BL/6 mice were purchased from Orient Bio, Inc (Seongnam, Republic of Korea). Mice were maintained in a specific pathogen-free environment at the Biomedical Research Institute of Seoul National University Hospital (BRISNUH, Seoul, Republic of Korea). Sex-matched mice aged 6–10 weeks were used for all experiments. All mouse experiments were approved by the Institutional animal care and use committee of the BRISNUH (17–0051 and 20–0171).

Serum transfer, arthritis scoring, histological examination, and immunohistochemistry

Request a detailed protocol

To induce AIA, mice were injected intraperitoneally with 70 μL of sera obtained from arthritic K/BxN mice on days 0 and 2. Ankle thicknesses were measured using calipers (Manostat, New York, NY) and scored as described previously (Kim and Chung, 2012). Clinical scores were presented as the sum of the scores from four limbs. To examine histological alterations in the joint tissues, whole knee joints and hind paws were fixed in 10% formalin, decalcified, and embedded in paraffin. Sections were prepared from the joint tissue blocks and stained with hematoxylin and eosin. Two expert pathologists reviewed all the specimens independently. Histological analyses of joint inflammation were performed by scoring based on synovial hyperplasia, inflammatory cell infiltration, inflammatory exudate, fibroblast proliferation, subcutaneous edema, and body erosion. Each score was based on these criteria: 0, absent; 1, weak to moderate; 2, severe. Histological scores were calculated as the sum of all criteria. Formalin-fixed paraffin-embedded tissue blocks were cut into 4–μm-thick slices and analyzed immunohistochemically using anti-DR5 antibodies (ab-8416, 1:50; Abcam, Cambridge, UK) and a Benchmark XT autostainer (Ventana Medical Systems, Tuscon, AZ), in accordance with the manufacturer's instruction. DR5-positive cells in joint tissues from patients with arthritis and healthy control subjects were counted under light microscopy in three high-power fields (400× magnification). Results are presented as the mean number of DR5-positive cells per high-power field in each sample.

In vivo experiments

Request a detailed protocol

Unless otherwise specified, reagents were injected into mice on days 1 and 3. A total of 1 μg of recombinant mouse sFasL, sTRAIL, or CX3CL1 (R and D Systems, Minneapolis, MN) was injected intraperitoneally and 50 μg of anti-mouse FasL, anti-Fas, anti-DR5, or anti-CX3CR1 antibodies (R and D Systems) was injected intravenously. To inhibit apoptosis in vivo, 50 μg of Z–VAD–FMK (Calbiochem, Billerica, MA,) was administered. The vehicle and isotype control injection were administered in the same way. To transfer splenocytes into Faslgld/gld mice, mouse spleens were homogenized and treated with red blood cell lysis solution (Qiagen, Hilden, Germany). In total, 1 × 106 spleen cells were pooled in phosphate-buffered saline (PBS) and injected intravenously into Faslgld/gld mice on the day before K/BxN serum injections.

Preparation of joint cells from mice

Request a detailed protocol

Total cells from mouse joints were prepared at 8 days after K/BxN serum injections as described previously (Kim and Chung, 2012). The total joint cell preparation contained CD45+ leukocytes and CD45– non-immune synovial cells. To isolate mouse synovial cells, adherent cells were collected from joint cells cultured at 37°C for 24 hr in RPMI 1640 media containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. These cells were then cultured for an additional 2 days. Western blotting analysis showed that the cells were CD45– vimentin+ cadherin11+ FLSCs (data not shown). The cells were stimulated with 200 ng/mL of recombinant mouse sFasL (R and D Systems). To prepare CX3CR1+ cells, the total cells were labeled using allophcocyanin (APC)-conjugated anti-mouse CX3CR1 antibodies (2A9-1; Biolegend, San Diego, CA), followed by binding to anti-APC magnetic beads and enrichment using a magnetically activated cell-sorting (MACS) separator (Miltenyi Biotec, Bergisch Gladbach, Germany).

Preparation of synovial fluid to measure soluble FasL

Request a detailed protocol

Synovial fluid was prepared by dissecting mouse joints in PBS and centrifuging the synovial cells at 500 g for 10 min. The synovial fluid was diluted with PBS to a concentration of approximately 1.5 mg/mL, as determined by a standard Bradford protein assay. The sFasL in the synovial fluid was measured by enzyme-linked immunosorbent assay (ELISA) using a Mouse Fas Ligand/TNFSF6 Quantikine ELISA Kit (R and D System), in accordance with the manufacturer’s instructions.

Culture and stimulation of hFLSCs and isolation of mononuclear immune cells from the synovial fluid of patients with rheumatoid arthritis hFLSCs were isolated from patients with rheumatoid arthritis as described previously (Kang et al., 2009) and cultured in DMEM containing 10% FBS and 1% penicillin/streptomycin. Passages 5–15 of the hFLSCs were treated with 200 ng/mL recombinant human sFasL (R and D Systems) in the presence of 20 μg/mL ZB4 anti-Fas blocking antibodies (Merck, Darmstadt, Germany) to inhibit the sFasL–Fas interaction. To test the FasL–DR5 interaction, hFLSCs were treated with recombinant TRAIL (200 ng/mL or as indicated; R and D Systems) or 20 μg/mL AF631 anti-DR5 neutralizing polyclonal antibodies (R and D Systems) 1 hr prior to FasL treatment. U0126 (ERK), PD98059 (MEK), SB203580 (JNK), MG132 (NF-κB), and BMS345541 (NF-κB) were used to inhibit signaling pathways. All inhibitory reagents were purchased from Sigma-Aldrich.

To obtain synovial immune cells, synovial fluid was collected from 14 patients who had rheumatoid arthritis and fulfilled the 1987 American College of Rheumatology criteria. The fluid was washed, filtered, and then cultured in DMEM containing 10% FBS and 1% penicillin/streptomycin. Non-adherent immune cells were harvested for migration and chemokine production assays and assessed using a hemocytometer and flow cytometry. This study was approved by the Institutional Review Board of Seoul National University Hospital (Seoul, Korea; H 1009–064–332) and informed consent was obtained from all sample donors.

Identification of a Fas-independent FasL receptor

Request a detailed protocol

To identify a Fas-independent FasL receptor, we implemented the in-situ chemical cross-linking method (Kim et al., 2012). SFasL was biotinylated with sulfo-NHS-SS biotin (Thermo Fisher Scientific, Waltham, MA), and 20 μg of biotinylated sFasL–Fc protein was incubated with 1.0 × 108 hFLSCs for 2 hr. Next, 1 mL of 3 μg/mL bis-(sulfo-succinimidyl) subsrate (BS3) cross-linking reagent was added and the mixture was kept at room temperature for 30 min. Then, we added 2 M Tris–Bis HCl pH 7.4 to a final concentration of 15 mM and allowed the cross-linking reaction to quench at room temperature for 15 min. Cells were lysed in radioimmunoprecipitation assay buffer, and biotinylated sFasL-cross-linked protein complexes were purified by avidin affinity chromatography. We used Fc protein to control for non-specific binding to the Fc region. The control samples were otherwise treated identically to the sFasL–Fc protein and Fc protein-incubated samples. The purified sFasL cross-linked protein complexes were separated by 4–12% SDS-PAGE and stained for spectrometry analyses (Shevchenko et al., 2006 ). The peptide samples extracted from the in-gel digestions were suspended in 0.1% formic acid, loaded onto an EASY-Spray Column (15 cm × 50 μm ID, C18 stationary phase), and separated using a 5–40% gradient of 0.1% formic acid in acetonitrile for 90 min at a flow rate of 300 nL/min. Mass spectra were recorded using a Q Exactive mass spectrometer (Thermo Fisher Scientific) interfaced with an Ultimate 3000 HPLC system. The raw data were searched against the Uniprot human database (143,673 entries, June 2014 release) using the Sequest algorithm (version 27) and the SORCERER (Sage-N Research) platform. Carbamidomethylation of cysteine was used as a fixed modification, and oxidation of methionine was used as a variable modification. In-gel digestion with trypsin (Thermo Fisher Scientific) and Coomassie blue staining were performed prior to analysis by mass spectrometry. A protein database search of the biologically relevant experiments identified a total of 144 statistically significant proteins (95% peptide thresholds; 99% protein thresholds) in the sFasL–Fc-incubated samples compared to the Fc protein-incubated samples. Among these, 29 extracellular-space or plasma-membrane proteins were selected and are listed in Table 1. Although other proteins could potentially bind to sFasL, we selected TNFRSF10B (DR5), a TNF-receptor superfamily protein as the most likely candidate.

Surface Plasmon resonance

Request a detailed protocol

A Biacore T100 system (GE Healthcare Bio-Sciences, Chicago, IL), installed at the National Center for Inter-University Research Facilities at Seoul National University, was used to perform surface plasmon resonance experiment. To determine equilibrium affinity measurements, recombinant DR5 (R and D systems: 631-T2-100) was coupled with a CM5 sensor chip using 10 mM sodium acetate (pH 5.5), and recombinant FasL or TRAIL (R and D Systems: 126-FL-010) was passed over the chip at a flow rate of 30 μL/min for 120 s. Dissociation was performed by adding 0.5 M NaOH at a flow rate of 30 μL/min for 240 s. A final response was calculated by subtracting the reading from an empty flow cell. BIA evaluation software version 3.1 (GE Healthcare) was used for to analyze the data. With exceptions of recombinant DR5, TRAIL, and FasL, all materials were purchased from GE Healthcare.

Cell lines

Request a detailed protocol

Mouse EL4 and human Jurkat cells were purchased from the Korean Cell Line Bank (EL4 cells, 40039; Jurkat cells, 40152). The cell lines were authenticated by STR profiling and were negative for mycoplasma contamination.

Plasmids and transfection

Request a detailed protocol

WT human FAS (NM_000043.5), TNFRSF10B (NM_147187.2), FASLG (AY858799.1), TNF (NC_000006.12), and TNFSF10 (NM_001190942.2), and the mutant forms of human TNFRSF10B and FASLG (as described in Figure 2—figure supplement 1B) were cloned into the pIRES3-puro vector (TaKaRa Bio, Inc, Shiga, Japan). EL4 cells were transfected with these genes using a Neon Transfection System kit (once at 1080 V, 50 ms; Thermo Fisher Scientific), in accordance with the manufacturer’s instructions. The expression of transfected genes was confirmed by real-time PCR (Figure 1—figure supplement 4I) or flow cytometry (Figure 1—figure supplement 4K and Figure 2—figure supplement 1D and E).

Transfection of small-interfering RNA (siRNA)

Request a detailed protocol

Human siRNAs for TNFRSF10A (SASI_Hs01_00139573), TNFRSF10B (SASI_Hs01_00040567), TNFRSF1A (SASI_Hs01_00033456), TNFRSF12A (SASI_Hs01_00129286), FAS (SASI_Hs02_00301734), RELA (SASI_Hs01_00171091), CUHK (SASI_Hs01_00206921), and IKBKB (SASI_Hs01_00156170), and the MISSION siRNA universal negative control were purchased from Sigma-Aldrich (St. Louis, MO). Human synovial cells were transfected with siRNA by electroporation using the Neon Transfection System kit (Thermo Fisher Scientific), in accordance with the manufacturer’s instructions. After 24 hr of transfection, cells were stimulated with 400 ng/mL sFasL (R and D Systems).

CRISPR/Cas9 genome editing

Request a detailed protocol

TrueGuide sgRNA (FAS, no. A35511; CRISPR872691_SGM – GATCCAGATCTAACTTGGGG and TNFRSF10B; CRISPR606464_SGM – ACAACGAGCACAAGGGTCTT, and control, no. A35526) and Truecut Cas9 protein (no. A36498) were purchased from Thermo Fisher Scientific. In total, 5 × 104 hFLSCs were mixed with 7.5 pmol sgRNA, 7.5 pmol Cas9 protein, and 10 μL resuspension buffer R and electroporated using the Neon Transfection System kit (twice at 880 V for 35 ms). Transfected cells were cultured for 48 hr after electroporation. The transfection efficiencies of DR5 and Fas genes were >80%, and DR5- or Fas-negative cells were sorted using a fluorescence-activate cell-sorting Aria III instrument (BD Biosciences, San Diego, CA).

Immunoprecipitation

Request a detailed protocol

For immunoprecipitation, 106 hFLSCs per sample were incubated with 200 ng/mL His-tagged TNF-α, FasL, or TRAIL (R and D Systems) for 30 min at 37°C, followed by cross-linking with 5 mM BS3 and 20 mM quench solution (pH 7.5). Then, the cells were washed twice with cold PBS and lysed using ProteoPrep membrane extraction kit (Sigma-Aldrich) in the presence of protease and phosphatase inhibitor cocktails. To prepare denatured proteins for immunoprecipitation, cells were lysed with buffer containing 50 mM of Tris (pH 7.9), 10 mM of dithiothreitol, 5 mM of EDTA, and 1% of SDS and then boiled for 10 min. The cell lysates (500 μg) were diluted with six volumes of non-denaturing cell lysis buffer and incubated with anti-His or anti-DR5 antibodies (1:50; Cell Signaling Technology, Inc, Beverly, MA), as well as isotype control rabbit mAb IgG (DA1E; Cell Signaling Technology, Inc) for 1 hr at 4°C. Samples were treated with 40 μL protein A/G PLUS-agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA) overnight at 4°C, separated using 10% SDS-PAGE and transferred to a polyvinylidene fluoride membranes (Millipore, Billerica, MA) for western blotting.

Immunoblotting

Request a detailed protocol

HFLSCs were stimulated with 200 ng/mL recombinant human sFasL (R and D Systems) in the presence or absence of anti-human DR5 and/or anti-human Fas blocking antibodies. The cells were washed twice with PBS after stimulation and lysed with buffer containing 20 mM Tris–Cl (pH 7.9), 120 mM NaCl, 0.5% Triton X–100, 2.5 mM EDTA, and 2 mM dithiothreitol in the presence of protease and phosphatase inhibitor cocktails. The eluted samples were separated using 8% polyacrylamide SDS-PAGE and transferred to polyvinylidene fluoride membranes (Millipore) for western blotting. Antibodies for phospho-p65 (93H1), p65 (D14E12), phospho-IκBα (14D4), IκBα (L35A5), and β-actin (13E5), DR5 (D4E9), Fas (C18C12), His-Tag (D3I1O), TNF-α (D5G9), TRAIL (C92B9), and FasL (D1N5E) were purchased from (Cell Signaling Technology, Inc).

Flow cytometry

Request a detailed protocol

Flow cytometry staining and analyses were performed according to standard protocols. The antibodies used are listed in Appendix 1—Key resource table. To measure cell death, phycoerythrin (PE)-conjugated AnnexinV (BD Biosciences) and 7-aminoactinomycin D (BD Biosciences) were used in accordance with the manufacturers’ instructions. To monitor necroptosis, hFLSCs were treated with 50 μM Z–VAD–FMK followed by staining with propidium iodide (BD Biosciences). Binding of FasL to hFLSCs was assessed using FasL–Fc fusion proteins (Y Biologics, Seoul, Republic of Korea) and PE- or fluorescein isothiocyanate (FITC)-conjugated anti-human IgG Fc, or biotinylated FasL, TRAIL, and TNF-α, as well as streptavidin PE (SAv-PE; BioLegend). All in vitro staining for flow cytometry was performed in PBS containing 1% FBS and 0.09% sodium azide for 30 min at 4°C. FasL, TRAIL, and TNF-α proteins were biotinylated for 30 min at room temperature using 10 mM Sulfo-NHS-SS-Biotin (Thermo Fisher Scientific). Data were acquired using an LSR II flow cytometer and analyzed using FlowJo software (ver 10.0; Tree Star, Ashland, OR).

Microarray assay

Request a detailed protocol

RNA was isolated from the joint tissues of WT, Faslpr/lpr, and Faslgld/gld mice 10 days after K/BxN serum transfer using the RNeasy Mini kit (Qiagen). To generate biotinylated-cRNA, total RNA was amplified and purified using an Ambion Illumina RNA amplification kit (Thermo Fisher Scientific), in accordance with the manufacturer’s instructions. The quality of hybridization and overall chip performance were monitored by an internal quality control. Raw data were extracted using Illumina GenomeStudio software (Gene Expression Module v1.9.0; Illumina, Inc, San Diego, CA). We applied a filtering criterion for data analysis and a high signal value was required to obtain a detection p-value <0.05. Selected gene signal values were transformed logarithmically, and statistical significance of the expression data was determined using fold change. Gene enrichment and functional annotation analysis for the significant probe list were performed using DAVID (http://david.abcc.ncifcrf.gov/home.jsp). All data analyses and visualization of differentially expressed genes were performed using R software (ver. 2.14.0; R Development Core Team, Vienna, Austria). The data were deposited at GEO (accession no. GSE110343).

ELISA

Request a detailed protocol

ELISA kits (BD Biosciences and R and D Systems) were used to measure human CCL2, CCL3, and CXCL10 proteins and human and mouse CX3CL1. All assays were performed in accordance with the manufacturer’s instructions. Standard curves were generated using recombinant proteins provided by the manufacturers.

Real-time PCR analyses

Request a detailed protocol

Total RNA was isolated from mouse joint tissues or human synovial cells using an RNeasy kit (Qiagen), in accordance with the manufacturer’s instructions. Joint tissues were prepared at 10 days after K/BxN serum transfer as described previously (Kim and Chung, 2012). RNA was reverse transcribed into cDNA using M-MLV-RT reverse transcriptase (Promega Corp., Madison, WI) prior to quantitative real-time PCR analyses. Gene-specific PCR products were measured using a 7500 sequence detection system (Applied Biosystems, Inc, Foster City, CA), and the results for each cytokine were normalized against Gapdh expression. All primers and probes were synthesized by Applied Biosystems (Appendix 1—Key resource table) and were used with a SensiFAST Probe Lo-ROX One-Step Kit (Bioline, London, UK).

Migration assay

Request a detailed protocol

Migration was measured using 8 μm pore size inserts (BD Biosciences) in accordance with the manufacturer’s instructions. Briefly, 24-well plates were coated with Matrigel (extracellular matrix, Sigma-Aldrich) and the inserts placed into RPMI 1640 media in the presence or absence of sFasL (400 ng/mL or indicated concentrations; R and D Systems) or CX3CL1 (400 ng/mL or indicated concentrations; R and D Systems). The cells were cultured on the inserts and incubated for 24 hr at 37°C. Cell migration was measured by counting the number of cells in the bottom of each chamber, compared with the number of migrated cells in the absence of stimulant. Anti-mouse CX3CR1 monoclonal antibodies (QA16A03; Biolegend) were added at 1 hr before stimulation to block the CX3CL1–CX3CR1 interaction.

Statistical analyses

Request a detailed protocol

Data were analyzed using GraphPad Prism software (ver. 5.0; GraphPad Software Inc, San Diego, CA), and t-tests were performed to compare two groups. One-way analysis of variance (ANOVA) and Tukey’s post hoc tests were used to compare groups. A p-value < 0.05 was considered statistically significant.

Appendix 1

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Antibodyanti-DR5 antibody (Polyclonal)AbcamAbcam:ab-8416; RRID:AB_306551Immunohistochemistry(1:50, v/v)
AntibodyPE-conjugated Annexin VBD BiosciencesBD:556421Flow cytometry(1:50, v/v)
AntibodyAlexa700-conjugated anti-mouse CX3CR1(SA011F11)BiolegendBiolegend:149035; RRID:AB_2629605Flow cytometry(1:200, v/v)
AntibodyAPC-conjugated anti-human Fas(DX2)BiolegendBiolegend:305612; RRID:AB_314550Flow cytometry(1:200, v/v)
AntibodyAPC-conjugated anti-mouse CX3CR1(SA011F11)BiolegendBiolegend:149007; RRID:AB_2564491MACS-sorting (1:50, v/v)
AntibodyAPC-conjugated anti-mouse F4/80(BM8)BiolegendBiolegend:123115; RRID:AB_893493Flow cytometry(1:200, v/v)
AntibodyBV421-conjungated anti-human FasL(NOK-1)BiolegendBiolegend:306411; RRID:AB_2716104Flow cytometry(1:200, v/v)
AntibodyFITC-conjugated anti-human IgG Fc (HP6017)BiolegendBiolegend:409309; RRID:AB_2561854Flow cytometry(1:200, v/v)
AntibodyFITC-conjugated anti-mouse CD11b(M1/70)BiolegendBiolegend:101205; RRID:AB_312788Flow cytometry(1:200, v/v)
AntibodyPE-conjugated anti-human DR5(DJR2-4)BiolegendBiolegend:307405; RRID:AB_314677Flow cytometry(1:200, v/v)
AntibodyPE-conjugated anti-human IgG Fc (HP6017)BiolegendBiolegend:409303; RRID:AB_10900424Flow cytometry(1:200, v/v)
AntibodyPE-conjugated anti-mouse DR5(MD5-1)BiolegendBiolegend:119905; RRID:AB_345401Flow cytometry(1:200, v/v)
AntibodyPE-Cy7-conjugated anti-mouse Ly6G(1A8)BiolegendBiolegend:127617; RRID:AB_1877262Flow cytometry(1:200, v/v)
AntibodyPerCP-Cy5.5-conjugated anti-mouse CD45(30-F11)BiolegendBiolegend:103131; RRID:AB_893344Flow cytometry(1:200, v/v)
AntibodyUltra-LEAF Purified anti-mouse CX3CR1 Recombinant antibody(QA16A03)BiolegendBiolegend:153707, RRID:AB_2721771In vitro treatment(10 μg/mL)
AntibodyDR5 (D4E9) XP Rabbit mAb(D4E9)Cell signalingCell signaling:8074T; RRID:AB_10950817Western blot, Co-IP(1:1000, v/v, 1:50, v/v(Co-IP))
AntibodyFas (C18C12) Rabbit mAb(C18C12)Cell signalingCell signaling:4233T; RRID:AB_2100359Western blot(1:1000, v/v)
AntibodyFasL (D1N5E) Rabbit mAb(D1N5E)Cell signalingCell signaling:68405S; RRID:AB_2799745Western blot(1:1000, v/v)
AntibodyHis-Tag (D3I1O) XP Rabbit mAb(D3I1O)Cell signalingCell signaling:12698S; RRID:AB_2744546Co-IP (1:1000, v/v)
AntibodyIκBα (L35A5) Mouse mAbCell signalingCell signaling:4814; RRID:AB_390781Western blot (1:1000, v/v)
AntibodyNF-κB p65 (D14E12) XP Rabbit mAbCell signalingCell signaling:8242; RRID:AB_10859369Western blot (1:1000, v/v)
AntibodyPhospho-IκBα (Ser32) (14D4) Rabbit mAbCell signalingCell signaling:2859; RRID:AB_561111Western blot (1:1000, v/v)
AntibodyPhospho-NF-κB p65 (Ser536) (93H1) Rabbit mAbCell signalingCell signaling:3033; RRID:AB_331284Western blot (1:1000, v/v)
AntibodyTRAIL (C92B9) Rabbit mAb (C92B9)Cell signalingCell signaling:3219S; RRID:AB_2205818Western blot (1:1000, v/v)
Antibodyβ-Actin (13E5) Rabbit mAbCell signalingCell signaling:4970; RRID:AB_2223172Western blot (1:1000, v/v)
AntibodyAnti-Mouse CD178 (Fas Ligand)(MFL3)eBioscienceeBioscience:16-5911; RRID:AB_469145In vivo injection (50 μg / injection)
AntibodyAnti-Fas Antibody (human, neutralizing)(ZB4)MerckMerck:05-338; RRID:AB_309682In vitro treatment (20 μg/mL)
AntibodyHuman Fas Ligand/TNFSF6 Antibody(100419)R&DR&D:MAB126; RRID:AB_2246667Neutralization (10 μg/mL)
AntibodyHuman TRAIL R2/TNFRSF10B Antibody(Polyclonal)R&DR&D:AF631; RRID:AB_355489Neutralization (20 μg/mL)
AntibodyHuman/Mouse CX3CR1 Antibody (Polyclonal)R&DR&D:AF5825; RRID:AB_2292441In vivo injection (10 μg / injection)
AntibodyMouse Fas/TNFRSF6/CD95 Antibody (Polyclonal)R&DR&D:AF435; RRID:AB_355358In vivo injection (50 μg / injection)
AntibodyMouse IgG2B Isotype Control(73009)R&DR&D:MAB0042; RRID:AB_471245Control (10 μg/mL)
AntibodyMouse TRAIL R2/TNFRSF10B Antibody(Polyclonal)R&DR&D:AF721; RRID:AB_205069In vivo injection (50 μg / injection)
AntibodyNormal Goat IgG Control (Polyclonal)R&DR&D:AB-108-C; RRID:AB_354267Control (20 μg/mL)
AntibodyNormal Goat IgG Control (Polyclonal)R&DR&D:AB-108-C; RRID:AB_354267In vivo injection (50 μg / injection)
Biological sample (H. sapiens)Human fibroblast-like synoviocytes (hFLSCs)PMID:19709444See materials and methods
Cell line (M. musculus)EL4Korean Cell Line BankKCLB:40039
Cell line (M. musculus)JurkatKorean Cell Line BankKCLB:40152
Chemical compound, drugZ-VAD-FMKCalbiochemCalbiochem:187389-52-250 μM
Chemical compound, drugZ-VAD-FMKCalbiochemCalbiochem:187389-52-250 μg / mouse
Chemical compound, drugProtein A/G PLUS-agarose beadsSanta Cruz BiotechnologySanat cruz:sc-2003
Chemical compound, drugBMS345541SigmaSigma:B993510 mM
Chemical compound, drugMG132SigmaSigma:M744910 mM
Chemical compound, drugNSCISigmaSigma:N14135 μM
Chemical compound, drugPD980259SigmaSigma:51300010 mM
Chemical compound, drugSB203580SigmaSigma:S830710 mM
Chemical compound, drugU0126SigmaSigma:U12010 mM
Chemical compound, drugBS3 (bis-(sulfo-succinimidyl) suberate)Thermo Fisher ScientificThermo Fisher:21580See materials and methods
Chemical compound, drugEZ Link Sulfo-NHS-SS-BiotinThermo Fisher ScientificThermo Fisher:A39258Biotinylation of Fas ligand (10mM)
Commercial assay or kitAnti-APC microbeadsMiltenyi BiotecMiltenyi Biotec:130-090-855Cell isolation (1:50, v/v)
Commercial assay or kitRNeasy Mini kitQiagenQiagen:74104
Commercial assay or kitHuman CCL2/MCP-1 Quantikine ELISA KitR&DR&D:SCP00
Commercial assay or kitHuman CCL3/MIP-1 alpha Quantikine ELISA KitR&DR&D:SMA00
Commercial assay or kitHuman CX3CL1/Fractalkine DuoSet ELISAR&DR&D:DY365
Commercial assay or kitHuman CXCL10/IP-10 Quantikine ELISA KitR&DR&D:SIP100
Commercial assay or kitMouse CX3CL1/Fractalkine DuoSet ELISAR&DR&D:DY472
Commercial assay or kitMouse Fas Ligand/TNFSF6 Quantikine ELISA KitR&DR&D;MFL00
Genetic reagent (M. musculus)Taqman gene expression assay (Ccl2)Thermo Fisher ScientificThermo Fisher:Mm00441242_m1
Genetic reagent (M. musculus)Taqman gene expression assay (Ccl3)Thermo Fisher ScientificThermo Fisher:Mm00441259_g1
Genetic reagent (H. sapiens)Taqman gene expression assay (CX3CL1)Thermo Fisher ScientificThermo Fisher:Hs00171086_m1
Genetic reagent (M. musculus)Taqman gene expression assay (Cx3cl1)Thermo Fisher ScientificThermo Fisher:Mm00436454_m1
Genetic reagent (M. musculus)Taqman gene expression assay (Cxcl10)Thermo Fisher ScientificThermo Fisher:Mm00445235_m1
Genetic reagent (H. sapiens)Taqman gene expression assay (GAPDH)Thermo Fisher ScientificThermo Fisher:Hs02786624_g1
Genetic reagent (M. musculus)Taqman gene expression assay (Gapdh)Thermo Fisher ScientificThermo Fisher:Mm99999915_g1
Genetic reagent (M. musculus)Taqman gene expression assay (Il1b)Thermo Fisher ScientificThermo Fisher:Mm00434228_m1
Genetic reagent (M. musculus)Taqman gene expression assay (Il4)Thermo Fisher ScientificThermo Fisher:Mm00445259_m1
Genetic reagent (M. musculus)Taqman gene expression assay (Il6)Thermo Fisher ScientificThermo Fisher:Mm00446190_m1
Genetic reagent (M. musculus)Taqman gene expression assay (Tgfb)Thermo Fisher ScientificThermo Fisher:Mm01178820_m1
Genetic reagent (M. musculus)Taqman gene expression assay (Tnfa)Thermo Fisher ScientificThermo Fisher:Mm00443258_m1
Genetic reagent (H. sapiens)Taqman gene expression assay (TNFRSF10B)Thermo Fisher ScientificThermo Fisher:Hs00366278_m1
Genetic reagent (H. sapiens)Taqman gene expression assay (TNFRSF1A)Thermo Fisher ScientificThermo Fisher:Hs01042313_m1
Genetic reagent (H. sapiens)Taqman gene expression assay (TNFRSF10A)Thermo Fisher ScientificThermo Fisher:Hs00269492_m1
Genetic reagent (H. sapiens)Taqman gene expression assay (TNFRSF12)Thermo Fisher ScientificThermo Fisher:Hs00171993_m1
Genetic reagent (M. musculus)Taqman gene expression assay (Tnfrsf10b)Thermo Fisher ScientificThermo Fisher:Mm00457866_m1
Genetic reagent (H. sapiens)TrueGuide sgRNA (FAS)Thermo Fisher ScientificThermo Fisher:CRISPR872691_SGM7.5 pmol
Genetic reagent (H. sapiens)TrueGuide sgRNA (negative control)Thermo Fisher ScientificThermo Fisher:A355267.5 pmol
Genetic reagent (H. sapiens)TrueGuide sgRNA (TNFRSF10B)Thermo Fisher ScientificThermo Fisher:CRISPR606464_SGM7.5 pmol
Other7-AADBD BiosciencesBD:559925Flow cytometry(1:50, v/v)
OtherPropidium Iodide Staining SolutionBD BiosciencesBD:556463Flow cytometry(1:50, v/v)
Peptide, recombinant proteinRecombinant Human Fas Ligand/TNFSF6 ProteinR&DR&D:126-FLIn vitro treatment(2 μM)
Peptide, recombinant proteinRecombinant Human TRAIL R2/TNFRSF10B Fc Chimera ProteinR&DR&D:631-T2In vitro treatment(200 ng/mL)
Peptide, recombinant proteinRecombinant Human TRAIL/TNFSF10 ProteinR&DR&D:375-TLFlow cytometry(200 ng/mL)
Peptide, recombinant proteinRecombinant Mouse CX3CL1/Fractalkine (Full Length) ProteinR&DR&D:472-FFIn vitro treatment(200 ng/mL)
Peptide, recombinant proteinRecombinant Mouse CX3CL1/Fractalkine (Full Length) ProteinR&DR&D:472-FFIn vivo injection (1 μg/injection)
Peptide, recombinant proteinRecombinant Mouse Fas Ligand/TNFSF6 ProteinR&DR&D:526-SAIn vivo injection(1 μg/mouse)
Peptide, recombinant proteinRecombinant Mouse Fas Ligand/TNFSF6 ProteinR&DR&D:526-SAIn vitro treatment(200 ng/mL)
Peptide, recombinant proteinRecombinant Mouse TRAILR&DR&D:1121-TLIn vitro treatment (200 ng/mL)
Peptide, recombinant proteinRecombinant Mouse TRAILR&DR&D:1121-TLIn vivo injection (1 μg/mouse)
Peptide, recombinant proteinTruecut Cas9 proteinThermo Fisher ScientificThermo Fisehr:A364987.5 pmol
Peptide, recombinant proteinFasL-FcY-BiologicsThis paperSee materials and methods
Peptide, recombinant proteinRecombinant Human TNF-alphaR&DR&D:210-TASee materials and methods
Peptide, recombinant proteinRecombinant Mouse TNF-alphaR&DR&D:410-MTSee materials and methods
Recombinant DNA reagentpIRESpuro3ClontechClontech:631619See materials and methods
Sequence-based reagentMISSION siRNA (CUHK)SigmaSigma:SASI_Hs01_00206921
Sequence-based reagentMISSION siRNA (FAS)SigmaSigma:SASI_Hs02_00301734
Sequence-based reagentMISSION siRNA (IKBKB)SigmaSigma:SASI_Hs01_00156170
Sequence-based reagentMISSION siRNA (RELA)SigmaSigma:SASI_Hs01_00171091
Sequence-based reagentMISSION siRNA (TNFRSF10A)SigmaSigma:SASI_Hs01_00139573
Sequence-based reagentMISSION siRNA (TNFRSF10B)SigmaSigma:SASI_Hs01_00040567
Sequence-based reagentMISSION siRNA (TNFRSF12A)SigmaSigma:SASI_Hs01_00129286
Sequence-based reagentMISSION siRNA (TNFRSF1A)SigmaSigma:SASI_Hs01_00033456
Software, algorithmFlowJoFlowJoVersion 10
Software, algorithmBIA evaluationGE Healthcare Bio-SciencesGE:BR-1005-97
Software, algorithmIllumina GenomeStudioGene Expression ModuleVersion 1.9.0
Software, algorithmGraphPad PrismGraphPad SoftwareVersion 5.0
Software, algorithmSequest algorithmN/AVersion 27
Software, algorithmSORCERERSage-N Research
Strain, strain background (Mus musculus, C57BL/6J)Faslgld/gldJapan SLC
Strain, strain background (Mus musculus, C57BL/6J)Faslpr/lprJapan SLC
Strain, strain background (Mus musculus, C57BL/6J)K/BxNPMID:8945509
Strain, strain background (Mus musculus, C57BL/6J)Tnfrsf10b KOMMMRCMMMRC:030532-MU
Strain, strain background (Mus musculus, C57BL/6J)FaslΔm/Δm PMID:19794494
Strain, strain background (Mus musculus, C57BL/6J)FaslΔs/ΔsPMID:19794494
Strain, strain background (Mus musculus, C57BL/6J)Wild type C57BL/6 (WT)Orient Bio
Strain, strain background (Mus musculus, C57BL/6J)Cx3cr1 KOTaconicTaconic:4167
Strain, strain background (Mus musculus, C57BL/6J)Fas-/-PMID:7581453RIKEN BRC:RBRC01474

Data availability

The microarray data mentioned in this paper has been deposited in NCBI's Gene Expression Omnibus (GEO) and are accessible through GEO Series accession number GSE110343.

The following data sets were generated
    1. Kim HS
    2. Chung DH
    (2018) NCBI Gene Expression Omnibus
    ID GSE110343. Genome-wide analysis for joint tissues of Fas (ligand) mutant mice during autoantibody induced arthritis.
    https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?&acc=GSE110343

References

    1. Blaschke S
    2. Koziolek M
    3. Schwarz A
    4. Benöhr P
    5. Middel P
    6. Schwarz G
    7. Hummel KM
    8. Müller GA
    (2003)
    Proinflammatory role of fractalkine (CX3CL1) in rheumatoid arthritis
    The Journal of Rheumatology 30:1918–1927.
    1. O'Connell J
    (2000)
    Immune privilege or inflammation? the paradoxical effects of fas ligand
    Archivum Immunologiae Et Therapiae Experimentalis 48:73–79.
    1. Ottonello L
    2. Tortolina G
    3. Amelotti M
    4. Dallegri F
    (1999)
    Soluble fas ligand is chemotactic for human neutrophilic polymorphonuclear leukocytes
    Journal of Immunology 162:3601–3606.
    1. Seino K
    2. Iwabuchi K
    3. Kayagaki N
    4. Miyata R
    5. Nagaoka I
    6. Matsuzawa A
    7. Fukao K
    8. Yagita H
    9. Okumura K
    (1998)
    Chemotactic activity of soluble fas ligand against phagocytes
    Journal of Immunology 161:4484–4488.

Decision letter

  1. David Wallach
    Reviewing Editor; The Weizmann Institute of Science, Israel
  2. Tadatsugu Taniguchi
    Senior Editor; Institute of Industrial Science, The University of Tokyo, Japan
  3. Marcus E Peter
    Reviewer; Feinberg School of Medicine, Northwestern University, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

In this study, you show that Fas ligand functions, not only by binding Fas, but also by binding to DR5 – a receptor that until now has been known to be activated only by the ligand TRAIL. Moreover, in exploring the contribution of this novel interaction to the pathology of autoantibody inducing arthritis in the mice K/BxN serum-transfer model, you found that soluble Fas ligand can induce via DR5 a functional change – transcription of the cytokine CX3CL1 (Fractalkine) – that does not occur upon triggering DR5 function by TRAIL, nor can it be induced via Fas. The induction of CX3CL1, and the consequent induction of several cytokines by the latter, are shown in your study to make a major contribution to the joint pathology in the K/BxN serum transfer model. Overall, this paper makes an important contribution to our knowledge of the functions served by the TNF family in revealing a novel interaction between members of the TNF ligand and receptor families, with a functional consequence that seems to contribute to the pathology of autoimmune diseases.

Decision letter after peer review:

Thank you for submitting your article "DR5 is a Fas-independent receptor for soluble Fas ligand that promotes inflammation" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Tadatsugu Taniguchi as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Marcus E Peter (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Your manuscript was examined by three expert reviewers and a reviewing editor. They were all highly intrigued by your claimed finding that soluble Fas ligand binds DR5 and activates it. They all consider this finding to be of major importance. However, since during the long time that has passed since the discovery of Fas ligand and DR5 none has reached similar findings and, moreover, some studies seemed to have clearly demonstrated that Fas ligand does not bind DR5 (e.g. Figure 2A in PMID 9373179), they were all also concerned that these findings might be mistaken.

Each of the reviewers sent me a long list of suggestions of ways by which you may address this concern. To assist you coping with these numerous requests I assembled them in three groups that are presented below: (i) Requests that might involve doing some additional experiments, which must be met in order to allow me considering your paper for publication. (ii) Requests concerning just your way of writing, which must also be met. (iii) Additional requests that I consider to be of secondary importance for the central message of the paper. You might choose either to address these requests or just to delete the data that they concern.

I would like to assist you as much as I can in publishing your interesting findings, However, I feel just as well compelled to do all that is necessary to exclude any mistake.

(i) Requests that might involve doing additional experiments, which must be met in order to allow me considering your paper for publication.

1. Much more detailed information should be provided in the Figure Legends and Methods sections about key results pertaining to the proposed interaction of FasL and DR5.

In particular:

(a) Detailed information of the antibodies that were used in vivo and ex vivo should be presented. What clone of monoclonal antibodies was used? What is the evidence for mouse- human cross-reactivity (in case of use of antibody against the one to block the other)? etc.

(b) The concentrations of all the recombinant proteins and antibodies used should be specified.

(c) The number of experiments performed (biological n) should be specified.

(d) The mass spectrometry experiment should be described in much greater detail, for example – for how long was sFasL applied, at what temperature, at what concentration, to how many cells? What does "Fc protein was used as a negative control throughout the process" mean? The list of hits obtained from the AP-MS experiment should be fully presented to allow examining if other TNFRSF members were also identified.

2. All commercially purchased reagents that have been used in key experiments, e.g. sFasL, FasL-Fc, TRAIL, anti-Fas, and anti-DR5 antibodies must be characterized and validated in order to confirm that their identity and activity are indeed what they are advertised to be.

3. The specific binding of sFasL to DR5 should be reconfirmed by demonstrating co-immunoprecipitation of the two in endogenous setting, that is to say – using cells that express DR5 at its endogenous levels and using sFaL at concentrations of the recombinant protein that mimic endogenous levels. Assessment of the bioactivity of the ligands should also be done at concentrations of the recombinant protein that are at the range of the endogenous levels.

4. Knockdown does not fully abolish the expression of a protein, nor can the use of antibodies always allow to fully block its activity. To alleviate the concern that such incomplete effects have led to mistaken conclusions the authors are requested to apply CRISPR/Cas9 to knockout the DR5 and Fas genes instead (which is rather easy to do nowadays). They should then further reconfirm the findings by re-expressing the cDNA for the knocked-out genes. Does the knockout of DR5 eliminate a residual response of Fas deficient cells to FasL? Does re-expression of DR5 in such cells rescue such deficiency?

5. The assessment of the affinity of binding of TRAIL to DR5 should be presented in a figure.

6. Specific triggering of cell death by DR5 in response to sFasL should be validated by the use of inhibitors that specifically affect apoptosis and necroptosis.

(ii) Requests concerning just your way of writing, which must also be met.

1. The authors begin the abstract by noting that "Fas-independent membrane bound receptor for FasL has not yet been reported". In the introduction, they argue that "in many studies demonstrating the biological effects of FasL in vitro and in vivo, some of the results have not been confirmed to be Fas-dependent. Thus, it is reasonable to consider the possibility that sFasL may bind Fas-independent receptor in addition to Fas in vivo". The premise that an alternate receptor for sFasL exists is arbitrary: just because this hasn't been ruled out doesn't qualify it as a valid possibility. There has to be some positive evidence in favor of this specific notion in order to qualify it as a starting point or hypothesis for further studies. Please change this statement accordingly.

2. Fas lpr mice are not completely negative for Fas. Some tissues actually express wt Fas (PMID: 7528670). That could compound some of the data especially the in vivo data. Please discuss the implications.

3. An interesting consideration is whether the reported increase in metastases in TRAIL-R k.o mice by the Walczak group could be due to FasL unbound to TRAIL-R driving metastasis through increased binding to Fas. In addition, other reports suggested that TRAIL-R deficiency sensitized mice to inflammation, DSS induced colitis or DEN induced liver cancer (PMIDs: 24117005; 18079962). Again, that seems to be at odds with the activity of DR5 described here to promote inflammation. Please discuss the implications.

4. Not once do the authors explain to a wider audience what FLSC stands for.

5. Figure 1G: How many patients/slides were stained? Statistics need to be provided.

6. Line 104: It should read "Figure 1—figure supplement 2C".

7. Line 107: It should read "Figure 1—figure supplement 2D and E". 8) Line 133: It should read "Figure 2—figure supplement 1B" instead of Figure S4B.

8. Figure 3—figure supplement 2 is labeled in the figure legend as Supplemental figure 7, Figure 5—figure supplement 1 as Supplemental figure 9, and Figure 6—figure supplement 1 as Supplemental figure 10, respectively.

9. The authors state that based on the data sFasL-DR5 interactions induce both apoptosis and necroptosis. Without more detailed analyses it is not clear whether necroptosis is induced. All that the data suggest is that cells undergo secondary necrosis, a phenomenon typical for in vitro stimulated cells. Please discuss.

10. As to the article title. I would suggest to include in the title that this is in the context of autoantibody-induced arthritis.

Also the "Fas independent receptor" does not sound good.

Something like:

Fas ligand drives autoantibody-induced arthritis through binding to DR5/TRAIL-R2

(iii) Additional requests that I consider to be of secondary importance for the central message of the paper. You might choose either to address these requests or just to delete the data that they concern.

1. FasL-Fc is an unnatural construct that (presumably) displays two FasL homotrimers. Rather than using it interchangeably without explanation, the authors should better use just sFasL throughout the study.

2. The authors contrast binding of FasL-Fc to human DR5 with human DR4. What about other TRAIL receptors, and other TNFRSF members? A more complete analysis is called for.

3. If FasL binds to DR5, then what specific binding site does it occupy? Are there any specific mutations that can disrupt this binding? Is the FasL binding site for DR5 related to TRAIL's? Is there homology between the DR5 and Fas binding sites for FasL?

4. All negative data using inhibitors (e.g. zVAD-fmk) need to be supported by positive control data for the inhibitors, particularly in the in vivo experiments.

5. The authors should provide evidence that sFasL leads to the assembly of a FADD-containing complex that is dependent of DR5 and not Fas using both murine and human Fas and DR5 KO cells.

6. sFas and TRAIL are known inducers of cell death, however, in the present manuscript the authors do not take into account this variable and the possible effect that cell death might have in, as an example, selecting for a particular cell population. The in vitro experiments should be validated in the presence of cell death inhibitors. In this regard, the authors mention different modes of cell death without testing for them. If such conclusions are to be drawn than the authors should use specific inhibitors of the difference cell death modalities.

7. Throughout the manuscript there are several controls missing. While the authors demonstrate the efficiency of deletion of the siRNAs used, it is imperative to assess the abolishment of the signaling that depends on that receptor in the presence of its respective bona fide ligands. This can be achieved by assessing of the formation of the FADD-containing complex by western blot and downstream output of cell death and gene activation.

8. The western blot presented in figure 3j raises doubt regarding the efficiency of Fas blocking in their experiments. As demonstrated in lanes 7-9 versus lanes 1-3, their blocking antibody for Fas has very little capacity to block sFasL-mediated p-IkBα. The authors should explain this observation and (as specified above) repeat the experiment using KO cells for DR5 and/or Fas.

9. Regarding the mechanisms of AIA and its dependency on DR5-sFasL engagement the authors should show the levels of CX3CL1 in mFasL KO mice and in sFasKO mice treated with recombinant sFasL. Additionally, the authors should generate DR5/CX3CL DKO mice and DR5-FasL delt.s DKO to show that these mice do not exhibit AIA upon sFasL treatment.

10. To show that sFasL-DR5 indeed leads to CX3CL1-induced AIA the authors should add to figure 6 a rescue experiment using sFasL-KO mice and conditionally induce CX3CL1 expression.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting the revised version of your manuscript "Soluble Fas ligand drives autoantibody-induced arthritis via binding to DR5/TRAIL-R2" for consideration by eLife.

The manuscript has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Tadatsugu Taniguchi as the Senior Editor. They were impressed by the added information, but still had specific concerns and requests that must be addressed before a decision on your manuscript can be taken.

Comments about the ex vivo data:

Specific comments

1. The viewers believe that in order to exclude remaining doubts about your claims there is the need for several more rigorous controls, as detailed below:

Figure 1H

The figure shows binding of FasL-Fc to DR5-transfected EL4 cells, which is blocked by anti-FasL antibody.

There should be a comparison to binding of TRAIL-Fc and to an irrelevant Fc fusion protein. Also, does TRAIL-Fc or anti-DR5 antibody block this FACS shift observed with FasL-Fc? The effect of re-expression of Fas alone, without the re-expression of DR5, in the double knockout cells should also be shown. Similar questions apply to Figure 1I.

Figure 1I and Figure 1—figure supplement 4C and 4D

The authors should provide real-time PCR evidence that the Fas and TRAIL genes have indeed been knocked out in all the cells in the preparations used in these experiments.

In Fig, 1J

sFasL or sTRAIL is added to hFLSCs, cross-linked, and immunoprecipitated with IgG or anti-DR5 and FasL or TRAIL visualized by immunoblot. PBS is an inadequate control here: they should use another soluble TNFSF ligand as a negative control. Also, the binding of sFasL should be blocked by excess sTRAIL and vice versa.

Figure 1K

Please compare binding of DR5-Fc with Fas-Fc. Compare binding to EL4-FasL with binding to EL4-TRAIL (positive) and EL4-mTNFa (negative). Is binding of DR5-Fc blocked by TRAIL or by anti-DR5 antibody?

2. Figure 3H and I and the related supplementary figures

The relevance of the signalling mechanism by which sCX3CL1 is induced to the rest of the paper is not clear. Moreover, given selectivity caveats with the small molecule the significance of the evidence about this issue is limited. The authors should either delete this part or relate to its implications as just putative.

General comments

1. How were transfected cell lines generated and validated? Please explain and present the data.

2. The references cited for TRAIL-DR5 interaction and co-crystal structures are incomplete.

Comments about the in vivo data:

As the authors themselves show (Figure 1—figure supplemental 1A), cells of the lpr mice still express some Fas, although at a greatly reduced level. This, unfortunately, casts some doubt on the interpretation of the in vivo data in this study. The authors should either fully delete all these data or present their implication as just putative. It is a pity that the authors have not used the Fas full knockout mice (which are available from Jackson laboratories). Demonstrating an effect of injected sFasL on those mice would have yielded unequivocal evidence.

Comments about the English:

The sentence ""the interaction of Fas-independent membrane bound receptor and FasL remains elusive or unclear" makes no sense. It implies the existence of previous evidence of such an alternative receptor. There is no such evidence and hence the starting point of the study is still poorly justified. One could change the sentence in the introduction to "whether sFasL-mediated inflammation is regulated via interaction with Fas in vivo has not been demonstrated directly". Also, the next sentence would make more sense if it started with: "By addressing these questions we identified….".

In the abstract the authors claim the following: "Affinity purification mass spectrometry analysis using human fibroblast-like synovial cells (hFLSCs) revealed DR5 as a FasL receptor." This statement is somewhat misleading. As the authors explain in their reply to the reviewers' comments, the mass-spectrometric analysis of the affinity precipitate they obtained with recombinant FasL-Fc, resulted in the identification of many different proteins as putative interactors with DR5 being one of many. It is therefore not correct to claim that the interaction with DR5 would be specific. In the response to the reviewers' comments the authors state that they "selected DR5" from a list of 29 proteins they found in the IP which contained a transmembrane domain or were expressed as extracellular proteins. Whereas this puts the starting point of the study into question (why did they not pick CD70, another TNFRSF member which they found in the list?), I understand the argument but in view of the reviewers they should stay closer to the data and relate to their findings differently. Something along the lines of the following would probably be more appropriate: "Affinity purification mass spectrometry analysis using human fibroblast-like synovial cells (hFLSCs) identified DR5 as one of several candidates as the elusive Fas-independent FasL receptor. Subsequent cellular and biochemical analysis revealed that DR5 can specifically interact with recombinant FasL-Fc protein, albeit with an approximately 60-fold lower affinity than Fas."

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for sending your article entitled "Soluble Fas ligand drives autoantibody-induced arthritis via binding to DR5/TRAIL-R2" for peer review at eLife. Your article is being evaluated by 4 peer reviewers, and the evaluation is being overseen by a Reviewing Editor and Tadatsugu Taniguchi as the Senior Editor.

Although you have addressed most of the concerns of the reviewers, the reviewers remained concerned about the lack of a definitive control from the beginning of this review process. This concern has not been addressed yet thoroughly enough. The reviewers maintain their request to provide such control by the use of a full Fas knockout mouse (which are available from Jackson Labs). Therefore, we ask you to obtain these mice and perform the definitive experiment which is to test whether injection of recombinant sFasL in full Fas knockout mice promotes AIA or not.

Given that this study may have far-reaching consequences, we believe that the revision with the above experimental results is essential for us to make the final decision.

One additional point: There seems to be a mistake in Figure 1H. The EL4 thymoma cells used in the experiment that was presented in this figure have been shown in quite a number of other studies to express TNF receptors and to respond to TNF. We wonder if the fact that you did not see any sign for binding of biotinylated TNF to the EL4-hDR5 cells that were used in this experiment was due to some fault in the preparation of the biotinylated TNF.

https://doi.org/10.7554/eLife.48840.sa1

Author response

Your manuscript was examined by three expert reviewers and a reviewing editor. They were all highly intrigued by your claimed finding that soluble Fas ligand binds DR5 and activates it. They all consider this finding to be of major importance. However, since during the long time that has passed since the discovery of Fas ligand and DR5 none has reached similar findings and, moreover, some studies seemed to have clearly demonstrated that Fas ligand does not bind DR5 (e.g. Figure 2A in PMID 9373179), they were all also concerned that these findings might be mistaken.

Each of the reviewers sent me a long list of suggestions of ways by which you may address this concern. To assist you coping with these numerous requests I assembled them in three groups that are presented below: (i) Requests that might involve doing some additional experiments, which must be met in order to allow me considering your paper for publication. (ii) Requests concerning just your way of writing, which must also be met. (iii) Additional requests that I consider to be of secondary importance for the central message of the paper. You might choose either to address these requests or just to delete the data that they concern.

I would like to assist you as much as I can in publishing your interesting findings, However, I feel just as well compelled to do all that is necessary to exclude any mistake. eLife usually allows a maximal period of just two months for revision. I will make an exception in this case and will allow you resubmitting within three months from now. If addressing the requests that we are making will take you longer time, I will also be glad to consider the paper for publication. However, in that case the date of the original submission will be ignored.

(i) Requests that might involve doing additional experiments, which must be met in order to allow me considering your paper for publication.

1. Much more detailed information should be provided in the Figure Legends and Methods sections about key results pertaining to the proposed interaction of FasL and DR5. In particular:

(a) Detailed information of the antibodies that were used in vivo and ex vivo should be presented. What clone of monoclonal antibodies was used? What is the evidence for mouse- human cross-reactivity (in case of use of antibody against the one to block the other)? etc.

As reviewer suggested, we provide detailed information for the antibodies used in our experiments in key resources table. Moreover, we checked cross-reactivity of antibodies between human and mouse by performing functional tests. To address this issue, we stimulated human and mouse cells with human or mouse soluble FasL in the presence or absence of antibodies against human or mouse Fas or DR5, and measured amounts of CX3CL1 in the culture supernatants and apoptosis (Figure 1—figure supplement 3 A-C). Antibodies against human DR5 inhibited CX3CL1 production in human, but not mouse synovial fibroblasts, whereas antibodies against mouse DR5 suppressed CX3CL1 production in mouse, but not human synovial fibroblasts. In addition, antibodies against human DR5 and Fas, but not those against mouse DR5 and Fas, inhibited cell death in human Jurkat cells, whereas antibodies against mouse DR5 and Fas, but not those against human DR5 and Fas, suppressed cell death in mouse spleen T cells. These findings indicate that antibodies against Fas and DR5 do not have cross reactivity between human and mouse Fas and DR5. These data are presented in Figure 1 —figure supplement 3A-C and described in the section of Results as follows: Anti-DR5 and Fas antibodies do not show cross reactivity between human and mouse DR5 and Fas, respectively (Figure 1—figure supplement 3).

(b) The concentrations of all the recombinant proteins and antibodies used should be specified.

As reviewer suggested, we have described the concentrations of all recombinant proteins and antibodies used in the methods and figure legends of revised manuscript and key resources table.

(c) The number of experiments performed (biological n) should be specified.

As reviewer suggested, we provided the numbers of experiments performed in figure legends.

(d) The mass spectrometry experiment should be described in much greater detail, for example – for how long was sFasL applied, at what temperature, at what concentration, to how many cells? What does "Fc protein was used as a negative control throughout the process" mean? The list of hits obtained from the AP-MS experiment should be fully presented to allow examining if other TNFRSF members were also identified.

We would like to appreciate the reviewer’s reasonable comments. As we described in the Materials and methods section on page 20 and 21, we implemented the in-situ chemical cross-linking method (Mapping protein receptor-ligand interactions via in vivo chemical crosslinking, affinity purification, and differential mass spectrometry, Methods, 2012) for identification of Fas-independent FasL receptor. Following the procedure, 20 μg of biotinylated sFasL-Fc protein was incubated with 1×108 cells for 2 hours. After incubation, 1 mL of 3 μg/ml of BS3 (bis- (sulfo-succinimidyl) suberate) cross-linking reagent was added for 30 min at room temperature. Then, we quenched the cross-linking reaction by adding Tris-bis HCl (2 M, pH 7.4) to a final concentration of 15 mM and incubated at room temperature for 15 min. Cells were lysed in RIPA buffer and biotinylated-sFasL-Fc chemical cross-linked protein complexes were purified by avidin affinity chromatography. As a negative control, we used Fc protein to remove non-specific binding to Fc region which included in our protein of interest, sFasL-Fc protein. In this experiment, all other steps were treated identically to sFasL-Fc protein and Fc protein incubated samples. The purified proteins were separated by 4-12% SDS-PAGE, stained with Coomassie Blue, and digested in-gel with trypsin for mass spectrometry analysis. Protein database search of the biologically duplicate experiments resulted in a total of 144 proteins appeared statistically significant (95% peptide thresholds, 99% protein thresholds) in the sFasL-Fc incubated sample compared with the Fc protein incubated sample. Among them, 29 of unique extracellular space or plasma membrane proteins were selected. Although other candidate proteins could potentially be binding partners of sFasL, a TNF-receptor superfamily protein, we selected TNFRSF10B (DR5) as the top candidate of sFasL binding partners. As shown in Figure 1E, peptide sequence information (LLVPANEGDPTETLR and DASVHTLLDALETLGER) of TNFRSF10B (DR5) were accurately assigned. As pointed out, we added a detailed experimental condition in the Materials and methods section.

2. All commercially purchased reagents that have been used in key experiments, e.g. sFasL, FasL-Fc, TRAIL, anti-Fas, and anti-DR5 antibodies must be characterized and validated in order to confirm that their identity and activity are indeed what they are advertised to be.

To validate these reagents, Jurkat T cells were treated with sFasL, FasL-Fc or TRAIL in the presence or absence of anti-Fas or anti-DR5 antibodies and cell death was estimated. sFasL and TRAIL increased cell death of Jurkat T cells, which was inhibited by adding anti-Fas or anti-DR5 antibodies (Figure 1—figure supplement 3B and C). Moreover, FasL-Fc increased production of CX3CL1 by human synovial fibroblasts as much as sFasL (Figure 3—figure supplement 1B and 1C). These findings indicate that these reagents are validated in terms of functional aspects. These results are presented in Figure 1 —figure supplement 3, and Figure 3—figure supplement 1B and 1C.

3. The specific binding of sFasL to DR5 should be reconfirmed by demonstrating co-immunoprecipitation of the two in endogenous setting, that is to say – using cells that express DR5 at its endogenous levels and using sFaL at concentrations of the recombinant protein that mimic endogenous levels. Assessment of the bioactivity of the ligands should also be done at concentrations of the recombinant protein that are at the range of the endogenous levels.

To address this issue, hFLSCs were pre-treated with recombinant FasL or TRAIL (200 ng/mL, purchased from R&D, 6×His-tagged at N terminus) for 30 min, and incubated with bis (sulfosuccinimidyl) suberate (BS3) for cross linking. After then, samples were prepared for immunoprecipitation using ProteoPrep membrane extraction kit (Σ) and immunoprecipitated with anti-DR5 antibody or control IgG, and blotted with anti-FasL, and TRAIL antibody (Figure 1J). On the other hand, to precipitate 6×His-tagged FasL and TRAIL, the samples were also immunoprecipitated with anti-His antibody or control IgG, and blotted with anti-Fas or anti-DR5 antibody Figure 1 —figure supplement 4H. These experiments demonstrated that DR5 bound to both FasL and TRAIL in hFLSCs, which are presented in Figure 1J and Figure 1 —figure supplement 4H.

4. Knockdown does not fully abolish the expression of a protein, nor can the use of antibodies always allow to fully block its activity. To alleviate the concern that such incomplete effects have led to mistaken conclusions the authors are requested to apply CRISPR/Cas9 to knockout the DR5 and Fas genes instead (which is rather easy to do nowadays). They should then further reconfirm the findings by re-expressing the cDNA for the knocked-out genes. Does the knockout of DR5 eliminate a residual response of Fas deficient cells to FasL? Does re-expression of DR5 in such cells rescue such deficiency?

To address this issue, DR5 (TNFRSF10B) and/or Fas (FAS) genes were knockout in human synovial fibroblasts using CRISPR/Cas9 system (Figure 1 —figure supplement 4C). Upon knockout of DR5 or Fas gene in human synovial fibroblasts, sFasL-mediated cell death (Figure 2 —figure supplement 2B) and FasL-Fc binding to cell surface (Figure 1I) were decreased compared with control synovial fibroblasts. When we performed knockout of both Fas and DR5 genes (double knockout; DKO) in human synovial fibroblasts, sFasL-mediated cell death and FasL-Fc binding to cell surface were reduced more in DKO fibroblasts than in fibroblasts knockout either DR5 or Fas gene (Figure 1I). Furthermore, re-expressing DR5 or Fas in DKO synovial fibroblasts restored sFasL-mediated cell death and FasL-Fc binding to cell surface (Figure 1I). However, sFasL-mediated CX3CL1 production was similarly reduced in DR5 gene KO and DKO human synovial fibroblasts, where it is not altered in Fas gene knockout-cells (Figure 3F). Moreover, re-expression of DR5 in DKO cells restored FasL-mediated CX3CL1 production as much as control cells, whereas that of Fas did not alter CX3CL1 production in DKO cells (figure 3F). Based on these findings, it is confirmed that sFasL binds to DR5 and this interaction increases CX3CL1 production by synovial fibroblasts. Moreover, the concern that incomplete effects of blocking antibodies and knockdown system have led to mistaken conclusions has been alleviated.

5. The assessment of the affinity of binding of TRAIL to DR5 should be presented in a figure.

As reviewer suggested, we presented the assessment of the binding affinity of TRAIL to DR5 in Figure 1—figure supplement 4G.

6. Specific triggering of cell death by DR5 in response to sFasL should be validated by the use of inhibitors that specifically affect apoptosis and necroptosis.

As reviewer suggested, we validated DR5-FasL interaction-mediated cell death using specific inhibitors of apoptosis (NSCI for caspase 3) and necroptosis (GSK’872 for RIPK3). Upon treatment of hFLSCs with sFasL, apoptosis and necroptosis were increased, which was inhibited by addition of NSCl and GSK’872, respectively (Figure 2—figure supplement 2A and 2C). In particular, sFasL-induced apoptosis and necroptosis were decreased in Fas or DR5 gene knockout hFLSCs, which was more decreased in DKO (Fas and DR5 gene-knockout) hFLSC (Figure 2—figure supplement 2B and D). These findings indicate that sFasL-DR5 interaction induces both apoptosis and necroptosis in synovial fibroblasts.

(ii) Requests concerning just your way of writing, which must also be met.

1. The authors begin the abstract by noting that "Fas-independent membrane bound receptor for FasL has not yet been reported". In the introduction, they argue that "in many studies demonstrating the biological effects of FasL in vitro and in vivo, some of the results have not been confirmed to be Fas-dependent. Thus, it is reasonable to consider the possibility that sFasL may bind Fas-independent receptor in addition to Fas in vivo". The premise that an alternate receptor for sFasL exists is arbitrary: just because this hasn't been ruled out doesn't qualify it as a valid possibility. There has to be some positive evidence in favor of this specific notion in order to qualify it as a starting point or hypothesis for further studies. Please change this statement accordingly.

As reviewer pointed out, we modified and deleted unclear sentences in the abstract and introduction as follows:

Abstract: The interaction of Fas-independent membrane bound receptor and FasL remains elusive.

Introduction: However, whether sFasL-mediated inflammation is regulated in a Fas-independent manner in vivo remains elusive and how it regulates inflammation in various microenvironments is unclear. To address this, we identified a Fas-independent membrane-bound receptor for FasL and explored its functions.

2. Fas lpr mice are not completely negative for Fas. Some tissues actually express wt Fas (PMID: 7528670). That could compound some of the data especially the in vivo data. Please discuss the implications.

As reviewer pointed out, it has been reported that Faslpr/lpr mice are not completely negative for Fas expression. Thus, it is reasonable to consider that low levels of Fas might affect sFasL-DR5 interaction-mediated inflammation in joint tissue.

First, Mariani et al. demonstrated that low level of Fas expression was detected in thymocytes from Faslpr/lpr mice. However, they have not investigated expression pattern of Fas in synovial fibroblasts. In our experiments, flow cytometric analysis revealed that synovial fibroblasts from Faslpr/lpr mice with AIA minimally expressed Fas on cell surface (Figure 1—figure supplement 1A), suggesting that minimal expression of Fas in Faslpr/lpr mice might not affect sFasL-DR5 interaction-mediated inflammation in the AIA model.

Second, Fas KO or DR5 KO synovial fibroblasts showed a reduction of sFasL-induced cell death compared with control cells, suggesting that sFasL-Fas interaction-mediated cell death might affect AIA in Faslpr/lpr mice. However, our experiments demonstrated that z-VAD-fmk (caspase inhibitor) did not affect AIA in WT mice, although z-VAD-fmk reduced apoptosis of immune cells from the inflamed joints. These findings indicate that sFasL-Fas interaction-mediated apoptosis minimally involved in the pathogenesis of AIA.

Thus, it is unlikely that minimal expression of Fas in Faslpr/lpr mice affects AIA. This issue has been discussed in the page 13 as follows: Although Mariani et al. demonstrated that low level of Fas expression was detected in thymocytes from Faslpr/lpr mice (Mariani, Matiba, Armandola, and Krammer, 1994), expression pattern of Fas in synovial fibroblasts has been unclear in Faslpr/lpr mice. In our experiments, flow cytometric analysis revealed that synovial fibroblasts from Faslpr/lpr mice with AIA minimally expressed Fas on cell surface. Moreover, our experiments demonstrated that z-VAD-fmk (caspase inhibitor) did not affect AIA in WT mice, although z-VAD-fmk reduced apoptosis of immune cells from the inflamed joints. Thus, it is unlikely that minimal sFasL-Fas interaction-mediated apoptosis in Faslpr/lpr mice affects the pathogenesis of AIA.

3. An interesting consideration is whether the reported increase in metastases in TRAIL-R k.o mice by the Walczak group could be due to FasL unbound to TRAIL-R driving metastasis through increased binding to Fas. In addition, other reports suggested that TRAIL-R deficiency sensitized mice to inflammation, DSS induced colitis or DEN induced liver cancer (PMIDs: 24117005; 18079962). Again, that seems to be at odds with the activity of DR5 described here to promote inflammation. Please discuss the implications.

We would like to appreciate invaluable comment. It is reasonable to consider that sFasL-DR5 interaction might affect various biological events in vivo, including tumor surveillance and inflammation in various organs. Our experiments demonstrated that sFasL-DR5 interaction occurred in the inflamed joint tissue-in particular-synovial fibroblasts, suggesting that this interaction might depend on DR5 and sFasL expression patterns, cell types, and microenvironment status in target tissues. Moreover, the expression of DR5 and FasL has been reported in various cell types, thereby establishing complicated interaction network during various biological events. Thus, it is reasonable that sFasL-DR5 interaction regulates tumor surveillance and inflammation via various ways, which should be investigated further. We discuss this issue in the section of Discussion (page 12 and 13) as follows: In several studies, DR5 KO mice showed enhancement of tumor metastasis and inflammation (Zhu et al., 2014; Finnberg, Klein-Szanto, and El-Deiry, 2008), which appears to be contradictory to inflammatory inducer of sFasL-DR5 interaction. However, the expression of DR5 and FasL has been reported in various cell types (O'Brien et al., 2005; O'Connell, 2000; Yuan et al., 2018), hereby inducing complicated interaction network during biological events, suggesting that sFasL-DR5 interaction regulates tumor surveillance and inflammation via complicated ways, resulting in various biological effects. Thus, these issues should be investigated further.

4. Not once do the authors explain to a wider audience what FLSC stands for.

In the first expression of FLSC, we described FLSC presents fibroblast-like synovial cells in 43 line of page 2 and 68 line of page 3.

5. Figure 1G: How many patients/slides were stained? Statistics need to be provided.

We analyzed DR5-positive cells in the minimum three fields (× 400 magnification) in microsection of joint tissues from three patients. As reviewer suggested, we presented statistics in Figure 1G.

6. Line 104: It should read "Figure 1—figure supplement 2C".

As reviewer pointed out, we modified manuscript.

7. Line 107: It should read "Figure 1—figure supplement 2D and E". 8) Line 133: It should read "Figure 2—figure supplement 1B" instead of Figure S4B.

As reviewer pointed out, we modified manuscript.

8. Figure 3—figure supplement 2 is labeled in the figure legend as Supplemental figure 7, Figure 5—figure supplement 1 as Supplemental figure 9, and Figure 6—figure supplement 1 as Supplemental figure 10, respectively.

As reviewer pointed out, we modified manuscript.

9. The authors state that based on the data sFasL-DR5 interactions induce both apoptosis and necroptosis. Without more detailed analyses it is not clear whether necroptosis is induced. All that the data suggest is that cells undergo secondary necrosis, a phenomenon typical for in vitro stimulated cells. Please discuss.

DR5 activation can be led to two major consequences; inflammation and cell death (apoptosis and/or necroptosis). We tried to figure out which pathway is activated by sFasL-DR5 interactions and exacerbates joint inflammation. To address this issue, specific triggering of cell death by DR5 in response to sFasL was validated using inhibitors that specifically affect apoptosis or necroptosis. Thus, we used specific inhibitors of apoptosis (NSCI for caspase 3) and necroptosis (GSK’872 for RIPK3). Upon treatment of hFLSCs with FasL, apoptosis and necroptosis were increased, which was inhibited by adding NSCI and GSK’872, respectively. In particular, FasL-induced apoptosis and necroptosis were reduced in Fas or DR5 gene- knockout hFLSCs. Moreover, both Fas and DR5 gene-knockout (DKO) hFLSCs showed minimal apoptosis and necroptosis upon sFasL treatment. These findings indicate that FasL-DR5 interaction induces both apoptosis and necroptosis. We discuss this issue in the section of results (page 7) as follows:

Moreover, the sFasL-DR5 and sTRAIL-DR5 interactions similarly induced apoptosis and necroptosis in hFLSCs (von Karstedt, Montinaro, and Walczak, 2017; Wiley et al., 1995), which was inhibited by NSCI (caspase 3 inhibitor) and GSK’872 (RIPK3 inhibitor), respectively (Figure 2F and G, and Figure 2—figure supplement 2A-D). Moreover, FasL-induced apoptosis and necroptosis were partially reduced in Fas or DR5 gene-knockout hFLSCs and almost abolished in both Fas and DR5 gene-knockout (DKO) hFLSCs. These findings indicate that FasL-DR5 and FasL-Fas interactions induce apoptosis and necroptosis.

10. As to the article title. I would suggest to include in the title that this is in the context of autoantibody-induced arthritis. Also the "Fas independent receptor" does not sound good. Something like: Fas ligand drives autoantibody-induced arthritis through binding to DR5/TRAIL-R2

As reviewer suggested, we modified title as follows: Soluble Fas ligand drives autoantibody-induced arthritis via binding to DR5/TRAIL-R2

(iii) Additional requests that I consider to be of secondary importance for the central message of the paper. You might choose either to address these requests or just to delete the data that they concern.

1. FasL-Fc is an unnatural construct that (presumably) displays two FasL homotrimers. Rather than using it interchangeably without explanation, the authors should better use just sFasL throughout the study.

We would like to appreciate reviewer’s reasonable comment. First, to address this issue, we biotinylated recombinant sFasL (bio-sFasL) and used this bio-sFasL for flow cytometry experiments. WT and Fas and/or DR5 KO hFLSCs were incubated with bio-sFasL, washed, and treated with streptavidin (sAv)-PE. Flow cytometry demonstrated that WT hFLSCs were stained with sAv-PE, which was decreased in Fas or DR5 KO cells. Moreover, sAv-PE staining was minimally detected in Fas and DR5 DKO cells compared with WT and single gene KO cells (Figure 1—figure supplement 4D). These results were similar to those obtained from experiments using FasL-Fc, suggesting that FasL-Fc is reasonable reagent to estimate binding between FasL and its receptors such as DR5 and Fas.

Second, we validated FasL-Fc in terms of functional aspect by measuring sFasL-mediated cell death and CX3CL1 production of hFLSCs (Figure 3—figure supplement 1B and 1C). FasL-Fc induced cell death and CX3CL1 production of hFLSCs, which were similar to those induced by sFasL (Figure 1 —figure supplement 3D and Figure 3 —figure supplement 1B and C).

Taken together, these findings indicate that biological activities of FasL-Fc are similar to those of sFasL.

2. The authors contrast binding of FasL-Fc to human DR5 with human DR4. What about other TRAIL receptors, and other TNFRSF members? A more complete analysis is called for.

To address this, we knock-downed other TRAIL receptors and TNFRSF members in hFLSCs (Figure 1—figure supplement 4B). However, no membrane receptors were bound to FITC-conjugated FasL-Fc except for Fas and DR5 and produced FasL-mediated CX3CL1 except DR5 (Figure 1 —figure supplement 4A and Figure 3—figure supplement 1I). These findings indicate that FasL binds to Fas and DR5, but not other TNFRSF members.

3. If FasL binds to DR5, then what specific binding site does it occupy? Are there any specific mutations that can disrupt this binding? Is the FasL binding site for DR5 related to TRAIL's? Is there homology between the DR5 and Fas binding sites for FasL?

We presented the results to address these questions in previous version of manuscript (page 7) as follows: Pre-incubation of rhFasL, but not rhTRAIL, reduced rhFasL-Fc protein binding to EL4 cells expressing hFas (Figure 2A and Figure 1—figure supplement 2G), whereas pre-incubation with rhTRAIL or rhFasL inhibited rhFasL-Fc protein binding to hFLSCs and hDR5-expressing EL4 cells, indicating that TRAIL and FasL compete for binding to DR5 (Figure 2A and B, and Figure 1—figure supplement 2F and J). Based on crystal structures of the FasL/DcR3 (PDB 4MSV) and TRAIL/DR5 (1D4V) complexes, FasL forms a trimer similar to other TNF ligands, and DcR3 or DR5 binds to the interface formed by two adjacent FasL or TRAIL monomers, resulting in 3:3 stoichiometry (FasL:DcR3 or TRAIL/DR5) (Figure 2—figure supplement 1B) (Liu et al., 2016; Mongkolsapaya et al., 1999). Moreover, superimposition of these two complexes demonstrates that most of their interaction determinants are similarly arranged. To test whether the binding mode of FasL and TRAIL to DR5 are similar, we mutated amino acids in cysteine-rich domain (CRD)2 or 3 of DR5, which are critical for the TRAIL-DR5 interaction (Figure 2C and Figure 2—figure supplement 1C). In contrast to WT hDR5, rhFasL-Fc protein did not bind to EL4 cells expressing hDR5 mutated in CRD2 or CRD3 (Figure 2D), although the expression levels of WT and mutant hDR5 were similar (Figure 2—figure supplement 1C). Moreover, rhDR5-Fc protein binding was abolished in EL4 cells expressing FasL mutants, which can inhibit the interaction between FasL and DcR3 (Figure 2E and Figure 2—figure supplement 1E). Collectively, these findings indicate that regions of DR5 that bind hFasL may largely overlap with those that bind hTRAIL, and the binding mode of FasL to DcR3 and DR5 is similar, although the precise sites of hFasL and hDR5 interaction remain unclear.

4. All negative data using inhibitors (e.g. zVAD-fmk) need to be supported by positive control data for the inhibitors, particularly in the in vivo experiments.

To address this, we injected mice with zVAD-fmk during AIA and measured cell death of immune cells from joint tissues. Upon injection with zVAD-fmk, the cell death of immune cells was inhibited, indicating that zVAD-fmk acts as caspase inhibitor in vivo. The data are presented in Figure 2 —figure supplement 3B.

5. The authors should provide evidence that sFasL leads to the assembly of a FADD-containing complex that is dependent of DR5 and not Fas using both murine and human Fas and DR5 KO cells.

I would like to appreciate reviewer’s reasonable comment on this issue. However, we did not address this issue further because we decided to delete these data in our manuscript.

6. sFas and TRAIL are known inducers of cell death, however, in the present manuscript the authors do not take into account this variable and the possible effect that cell death might have in, as an example, selecting for a particular cell population. The in vitro experiments should be validated in the presence of cell death inhibitors. In this regard, the authors mention different modes of cell death without testing for them. If such conclusions are to be drawn than the authors should use specific inhibitors of the difference cell death modalities.

To address this issue, specific triggering of cell death by DR5 in response to sFasL was validated by the use of inhibitors that specifically affect apoptosis and necroptosis. Thus, we used specific inhibitors of apoptosis (NSCl for caspase 3) and necroptosis (GSK’872 for RIPK3). Upon treatment of hFLSCs with FasL, apoptosis and necroptosis were increased, which was inhibited by adding NSCI and GSK’872, respectively. In particular, FasL-induced apoptosis and necroptosis were reduced in Fas or DR5 gene- knockout hFLSCs (Figure 2 —figure supplement 2B and 2D). Moreover, both Fas and DR5 gene-knockout (DKO) hFLSC showed minimal apoptosis and necroptosis upon FasL treatment (Figure 2 —figure supplement 2B and 2D). These findings indicate that FasL-DR5 interaction induces both apoptosis and necroptosis but minimally effects on AIA.

7. Throughout the manuscript there are several controls missing. While the authors demonstrate the efficiency of deletion of the siRNAs used, it is imperative to assess the abolishment of the signaling that depends on that receptor in the presence of its respective bona fide ligands. This can be achieved by assessing of the formation of the FADD-containing complex by western blot and downstream output of cell death and gene activation.

To address this issue, we knockout DR5 and/or Fas gene in hFLSC using CRISPR/Cas9 rather than assessing of the formation of the FADD-containing complex using western blot. Flow cytometric analysis demonstrated that the expression of Fas and DR5 on hFLSCs after knockout these genes using CRISPR/Cas9 (Figure 1 —figure supplement 4C). Upon knockout of DR5 or Fas gene in human synovial fibroblasts, FasL-mediated cell death and FasL-Fc binding were decreased compared with WT synovial fibroblasts, which were more decreased by both Fas and DR5 gene knockout (double knockout; DKO) cells. FasL-mediated cell death and FasL-Fc binding were restored in DKO synovial fibroblasts by re-expressing DR5 or Fas. Furthermore, sFasL-mediated CX3CL1 production was reduced in DR5, but not in Fas gene knockout human synovial fibroblasts (Figure 3F). DKO cells also showed a reduction of FasL-mediated cell death and FasL-Fc binding like as DR5 knockout cells. Furthermore, re-expression of DR5 in DKO cells restored FasL-mediated cell death and CX3CL1 production, and FasL-Fc binding, whereas Fas re-expression did FasL-mediated cell death and FasL-Fc binding, but not CX3CL1 production. Thus, both knock-down and knockout system demonstrated similar results in terms of FasL-DR5 interaction and its biological effect on CX3CL1 production by synovial fibroblasts.

8. The western blot presented in figure 3j raises doubt regarding the efficiency of Fas blocking in their experiments. As demonstrated in lanes 7-9 versus lanes 1-3, their blocking antibody for Fas has very little capacity to block sFasL-mediated p-IkBα. The authors should explain this observation and (as specified above) repeat the experiment using KO cells for DR5 and/or Fas.

We would like to appreciate reviewer’s reasonable comment. As reviewer pointed out, we deleted our western data in revised manuscript instead of performing experiments using KO cells for DR5 and/or Fas.

9. Regarding the mechanisms of AIA and its dependency on DR5-sFasL engagement the authors should show the levels of CX3CL1 in mFasL KO mice and in sFasKO mice treated with recombinant sFasL. Additionally, the authors should generate DR5/CX3CL DKO mice and DR5-FasL delt.s DKO to show that these mice do not exhibit AIA upon sFasL treatment.

As reviewer pointed out, we present the levels of CX3CL1 in mFasL KO (FaslΔm/Δm) mice and sFasL KO (FaslΔs/Δs) treated with recombinant sFasL in the joint tissue during AIA (Figure 4D). Upon induction of AIA, the levels of CX3CL1 were reduced in joint tissues from sFasL KO and tnfrsf10b KO mice, but not mFasL KO mice compared with WT mice. Injection with recombinant sFasL increased the levels of CX3CL1 in the joint tissues from WT, sFasL KO, and mFasL KO mice, but not tnfrsf10b KO mice during AIA.

As reviewer suggested, we have been trying to generate DR5/CX3CL1 and DR5/FasL delt.s DKO mice after editor’s decision that gave us a chance to revise our manuscript. Unfortunately, we have not generated these DKO mice yet due to short of time. Thus, we could not perform experiments using these DKO mice.

10. To show that sFasL-DR5 indeed leads to CX3CL1-induced AIA the authors should add to figure 6 a rescue experiment using sFasL-KO mice and conditionally induce CX3CL1 expression.

In previous version of manuscript, we presented results of rescue experiments using sFasL KO mice. As reviewer pointed out, recombinant CX3CL1 injection restored AIA in sFasL KO mice. Moreover, recombinant sFasL increased the levels of CX3CL1 in the joint tissues of sFasL KO mice (Figure 4D).

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Comments about the ex vivo data:

Specific comments

1. The viewers believe that in order to exclude remaining doubts about your claims there is the need for several more rigorous controls, as detailed below:

Figure 1H

The figure shows binding of FasL-Fc to DR5-transfected EL4 cells, which is blocked by anti-FasL antibody. There should be a comparison to binding of TRAIL-Fc and to an irrelevant Fc fusion protein. Also, does TRAIL-Fc or anti-DR5 antibody block this FACS shift observed with FasL-Fc? The effect of re-expression of Fas alone, without the re-expression of DR5, in the double knockout cells should also be shown. Similar questions apply to Figure 1I.

I would like to appreciate reviewer’s reasonable suggestion regarding appropriate control for these experiments. However, TRAIL-Fc protein is not commercially available and it is not easy to generate TRAIL-Fc protein by ourselves due to time and technical limitation. Alternatively, we have addressed this point using biotinylated TRAIL, FasL, and TNF-α by biotinylating recombinant proteins. Our experiments demonstrated that biotinylated human FasL (bio-hFasL) and bio-TRAIL bound to hDR5-transfected EL4 cells. Moreover, bio-hFasL binding was blocked by pre-incubation of cells with recombinant human TRAIL or anti-human FasL antibody. However, an irrelevant protein such as biotinylated human TNF-α did not bind to human DR5-transfected EL4 cells. Furthermore, biotinylated human FasL (bio-hFasL) bound to human Fas-transfected EL4 cells, which was also inhibited by pre-incubation of bio-hFasL with recombinant hDR5. In contrast, biotinylated human TRAIL did not bind to human Fas-transfected EL4 cells. These results have been presented in Figure 1H and Figure 1—figure supplement 2I in revised version.

In addition, biotinylated hFasL bound to double knockout cells with re-expression of Fas alone, whereas biotinylated hTRAIL did not, which have been also presented in Figure 1I and Figure 1—figure supplement 4D and E.

Taken together, it has been confirmed that FasL specifically binds to DR5 as well as Fas on the cell surface.

Figure 1I and Figure 1 – —figure supplement 4C and 4D

The authors should provide real-time PCR evidence that the Fas and TRAIL genes have indeed been knocked out in all the cells in the preparations used in these experiments.

As reviewer suggested, we performed real-time PCR for validating knockout of target genes, which has been presented in Figure1—figure supplement 4C.

In Fig, 1J

sFasL or sTRAIL is added to hFLSCs, cross-linked, and immunoprecipitated with IgG or anti-DR5 and FasL or TRAIL visualized by immunoblot. PBS is an inadequate control here: they should use another soluble TNFSF ligand as a negative control. Also, the binding of sFasL should be blocked by excess sTRAIL and vice versa.

As reviewer suggested, we performed immunoprecipitation using appropriate control protein such as recombinant TNF-α. Recombinant TNF-α did not bound to immunoprecipitated DR5, whereas recombinant FasL and TRAIL bound to DR5, which have been presented in figure 1J. Furthermore, excess amount (20 times) of recombinant TRAIL inhibited binding of FasL to DR5 and that of recombinant FasL also blocked binding of TRAIL to DR5, which has been presented in Figure 2—figure supplement 1A.

Figure 1K

Please compare binding of DR5-Fc with Fas-Fc. Compare binding to EL4-FasL with binding to EL4-TRAIL (positive) and EL4-mTNFa (negative). Is binding of DR5-Fc blocked by TRAIL or by anti-DR5 antibody?

As reviewer suggested, we compared binding of DR5-Fc and Fas-Fc to human FasL-transfected EL4 cells. Both Fas-Fc and DR5-Fc bound to human FasL-transfected EL4 cells (Figure 1—figure supplement 4J). Furthermore, DR5-Fc bound to human TRAIL or FasL-transfected EL4 cells, whereas it did not bind to human TNF-α-transfected EL4 cells. Compared with DR5-Fc, Fas-Fc bound to human FasL-transfected EL4 cells, but not human TNF-α or TRAIL-transfected EL4 cells. These results have been presented in Figure 1—figure supplement 4K and L. Furthermore, Binding of DR5-Fc to human FasL-transfected EL4 cells were inhibited by pre-incubating with recombinant human TRAIL, anti-human DR5 antibody, or anti-human FasL antibody (Figure 1K).

2. Figure 3H and I and the related supplementary figures

The relevance of the signalling mechanism by which sCX3CL1 is induced to the rest of the paper is not clear. Moreover, given selectivity caveats with the small molecule the significance of the evidence about this issue is limited. The authors should either delete this part or relate to its implications as just putative.

As reviewer suggested, we described implication of sCX3CL1 signaling mechanism as just putative in abstract, results, and discussion parts as follows:

Abstract; The interaction enhanced Cx3cl1 transcription and sCX3CL1 generation from FLSCs, which might be in an NF-κB-dependent manner.

Results; These findings indicate that sFasL-DR5 interaction-mediated enhancement of CX3CL1 transcription and sCX3CL1 generation in hFLSCs, which might be dependent on the NF-κB signaling pathway.

Discussion; In our experiments, the sFasL-DR5 interaction enhanced Cx3cl1 transcription and sCX3CL1 generation by FLSCs in mice and humans, which might be in an NF-κB dependent manner, whereas the sTRAIL-DR5 interaction did not.

General comments

1. How were transfected cell lines generated and validated? Please explain and present the data.

As reviewer pointed out, we have described how to generate transfected cell lines in Materials and methods and validated transfected genes, which have been presented in Figure 1—figure supplement 2H (for TNFRSF10B and FAS genes) and Figure 1—figure supplement 4 I (for FASL, TNFSF10, and TNF genes).

In page 20, Materials and methods as follows;

Plasmids and transfection

WT human FAS (NM_000043.5), TNFRSF10B (NM_147187.2), FASLG (AY858799.1), TNF (NC_000006.12), and TNFSF10 (NM_001190942.2), and the mutant forms of human TNFRSF10B and FASLG (as described in Figure 2—figure supplement 1C) were cloned into the pIRES3-puro vector (Clontech). EL4 cells were transfected with these genes using a Neon transfection system kit referred to the conventional protocol (1080 V, 50 ms, 1 time). The expression of transfected genes was examined by real-time PCR (Figure 1 —figure supplement 4I) or flow cytometry (Figure 1 —figure supplement 4K and Figure 2 – —figure supplement 1D and E).

2. The references cited for TRAIL-DR5 interaction and co-crystal structures are incomplete.

As reviewer pointed out, we have added references for TRAIL-DR5 interaction and co-crystal structures as follows;

These findings indicate that TRAIL and FasL compete for binding to DR5. Based on crystal structures of the FasL/DcR3 (PDB 4MSV) and TRAIL/DR5 (1D4V and 1DU3) complexes, FasL forms a trimer similar to other TNF ligands, and DcR3 or DR5 binds to the interface formed by two adjacent FasL or TRAIL monomers, resulting in 3:3 stoichiometry (FasL:DcR3 or TRAIL:DR5) (Figure 2—figure supplement 1A) (Cha et al., 2000; Liu et al., 2016<; Mongkolsapaya et al., 1999).

Comments about the in vivo data:

As the authors themselves show (Figure 1—figure supplemental 1A), cells of the lpr mice still express some Fas, although at a greatly reduced level. This, unfortunately, casts some doubt on the interpretation of the in vivo data in this study. The authors should either fully delete all these data or present their implication as just putative. It is a pity that the authors have not used the Fas full knockout mice (which are available from Jackson laboratories). Demonstrating an effect of injected sFasL on those mice would have yielded unequivocal evidence.

As reviewer pointed out, the effect of sFasL-Fas interaction on joint inflammation should be considered in Faslpr/lpr mice. Thus, we have presented results and implication of Faslpr/lpr mice as putative as follows in results and discussion parts:

Results: Taken together, these findings suggest that sFasL generation in hematopoietic cells promotes AIA by binding Fas-independent receptor, although Faslpr/lpr mice have been reported to express low level of Fas in vivo (Mariani, Matiba, Armandola, and Krammer, 1994).

Discussion part: Thus, it is unlikely that minimal sFasL-Fas interaction-mediated apoptosis in Faslpr/lpr mice affects the pathogenesis of AIA, although the effect of sFasL-Fas interaction on arthritis might be completely ruled out in Faslpr/lpr mice.

Comments about the English:

The sentence ""the interaction of Fas-independent membrane bound receptor and FasL remains elusive or unclear" makes no sense. It implies the existence of previous evidence of such an alternative receptor. There is no such evidence and hence the starting point of the study is still poorly justified. One could change the sentence in the introduction to "whether sFasL-mediated inflammation is regulated via interaction with Fas in vivo has not been demonstrated directly". Also, the next sentence would make more sense if it started with: "By addressing these questions we identified….".

In the abstract the authors claim the following: "Affinity purification mass spectrometry analysis using human fibroblast-like synovial cells (hFLSCs) revealed DR5 as a FasL receptor." This statement is somewhat misleading. As the authors explain in their reply to the reviewers' comments, the mass-spectrometric analysis of the affinity precipitate they obtained with recombinant FasL-Fc, resulted in the identification of many different proteins as putative interactors with DR5 being one of many. It is therefore not correct to claim that the interaction with DR5 would be specific. In the response to the reviewers' comments the authors state that they "selected DR5" from a list of 29 proteins they found in the IP which contained a transmembrane domain or were expressed as extracellular proteins. Whereas this puts the starting point of the study into question (why did they not pick CD70, another TNFRSF member which they found in the list?), I understand the argument but in view of the reviewers they should stay closer to the data and relate to their findings differently. Something along the lines of the following would probably be more appropriate: "Affinity purification mass spectrometry analysis using human fibroblast-like synovial cells (hFLSCs) identified DR5 as one of several candidates as the elusive Fas-independent FasL receptor. Subsequent cellular and biochemical analysis revealed that DR5 can specifically interact with recombinant FasL-Fc protein, albeit with an approximately 60-fold lower affinity than Fas."

I would like to appreciate reviewer’s reasonable comments for several sentences in abstract. As reviewer suggested, we modified several sentences in the abstract as follows:

Whether sFasL-mediated inflammation is regulated via interaction with Fas in vivo has not been demonstrated directly. By addressing these questions we identified FasL specifically interacts with TNFRSF10B, known as DR5. FasL (Faslgld/gld)-and soluble FasL (FaslΔs/Δs)-deficient mice, but not Fas (Faslpr/lpr)-and membrane FasL (FaslΔm/Δm)-deficient mice, attenuated autoantibody-induced arthritis (AIA), suggesting sFasL promotes inflammation by binding a Fas-independent receptor. Affinity purification mass spectrometry analysis using human fibroblast-like synovial cells (hFLSCs) identified DR5 as one of several candidates as the elusive Fas-independent FasL receptor. Subsequent cellular and biochemical analysis revealed that DR5 can specifically interact with recombinant FasL-Fc protein, albeit with an approximately 60-fold lower affinity than interaction between TRAIL and DR5.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Although you have addressed most of the concerns of the reviewers, the reviewers remained concerned about the lack of a definitive control from the beginning of this review process. This concern has not been addressed yet thoroughly enough. The reviewers maintain their request to provide such control by the use of a full Fas knockout mouse (which are available from Jackson Labs). Therefore, we ask you to obtain these mice and perform the definitive experiment which is to test whether injection of recombinant sFasL in full Fas knockout mice promotes AIA or not.

Given that this study may have far-reaching consequences, we believe that the revision with the above experimental results is essential for us to make the final decision.

As Dr. Taniguchi suggested, we obtained frozen embryo of Fas KO mice from RIKEN, Japan and performed experiments after recovering them, which has been taking long time. I would like to deeply appreciate Dr. Taniguchi and reviewers’ kind consideration on work.

In K/BxN serum transfer arthritis model, Fas KO mice showed significant joint inflammation and increased expression levels of Cx3cl1 as much as wild-type (WT) mice , whereas minimal joint inflammation was found in DR5 KO mice (Figure 1A, and Figure 1—figure supplement 1A, B, and C, and Figure 3C). Furthermore, injection of recombinant sFasL (soluble Fas ligand) enhanced arthritis in WT and Fas KO mice during K/BxN serum transfer arthritis model, whereas it minimally altered joint inflammation in DR5 KO mice (Figure 1—figure supplement 1J). Also, in vitro culture showed that sFasL promoted Cx3cl1 transcript expression and CX3CL1 secretion by synovial fibroblasts from Fas KO mice (Figure 3G and Figure 3 —figure supplement 1K). Taken together these results and large amount data in our manuscript, we have concluded that sFasL promotes joint inflammation by interaction with DR5, but not Fas.

One additional point: There seems to be a mistake in Figure 1H. The EL4 thymoma cells used in the experiment that was presented in this figure have been shown in quite a number of other studies to express TNF receptors and to respond to TNF. We wonder if the fact that you did not see any sign for binding of biotinylated TNF to the EL4-hDR5 cells that were used in this experiment was due to some fault in the preparation of the biotinylated TNF.

We would like to thank reviewer for reasonable comment. As reviewer suggested, we present new data in Figure 1H.

https://doi.org/10.7554/eLife.48840.sa2

Article and author information

Author details

  1. Dongjin Jeong

    1. Department of Pathology, Seoul National University College of Medicine, Seoul, Republic of Korea
    2. Laboratory of Immune Regulation in Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology
    Contributed equally with
    Hye Sung Kim
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7122-1220

  2. Hye Sung Kim

    Laboratory of Immune Regulation in Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Conceptualization, Investigation, Methodology
    Contributed equally with
    Dongjin Jeong
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1297-7081

  3. Hye Young Kim

    Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Conceptualization, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-5978-512X

  4. Min Jueng Kang

    1. Department of Molecular Medicine and Biopharmaceutical Sciences, School of Convergence Science, Seoul, Republic of Korea
    2. Technology and College of Medicine or College of Pharmacy, Seoul National University, Seoul, Republic of Korea
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared

  5. Hyeryeon Jung

    1. Department of Molecular Medicine and Biopharmaceutical Sciences, School of Convergence Science, Seoul, Republic of Korea
    2. Technology and College of Medicine or College of Pharmacy, Seoul National University, Seoul, Republic of Korea
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-5179-8604

  6. Yumi Oh

    Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared

  7. Donghyun Kim

    Laboratory of Immune Regulation in Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7863-7384

  8. Jaemoon Koh

    Department of Pathology, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared

  9. Sung-Yup Cho

    Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared

  10. Yoon Kyung Jeon

    Department of Pathology, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Investigation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8466-9681

  11. Eun Bong Lee

    Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Resources
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0703-1208

  12. Seung Hyo Lee

    Graduate School of Medical Science and Engineering, Korean Advanced Institute of Science and Technology (KAIST), Daejeon, Republic of Korea
    Contribution
    Interpretation and integration of key experiments and results
    Competing interests
    No competing interests declared

  13. Eui-Cheol Shin

    Graduate School of Medical Science and Engineering, Korean Advanced Institute of Science and Technology (KAIST), Daejeon, Republic of Korea
    Contribution
    Interpretation and integration of key experiments and results
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6308-9503

  14. Ho Min Kim

    Graduate School of Medical Science and Engineering, Korean Advanced Institute of Science and Technology (KAIST), Daejeon, Republic of Korea
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0029-3643

  15. Eugene C Yi

    1. Department of Molecular Medicine and Biopharmaceutical Sciences, School of Convergence Science, Seoul, Republic of Korea
    2. Technology and College of Medicine or College of Pharmacy, Seoul National University, Seoul, Republic of Korea
    Contribution
    Methodology
    Competing interests
    No competing interests declared

  16. Doo Hyun Chung

    1. Department of Pathology, Seoul National University College of Medicine, Seoul, Republic of Korea
    2. Laboratory of Immune Regulation in Department of Biomedical Sciences, Seoul National University College of Medicine, Seoul, Republic of Korea
    Contribution
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Methodology, Project administration
    For correspondence
    doohyun@snu.ac.kr
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9948-8485

Funding

Ministry of Health and Welfare (HI14C1277)

  • Doo Hyun Chung

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We would like to thank Hyehwa Forum members for their helpful discussions. This research was supported by Korea Health Technology R and D Project grant through the Korea Health Industry Development Institute (KHIDI), which is funded by the Ministry of Health and Welfare, Republic of Korea (grant number: HI14C1277).

Ethics

Human subjects: Research participants were diagnosed with rheumatoid arthritis, fulfilled the 1987 American College of Rheumatology (ACR) criteria. There were no specific characteristics within the participants other than rheumatoid arthritis. All participants with arthritis were recruited in Seoul National University Hospital. This study was approved by the Institutional Review Board of Seoul National University Hospital (H 1009-064-332) and informed consent obtained from all sample donors.

Animal experimentation: This study was approved by the Institutional Animal Care and Use Committee of Biomedical Research Institute of Seoul National University Hospital (BRISNUH, IACUC No. 17-0051 and 20-0171). All of the animals were maintained in the facility accredited AAALAC International (#001169) in accordance with Guide for the Care and Use of Laboratory Animals 8th edition, NRC (2010). All animal experiments were done according to the Guideline for Ethical Animal Experiments, Seoul National University (2013). Mouse sacrifice was performed under isoflurane anesthesia, and every effort was made to minimize suffering.

Senior Editor

  1. Tadatsugu Taniguchi, Institute of Industrial Science, The University of Tokyo, Japan

Reviewing Editor

  1. David Wallach, The Weizmann Institute of Science, Israel

Reviewer

  1. Marcus E Peter, Feinberg School of Medicine, Northwestern University, United States

Version history

  1. Received: May 27, 2019
  2. Accepted: June 23, 2021
  3. Version of Record published: July 5, 2021 (version 1)

Copyright

© 2021, Jeong et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,397
    Page views
  • 172
    Downloads
  • 3
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Dongjin Jeong
  2. Hye Sung Kim
  3. Hye Young Kim
  4. Min Jueng Kang
  5. Hyeryeon Jung
  6. Yumi Oh
  7. Donghyun Kim
  8. Jaemoon Koh
  9. Sung-Yup Cho
  10. Yoon Kyung Jeon
  11. Eun Bong Lee
  12. Seung Hyo Lee
  13. Eui-Cheol Shin
  14. Ho Min Kim
  15. Eugene C Yi
  16. Doo Hyun Chung
(2021)
Soluble Fas ligand drives autoantibody-induced arthritis by binding to DR5/TRAIL-R2
eLife 10:e48840.
https://doi.org/10.7554/eLife.48840

Categories and tags

Research organisms

Further reading

    1. Immunology and Inflammation

    Mouse gingival single-cell transcriptomic atlas identified a novel fibroblast subpopulation activated to guide oral barrier immunity in periodontitis

    Takeru Kondo, Annie Gleason ... Ichiro Nishimura
    Research Article

    Periodontitis, one of the most common non-communicable diseases, is characterized by chronic oral inflammation and uncontrolled tooth supporting alveolar bone resorption. Its underlying mechanism to initiate aberrant oral barrier immunity has yet to be delineated. Here, we report a unique fibroblast subpopulation activated to guide oral inflammation (AG fibroblasts) identified in a single-cell RNA sequencing gingival cell atlas constructed from the mouse periodontitis models. AG fibroblasts localized beneath the gingival epithelium and in the cervical periodontal ligament responded to the ligature placement and to the discrete topical application of Toll-like receptor stimulants to mouse maxillary tissue. The upregulated chemokines and ligands of AG fibroblasts linked to the putative receptors of neutrophils in the early stages of periodontitis. In the established chronic inflammation, neutrophils, together with AG fibroblasts, appeared to induce type 3 innate lymphoid cells (ILC3s) that were the primary source of interleukin-17 cytokines. The comparative analysis of Rag2-/- and Rag2-/-Il2rg-/- mice suggested that ILC3 contributed to the cervical alveolar bone resorption interfacing the gingival inflammation. We propose the AG fibroblast–neutrophil–ILC3 axis as a previously unrecognized mechanism which could be involved in the complex interplay between oral barrier immune cells contributing to pathological inflammation in periodontitis.

    1. Cell Biology
    2. Immunology and Inflammation

    Regulation of pDC Fate Determination by Histone Deacetylase 3

    Yijun Zhang, Tao Wu ... Li Wu
    Research Article

    Dendritic cells (DCs), the key antigen-presenting cells, are primary regulators of immune responses. Transcriptional regulation of DC development had been one of the major research interests in DC biology, however, the epigenetic regulatory mechanisms during DC development remains unclear. Here, we report that Histone deacetylase 3 (Hdac3), an important epigenetic regulator, is highly expressed in pDCs, and its deficiency profoundly impaired the development of pDCs. Significant disturbance of homeostasis of hematopoietic progenitors was also observed in HDAC3-deficient mice, manifested by altered cell numbers of these progenitors and defective differentiation potentials for pDCs. Using the in vitro Flt3L supplemented DC culture system, we further demonstrated that HDAC3 was required for the differentiation of pDCs from progenitors at all developmental stages. Mechanistically, HDAC3 deficiency resulted in enhanced expression of cDC1-associated genes, owing to markedly elevated H3K27 acetylation (H3K27ac) at these gene sites in BM pDCs. In contrast, the expression of pDC-associated genes was significantly downregulated, leading to defective pDC differentiation.

    1. Computational and Systems Biology
    2. Immunology and Inflammation

    Quantitative analyses of T cell motion in tissue reveals factors driving T cell search in tissues

    David J Torres, Paulus Mrass ... Judy L Cannon
    Research Article Updated

    T cells are required to clear infection, and T cell motion plays a role in how quickly a T cell finds its target, from initial naive T cell activation by a dendritic cell to interaction with target cells in infected tissue. To better understand how different tissue environments affect T cell motility, we compared multiple features of T cell motion including speed, persistence, turning angle, directionality, and confinement of T cells moving in multiple murine tissues using microscopy. We quantitatively analyzed naive T cell motility within the lymph node and compared motility parameters with activated CD8 T cells moving within the villi of small intestine and lung under different activation conditions. Our motility analysis found that while the speeds and the overall displacement of T cells vary within all tissues analyzed, T cells in all tissues tended to persist at the same speed. Interestingly, we found that T cells in the lung show a marked population of T cells turning at close to 180o, while T cells in lymph nodes and villi do not exhibit this “reversing” movement. T cells in the lung also showed significantly decreased meandering ratios and increased confinement compared to T cells in lymph nodes and villi. These differences in motility patterns led to a decrease in the total volume scanned by T cells in lung compared to T cells in lymph node and villi. These results suggest that the tissue environment in which T cells move can impact the type of motility and ultimately, the efficiency of T cell search for target cells within specialized tissues such as the lung.