E. coli TraR allosterically regulates transcription initiation by altering RNA polymerase conformation
- The Rockefeller University, United States
- University of Wisconsin-Madison, United States
Figures
Figure 1 with 4 supplements
Cryo-EM structure of TraR-Eσ70.
(top) Color-coding key. (A) TraR-Eσ70(I) - cryo-EM density map (3.7 Å nominal resolution, low-pass filtered to the local resolution) is shown as a transparent surface and colored according to the …
Figure 1—figure supplement 1
Cryo-EM solution conditions do not affect TraR function and TraR-Eσ70 cryo-EM processing pipeline.
(A) Multi-round in vitro transcription of rpsT P2 by Eσ70 (20 nM) at a range of TraR concentrations (wedge indicates 4 nM - 4 µM) in the absence or presence of 8 mM CHAPSO as indicated. Plasmid …
Figure 1—figure supplement 2
TraR-Eσ70 cryo-EM.
(A) Representative micrograph of TraR-Eσ70 in vitreous ice. (B) The ten most populated classes from 2D classification. (C) Angular distribution for TraR-Eσ70(I) particle projections. (D) Angular …
Figure 1—figure supplement 3
Eσ70 cryo-EM processing pipeline.
Eσ70 cryo-EM processing pipeline.
Figure 1—figure supplement 4
Eσ70 cryo-EM.
(A) Representative micrograph of Eσ70 in vitreous ice. (B) The ten most populated classes from 2D classification. (C) Angular distribution for Eσ70 particle projections. (D) The 4.1 Å resolution …
Figure 2 with 2 supplements
Cryo-EM structure of rpsT P2-RPo.
(A) The Eco rpsT P2 promoter fragment used for cryo-EM. (B) rpsT P2-RPo cryo-EM density map (3.4 Å nominal resolution, low-pass filtered to the local resolution) is shown as a transparent surface …
Figure 2—figure supplement 1
rpsT P2-RPo cryo-EM processing pipeline.
Figure 2—figure supplement 2
rpsT P2-RPo cryo-EM.
(A) The ten most populated classes from 2D classification. (B) Angular distribution for rpsT P2-RPo particle projections. (C) (top) The 3.4 Å resolution cryo-EM density map of rpsT P2-RPo is colored …
Figure 3 with 1 supplement
Conformational flexibility of β'Si3 in TraR-Eσ70.
(A) Overall view of TraR-Eσ70 structure with alternative positions of Si3. Si3(I) is shown in brown. A ~ 121° rotation about the rotation axis shown gives rise to the position of Si3(II) shown in …
Figure 3—figure supplement 1
RNAP-Si3 interaction with TraRG residues.
(A) - (G) Quantifications show averages with range from two independent experiments. (A) (B) (C) Multi round in vitro transcription of rpsT P2 (A), pargI (B) or phisG (C) was performed at a range of …
Figure 4 with 1 supplement
TraR and the βlobe-Si1 domain.
(A) Overall top view of the TraR-Eσ70 structure with the βlobe-Si1 in dark blue. The corresponding position of the βlobe-Si1 in the rpsT P2-RPo structure (Figure 2) is shown in light blue. The …
Figure 4—figure supplement 1
EΔ1.1σ70 has small defects for inhibition of rrnB P1 by TraR.
(A) (top) Multi round in vitro transcription at rrnB P1 was carried out at a range of TraR concentrations (wedge indicates 4 nM - 4 µM) in the presence of 20 nM WT-Eσ70 or EΔ1.1σ70 as indicated. …
Figure 5
TraR rotates the β'shelf and kinks the BH.
(A) Overall view if the TraR-Eσ70(I) structure, shown as a molecular surface. The β'shelf domain is highlighted in hot pink. The β'shelf (which here includes the β'jaw) comprises Eco β' residues …
Figure 6
Multi-body analysis of Eσ70 clamp conformational changes.
(A) Model of Eσ70 refined into the consensus cryo-EM map (nominal 4.1 Å resolution). The RNAP clamp is highlighted in magenta. The clamp (which in the context of Eσ70 includes σ702) comprises the …
Figure 7
Range of clamp conformations for Eco RNAP complexes.
(top) Eσ70 is shown as a molecular surface (α, ω, light gray; β, light cyan; β', light pink; σ70, light orange) except the clamp/σ702 module is shown schematically as blue or red outlines (the σ70NCR…
Figure 8
Proposed effects of TraR on the free energy diagram for hypothetical inhibited and activated promoters.
Shown at the top is a proposed three-step linear kinetic scheme for RPo formation (Hubin et al., 2017a) with an added fourth irreversible step (formation of RPitc) once RNA synthesis begins. (T) …
Videos
Video 1
Video illustrating changes in conformation and conformational dynamics of RNAP induced by TraR binding.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Ident-ifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | Eco BL21(DE3) | EMD Millipore (Burlington, MA) | ||
| Recombinant DNA reagent | pACYCDuet-1_Ec_rpoZ | PMID: 21416542 | ||
| Recombinant DNA reagent | pEcrpoABC(-XH)Z | PMID: 21416542 | ||
| Recombinant DNA reagent | pET28a | EMD Millipore | ||
| Recombinant DNA reagent | pET28a-His10-SUMO rpoD | PMID: 28988932 | ||
| Recombinant DNA reagent | pET28a-His10-SUMO traR (pRLG15142) | This paper | Encodes Eco TraR with N-terminal His10-SUMO tag (Darst lab) | |
| Recombinant DNA reagent | pRLG770 | PMID: 2209559 | In vitro transcription vector, AmpR | |
| Recombinant DNA reagent | pRLG770-rrnB P1 (pRLG13065) | PMID: 27237053 | rrnB P1 with −88 to +50 endpoints | |
| Recombinant DNA reagent | pRLG770-argI (pRLG13098) | PMID: 11162084 | pargI with −45 to +32 endpoints | |
| Recombinant DNA reagent | pRLG770-hisG (pRLG13099) | PMID: 15899978 | phisG with −60 to +1 endpoints | |
| Recombinant DNA reagent | pRLG770-rpsT P2 (pRLG14658) | PMID: 21402902 | rpsT P2 with −89 to +50 endpoints | |
| Recombinant DNA reagent | pRLG770-thrABC (pRLG15276) | PMID: 11162084 | pthrABC with −72 to +16 endpoints | |
| Recombinant DNA reagent | pT7 αββ'(Δ943–1130) (pIA331) | PMID: 12511572 | ∆Si3 RNAP | |
| Recombinant DNA reagent | pIA900 rpoB Δ225–343ΩGG (pRLG12586) | PMID: 28652326 | ∆Si1 RNAP | |
| Recombinant DNA reagent | pET28a-His10-SUMO P43A traR (pRLG14844) | This paper | Encodes Eco TraR[P43A] with N-terminal His10-SUMO tag (Gourse lab) | |
| Recombinant DNA reagent | pET28a- His10- SUMO P45A traR (pRLG14846) | This paper | Encodes Eco TraR[P45A] with N-terminal His10-SUMO tag (Gourse lab) | |
| Recombinant DNA reagent | pET28a-His10- SUMO E46A traR (pRLG14847) | This paper | Encodes Eco TraR[E46A] with N-terminal His10-SUMO tag (Gourse lab) | |
| Recombinant DNA reagent | pET28a-His10-SUMO R49A traR (pRLG15278) | This paper | Encodes Eco TraR[R49A] with N-terminal His10-SUMO tag (Gourse lab) | |
| Recombinant DNA reagent | pET28a-His10-SUMO K50A traR (pRLG15279) | This paper | Encodes Eco TraR[K50A] with N-terminal His10-SUMO tag (Gourse lab) | |
| Sequence-based reagent | P43A traR | IDT, this paper | 5’ GAAGCATGCGGAAATGCTATTCCGGAAGCC 3’ (Gourse lab) | |
| Sequence-based reagent | P45A traR | IDT, this paper | 5’ GGAAATCCTATTGCGGAAGCCCGGCGG 3’ (Gourse lab) | |
| Sequence-based reagent | E46A traR | IDT, this paper | 5’ GGAAATCCTATTCCGGCAGCCCGGCGGAAAATA 3’ (Gourse lab) | |
| Sequence-based reagent | R49A traR | IDT, this paper | 5’ ATTCCGGAAGCCCGGGCGAAAATATTTCCCGGT 3’ (Gourse lab) | |
| Sequence-based reagent | K50A traR | IDT, this paper | 5’ ATTCCGGAAGCCCGGCGGGCAATATTTCCCGGT 3’ (Gourse lab) | |
| Sequence-based reagent | SumoF | IDT, this paper | 5’ GGGGAATTGTGAGCGGATAACAATTCC 3’ (Gourse lab) | |
| Sequence-based reagent | SumoR | IDT, this paper | 5’ GTCCCATTCGCCAATCCGGATATAG 3’ (Gourse lab) | |
| Sequence-based reagent | TraR_sumo_vector_FOR | IDT, this paper | 5’- AAACATTATGCATAACAAAGCCCGAAAGGAAGCTGAG −3’ (Gourse lab) | |
| Sequence-based reagent | pETsumo_traR_vector_REV | IDT, this paper | 5’- CGGCTTCATCACTTCCACCAATCTGTTCTCTGTGAGCC −3’ (Gourse lab) | |
| Sequence-based reagent | TraR_sumo_fragment_REV | IDT, this paper | 5’- TCGGGCTTTGTTATGCATAATGTTTTCTCTGTCTTTCCTGATACG −3’ (Gourse lab) | |
| Sequence-based reagent | TraR_sumo_fragment_FOR | IDT, this paper | 5’- CAGATTGGTGGAAGTGATGAAGCCGATGAAGCATATTCAG −3’ (Gourse lab) | |
| Sequence-based reagent | rrnBP1(−63 to +20) top | IDT, this paper | 5’- GGTCAGAAAATTATTTTAAATTTCCTCTTGTCA GGCCGGAATAACTCCCTATAATGCGCCACCACTGACACGGAACAACGGCG −3’ (Darst lab) | |
| Sequence-based reagent | rrnBP1(−63 to +20) bot | IDT, this paper | 5’- CGCCGTTGTTCCGTGTCAGTGGTGGCGCATTAT AGGGAGTTATTCCGGCCTGACAAGAGGAAATTTAAAATAATTTTCTGACC −3’ (Darst lab) | |
| Sequence-based reagent | rpsTP2(−60 to +25) top | IDT, this paper | 5’- GGCGGCGCTTATTTGCACAAATCCATTGACAAA AGAAGGCTAAAAGGGCATATTCCTCGGCCTTTG AATTGTCCATATAGAACGC −3’ (Darst lab) | |
| Sequence-based reagent | rpsTP2 (−60 to +25) bot | IDT, this paper | 5’- GCGTTCTATATGGACAATTCAAAGGCCGAGGAA TAT GCCCTTTTAGCCTTCTTTTGTCAATGGATTTGT GCAAATAAGCGCCGCC −3’ (Darst lab) | |
| Chemical compound, drug | 3-[(3-Cholamidopropyl)dimethylammonio]−2-Hydroxy-1-Propanesulfonate (CHAPSO) | Anatrace | Cat# C317 | |
| Software, algorithm | Bayesian Polishing | PMID: 30412051 | ||
| Software, algorithm | Bsoft | PMID: 23954653 | ||
| Software, algorithm | Coot | PMID: 15572765 | ||
| Software, algorithm | cryoSPARC | PMID: 28165473 | ||
| Software, algorithm | CTFFIND4 | PMID: 26278980 | ||
| Software, algorithm | EMAN2 | PMID: 16859925 | ||
| Software, algorithm | Gautomatch | http://www.mrc-lmb.cam.ac.uk/kzhang/Gautomatch | ||
| Software, algorithm | Gctf | PMID: 26592709 | ||
| Software, algorithm | Molprobity | PMID: 20057044 | ||
| Software, algorithm | MotionCor2 | PMID: 28250466 | ||
| Software, algorithm | Multi-body refinement | PMID: 29856314 | ||
| Software, algorithm | PHENIX | PMID: 20124702 | ||
| Software, algorithm | RELION | PMID: 23000701 | ||
| Software, algorithm | SerialEM | PMID: 16182563 | ||
| Software, algorithm | UCSF Chimera | PMID: 15264254 | ||
| Software, algorithm | Unblur | PMID: 26023829 | ||
| Other | C-flat CF-1.2/1.3 400 mesh gold grids | Electron Microscopy Sciences | Cat# CF413-100-Au |
Additional files
-
Supplementary file 1
Cryo-EM data acquisition and refinement parameters (Chen et al., 2010).
- https://cdn.elifesciences.org/articles/49375/elife-49375-supp1-v2.docx
-
Supplementary file 2
Details of flux calculator (Galburt, 2018) calculations.
- https://cdn.elifesciences.org/articles/49375/elife-49375-supp2-v2.docx
-
Supplementary file 3
RNAP conformational changes.
- https://cdn.elifesciences.org/articles/49375/elife-49375-supp3-v2.docx
-
Supplementary file 4
Plasmids.
- https://cdn.elifesciences.org/articles/49375/elife-49375-supp4-v2.docx
-
Supplementary file 5
Oligonucleotides and Geneblock sequences.
- https://cdn.elifesciences.org/articles/49375/elife-49375-supp5-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/49375/elife-49375-transrepform-v2.pdf
