The Mars1 kinase confers photoprotection through signaling in the chloroplast unfolded protein response
- Howard Hughes Medical Institute, University of California, San Francisco, United States
- University of California, San Francisco, United States
- Lawrence Berkeley National Laboratory, United States
- Princeton University, United States
Figures
Figure 1 with 1 supplement
Reporter strain for high-throughput screening for cpUPR mutants.
(A) Schematic of cpUPR regulation in the reporter strain. Under homeostatic conditions (-Vit), chloroplast ClpP1 is expressed and the cpUPR pathway is OFF, as indicated by the lack of VIPP2 …
Figure 1—figure supplement 1
Design of a reporter strain for high-throughput detection of the cpUPR signaling in C. reinhardtii.
(A) Histograms of the normalized Yellow Fluorescent Protein (YFP) maximum intensity signal after 2 days in ClpP1-permissive (-Vit) or ClpP1-nonpermissive media (+Vit) for control and cpUPR reporter …
Figure 2 with 4 supplements
Genetic screen identifying mars1-1 and mars1-2.
(A) Scatter plot of changes in YFP fluorescence for each mutant relative to reporter cells in ClpP1-permissive (–Vit) and ClpP1-nonpermissive (+Vit) conditions. Mutants exhibiting YFP fluorescence …
-
Figure 2—source data 1
Scoring mutants via YFP and area measurements.
- https://cdn.elifesciences.org/articles/49577/elife-49577-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
The genetic screen yields two cpUPR silencing mutants, mars1-1 and mars1-2.
(A) A merge of the chlorophyll (green) and YFP (magenta) channel for each of the following cell colonies: control cells (containing only the ClpP1 repressible system), cpUPR reporter cells …
Figure 2—figure supplement 2
Genetic analysis of mars1-1.
(A) Diagram showing the backcross of mars1-1 to CC-124 (WT) and indicating the mating-type and other genetic markers of these two strains. The spectinomycin resistance (Spec R) and the Vit-driven NAC…
Figure 2—figure supplement 3
Genetic analysis of mars1-2.
(A) Diagram showing the backcross of mars1-2 to CC-124 (WT) and indicating the mating-type and other genetic markers of these two strains. (B) Photographs of offspring from the mars1-2 to CC-124 …
Figure 2—figure supplement 4
Genetic analysis of mars1-3 and mars1-4.
(A) Diagram showing the backcross of mars1-3 or mars1-4 to CC-125 (WT) and indicating the mating-type and other genetic markers of these strains. (B) Photographs of offspring from the backcross of ma…
Figure 3 with 2 supplements
Characterization of Mars1.
(A) In the upper diagram, the length of MARS1 transcript is shown, the position of exon-exon boundaries is indicated with vertical lines while the different locations of the triple Flag epitope …
Figure 3—figure supplement 1
A catalytic active Mars1 kinase is required for signaling during the cpUPR.
(A) Immunoblot analysis of samples prepared from strains described below grown in ClpP1-permissive (-Vit) and ClpP1-nonpermissive conditions (+Vit) using antibodies against Flag for Mars1 detection, …
Figure 3—figure supplement 2
Specific immunodetection of the Mars1 Flag protein.
(A) WT cells (CC-4533) were grown in TAP medium, fixed for immunofluorescence (IF) staining with the indicated antibodies and imaged by structured illumination microscopy with the indicated laser …
Figure 4 with 2 supplements
mars1 cells are hypersensitive to photooxidative stress.
(A) Liquid TAP cultures of WT, mars1, mars1:MARS1-D and mars1:MARS1-D KD at different time points upon HL exposure. Alleles used: mars1 = mars1-3; mars1:MARS1-D = mars1-3 transformed with the MARS1-D…
Figure 4—figure supplement 1
Mars1 confers protection against photooxidative stress.
(A) Line charts of total chlorophyll concentrations measured from liquid TAP cultures of strains described in Figure 4A during high light treatment, at the indicated time points. (B) The following …
-
Figure 4—figure supplement 1—source data 1
Chlorophyll measurements during high light stress.
- https://cdn.elifesciences.org/articles/49577/elife-49577-fig4-figsupp1-data1-v2.xlsx
Figure 4—figure supplement 2
mars1 cells can cope with ER stress.
(A) WT, mars1-3 and ire1 cells grown till log phase were harvested and resuspended to a final chlorophyll concentration of ~10 µg/ml in liquid TAP with or without 5 µg/ml of tunicamycin (Tm), a …
Figure 5 with 5 supplements
mars1 cells do not activate the cpUPR transcriptional program.
(A) Venn diagram highlighting the transcriptional changes elicited genetically (ClpP1 repression) or physiologically (HL exposure) in Chlamydomonas cells , as determined by RNA sequencing (overlap …
Figure 5—figure supplement 1
mars1 cells do not induce the cpUPR transcriptional program.
(A) The multidimensional scaling plot illustrates the distance between RNA-seq samples, calculated as leading biological coefficient of variation between samples, based on the log2-fold change of …
Figure 5—figure supplement 2
MARS1 gene expression pattern.
(A) MARS1 mRNA expression profile according to CircadiaNET, a web-based developed tool integrating RNA-Seq data generated over 24 hr periods in neutral day conditions (12 hr light/12 hr dark) from …
-
Figure 5—figure supplement 2—source data 1
MARS1 transcript levels (RPKM values).
- https://cdn.elifesciences.org/articles/49577/elife-49577-fig5-figsupp2-data1-v2.xlsx
Figure 5—figure supplement 3
mars1 cells do not activate autophagy and sulfur starvation genes during cpUPR inducing conditions.
(A) Heatmap comparing expression pattern of manually-selected genes involved autophagy in WT and mars1-1 mutant upon HL exposure (40 and 70 min) and ClpP1 repression. MARS1 disruption impairs the …
Figure 5—figure supplement 4
mars1 cells activate sulfur starvation genes and survive in sulfur-limiting conditions.
(A) WT, mars1-3 and snrk2 cells grown till saturation were harvested, washed twice in sulfur-depleted TAP (-S) and resuspended in TAP or sulfur-depleted TAP to a final chlorophyll concentration of ~1…
Figure 5—figure supplement 5
Regulation of photosynthesis-associated genes is not affected in mars1 cells.
Heatmap comparing expression patterns of manually-selected genes involved in photosynthesis in WT and mars1-1 mutant upon high light exposure (40 and 70 min) and ClpP1 repression. HL = high light; …
Figure 6 with 1 supplement
Basal induction of the cpUPR renders cells more resistant to chloroplast stress.
(A) A diagram of MARS1-E transcript showing the position of the 6x-Flag epitope inserted after Leu402 of Mars1. (B) Immunoblot analysis of samples prepared from cells grown under normal conditions, …
Figure 6—figure supplement 1
The MARS1-E transgene causes mild induction of cpUPR signaling.
(A) Immunoblot analysis of samples prepared from WT cells (CC-4533) and WT cells expressing MARS1-E, MARS1-A or MARS1-D transgene, using antibodies against Flag for Mars1 detection, Vipp2, and …
Author response image 1
Multiple sequence alignment of Mars1 kinase domain (1638-2019 aa) and the five proteins selected by RaptorX as PDB templates to predict Mars1 tertiary structure.
The canonical ATP-binding loop, catalytic triad and EF-helix regions are highlighted by green rectangular frames. The red asterisk indicated the phosphoserine (pS) residue identified in Mars1 …
Author response image 2
Mars1 tertiary structure prediction.
(A) Tertiary structural alignment of Mars1 (light blue) and human VEGFR2 kinase (magenta) in complex with a small molecule inhibitor, Axitinib (gold) (PDB ID: 4agc). 4agc was selected by the RaptorX …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (C. reinhardtii) | clpP1 | GenBank | L28803.1 | |
| Gene (C. reinhardtii) | VIPP2 | Phytozome | Cre11.g468050 | |
| Gene (C. reinhardtii) | MARS1 | Phytozome | Cre16.g692228 | |
| Recombinant DNA reagent | YFP 3x-FLAG | GenBank | ANF29833.1 | |
| Recombinant DNA reagent | pMJ016c | GenBank | KX077951.1 | |
| Antibody | anti-ClpP1 | gift from Francis-André Wollman and Olivier Vallon | 1:5000 | |
| Antibody | anti-Vipp2 (rabbit, polyclonal) | developed during this study | (1:3000) | |
| Antibody | anti-FLAG (mouse, monoclonal) | Sigma | F1804 | (1:3000 for IB; 1:500 for IF) |
| Antibody | anti-Hsp22E/F (rabbit, polyclonal) | gift from Michael Schroda | (1:10000) | |
| Antibody | anti-DnaK (rabbit, polyclonal) | gift from Jean David Rochaix | (1:10000) | |
| Antibody | anti-α tubulin (rabbit, polyclonal) | Sigma | T5168 | (1:10000) |
| Antibody | anti-Histone H3 (rabbit, polyclonal) | Agrisera | AS10 710 | (1:10000 for IB; 1:500 for IF) |
| Antibody | anti-AtpD (rabbit, polyclonal) | Agrisera | AS10 1590 | (1:500) |
| Antibody | anti-Nab1 (rabbit, polyclonal) | Agrisera | AS08 333 | (1:500) |
| Antibody | anti-AtpD (rabbit, polyclonal) | Agrisera | AS10 1590 | (1:500) |
| Antibody | anti-RpoA (rabbit, polyclonal) | gift from Jean David Rochaix | (1:10000) | |
| Antibody | anti-holo Rubisco (rabbit, polyclonal) | gift from Jean David Rochaix | (1:10000) | |
| Antibody | anti-Aox1 (rabbit, polyclonal) | Agrisera | AS06 152 | (1:2000) |
| Antibody | anti-Sultr2 (rabbit, polyclonal) | gift from Arthur Grossman | (1:3000) | |
| Antibody | anti-Hsp90 (rabbit, polyclonal) | Agrisera | AS06 174 | (1:10000) |
| Commercial assay or kit | KOD Hot Start DNA Polymerase | ThermoFisher Scientific | 71086–3 | |
| Commercial assay or kit | Phusion High-Fidelity DNA Polymerase | ThermoFisher Scientific | F530L | |
| Commercial assay or kit | PureYield Plasmid Miniprep System | Promega | A1222 | |
| Commercial assay or kit | NucleoSpin Gel and PCR Clean-up | Clontech | 740609 | |
| Commercial assay or kit | Direct-zol RNA Miniprep Plus | Zymo Research | R2070 | |
| Commercial assay or kit | Alexa Fluor 488 Tyramide SuperBoost Kit, goat anti-mouse IgG | ThermoFisher Scientific | B40941 | |
| Commercial assay or kit | In-Fusion HD cloning plus | Takara | 638910 | |
| Commercial assay or kit | CircLigase II ssDNA | Epicentre | CL9025K | |
| Commercial assay or kit | PrimeScript 1 st strand cDNA Synthesis Kit | Takara | 6110A | |
| Commercial assay or kit | iQ SYBR Green Supermix - Bio-Rad | Bio-Rad | 170–8880 | |
| Commercial assay or kit | Dynabeads kilobase Binder Kit | Invitrogen | 60101 | |
| Commercial assay or kit | Kapa mRNA HyperPrep kit | Roche | KK8540 | |
| Commercial assay or kit | PrepX DNA Library Kit (400075) | Takara | 640101 | |
| Commercial assay or kit | SuperSignal West Femto | ThermoFisher Scientific | 34095 | |
| Commercial assay or kit | SuperSignal West Dura | ThermoFisher Scientific | 34075 | |
| Chemical compound, drug | N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt | Sigma | D0627 | |
| Chemical compound, drug | Thiamine hydrochloride | Sigma | T4625 | |
| Chemical compound, drug | Vitamin B12 | Sigma | V6629 | |
| Chemical compound, drug | digitonin, high purity | Calbiochem | 300410 | |
| Chemical compound, drug | Metronidazole | Sigma | M3761 | |
| Software, algorithm | Sequence Data Analysis | Geneious | ||
| Software, algorithm | Sequence Data Analysis | Snapgene | ||
| Software, algorithm | Microscopy imaging interface | Zeiss | ZEN | |
| Software, algorithm | Image processing | NIH | ImageJ | |
| Other | electroporation system | Biorad | Gene Pulser II | |
| Other | electroporation system | Nepagene | Nepa21 | |
| Other | colony picker | Norgren Systems | CP7200 | |
| Other | colony manipulation robot | Singer | Rotor HAD | |
| Other | Fluorescence scanner | GE Healthcare | Typhoon Trio | |
| Other | Protran NitrocelluloseHybridization Transfer Membrane | Perkin Elmer | NBA083C001EA | |
| Other | Imaging system | LI-COR Biosciences | Odyssey CLx | |
| Other | Plant LED Grow Light | Phlizon 2017 | 2000W | |
| Other | Smart Sensor | Wifi Gateway | G1 | |
| Other | Smart Sensor | Sensor Push | HT1 |
Table 1
Strains table.
| CrPW number | Strain name | Short description | Reference |
|---|---|---|---|
| CC-4533 | parental strains used to generate mars1-3 and mars1-4 | (Li et al., 2016) | |
| CC-124 | wild-type used for mars1-1 and mars1-2 genetic backcrosses | (available at the Chlamydomonas Resource Center) | |
| A31 | parental strain of DCH16 | (Ramundo et al., 2013) | |
| DCH16 | ClpP1 repressible strain | (Ramundo et al., 2013) | |
| CrPW1 | A1N5 | cpUPR reporter strain | (generated during this study) |
| CrPW2 | ACT C6 | YFP positive strain | (generated during this study) |
| CrPW3 | DRB1 | YFP positive strain | (generated during this study) |
| CrPW4 | mars1-1 | Cre16.g692228 mutant allele | (generated during this study) |
| CrPW5 | mars1-2 | Cre16.g692228 mutant allele*-Full genotype described below | (generated during this study) |
| CrPW6 | mars1-3 | (available at the Chlamydomonas Resource Center) | Cre16.g692228 mutant allele Clip ID: LMJ.RY0402.195536 |
| CrPW7 | mars1-4 | (available at the Chlamydomonas Resource Center) | Cre16.g692228 mutant allele Clip ID: LMJ.RY0402.189144 |
| CrPW8 | E12 | wild-type like progeny from backcross of mars1-1 to CC124 (used for RNA-seq analysis) | (generated during this study) |
| CrPW9 | F2 | MARS1 mutant progeny from backcross of mars1-1 to CC124 (used for RNA-seq analysis) | (generated during this study) |
| CrPW10 | D2C4 | wild-type like progeny from backcross of mars1-2 to CC124 (used for complementation analysis)† | (generated during this study) |
| CrPW11 | D2C3 | MARS1 mutant progeny from backcross of mars1-2 to CC124 (used for complementation analysis)† | (generated during this study) |
| CrPW12 | M22 | mars1-3:MARS1-A strain | (generated during this study) |
| CrPW15 | FMW14 | mars1-3:MARS1-D strain | (generated during this study) |
| CrPW16 | KDM14 | mars1-3:MARS1-A KD strain | (generated during this study) |
| CrPW17 | FMD17 | mars1-3:MARS1-D KD strain | (generated during this study) |
| CrPW18 | 189 N25 | mars1-1:MARS1-A strain | (generated during this study) |
| CrPW19 | FKD7 | mars1-1:MARS1-D strain | (generated during this study) |
| CrPW20 | pKP29 B30 | mars1-1:MARS1-D KD strain | (generated during this study) |
| CrPW21 | pKP30 D7 | mars1-1:MARS1-D KD strain | (generated during this study) |
| CrPW22 | DCM2 | mars1-2:MARS1-A strain | (generated during this study) |
| CrPW23 | DCM5 | mars1-2:MARS1-A strain | (generated during this study) |
| CrPW24 | DCM10 | mars1-2:MARS1-A strain | (generated during this study) |
| CrPW25 | DCM19 | mars1-2:MARS1-A strain | (generated during this study) |
| CrPW26 | DCM21 | mars1-2:MARS1-A strain | (generated during this study) |
| CrPW27 | W153 | CC-4533 transformed withMARS1-E transgene, strain (a) | (generated during this study) |
| CrPW28 | W155 | CC-4533 transformed withMARS1-E transgene, strain (b) | (generated during this study) |
| CrPW29 | WKD4 | CC-4533 transformed withMARS1-E KD transgene, strain (a) | (generated during this study) |
| CrPW30 | WKD16 | CC-4533 transformed with MARS1-E KD transgene, strain (a) | (generated during this study) |
| CrPW31 | WFM2 | CC-4533 transformed withMARS1-D transgene, strain (a) | (generated during this study) |
| CrPW43 | ire1 | Cre08.g371052 mutant allele Clip ID: LMJ.RY0402.122895 | (available at the Chlamydomonas Resource Center) |
| CrPW44 | snrk2 | Cre02.g075850 mutant allele Clip ID: LMJ.RY0402.187019 | (available at the Chlamydomonas Resource Center) |
-
*mars1-2 has a total of three mapped genomic disruptions.
1The chromosome 16 deletion which encompasses Cre16.g692228 (MARS1), Cre16.g692340, and Cre16.g692452.
-
2The full Paromomycin cassette was found in an intergenic region on chromosome 7, 958 bp downstream of gene Cre07.g336300. A portion of a gene- Cre02.g108450 (5’UTR-intron 4) was found directly upstream of this Paromomycin cassette (in intergenic region of Chromosome 7).
3The locus for the Cre02.g108450 gene itself has a deletion spanning the 5’UTR-intron 4.
-
†D2C3 and D2C4 were offspring isolated upon backcrossing mars1-2 to CC-124 three times. D2C4 contains the wild-type MARS1 gene whereas D2C3 contains the MARS1 deletion. In both strains, all other markers (Hygromycin,Paromomycin, and Spectinomycin) as well as the abovementioned Cre02.g108450 deletion were crossed out.
Table 2
Plasmids Table.
| Plasmid name (nickname/official name) | Used for | Reference |
|---|---|---|
| pLM005 | for amplification of theYFP coding sequence | (Mackinder et al., 2016) |
| pHyg3 | for amplification of the RBCS2 3'UTR sequence and cloning of the Hygromycin resistance cassette | (Berthold et al., 2002) |
| pMJ016c | for insertional mutagenesis | (Li et al., 2016) |
| pRAM118/pPW3216 | for gene tagging and subcloning | (Li et al., 2019) |
| pRAM103.5/pPW3217 | For generation of the cpUPR reporter strain | (generated during this study) |
| pRAM185.2/pPW3218 | For MARS1 cloning (untagged MARS1 transgene) | (generated during this study) |
| pRAM189 M2/pPW3219 | For MARS1 cloning (MARS1-A transgene) | (generated during this study) |
| pKP29 /pPW3222 | For MARS1 cloning (MARS1-D transgene) | (generated during this study) |
| pRAM184.1 /pPW3223 | For MARS1 cloning (MARS1-E transgene) | (generated during this study) |
| pHT20.1/pPW3224 | For MARS1 cloning (catalytically-dead MARS1-A transgene) | (generated during this study) |
| pKP30/pPW3225 | For MARS1 cloning (catalytically-dead MARS1-D transgene) | (generated during this study) |
| pHT6/pPW3226 | For MARS1 cloning (catalytically-dead MARS1-E transgene) | (generated during this study) |
Table 3
Primers Table.
| Primer name | 5'-->3' sequence |
|---|---|
| oMJ598 | b-CAGGCCATGTGAGAGTTTGC (b = biotinylated) |
| oMJ619 | /5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTACTCAGTAGTTGTGCGATGGATTGATG/3ddc/ (/5Phos/=phosphorylated;/3ddc/=dideoxycytidine (to prevent self-ligation) |
| oMJ621 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| oMJ1234 | b-GCAGCCAAACCAGGATGATG (b = biotinylated) |
| oMJ1239 | aattaaccctcactaaagCAATCATGTCAAGCCTCAGC |
| T3_3'_oMJ016c 11/23 | aattaaccctcactaaagGGTCGAGCCTTCTGGCAGA |
| T3_5'_oMJ016c 11/24 | aattaaccctcactaaaggGCGGAGACGTGTTTCTGAC |
| SR502 | tgctcaccatACTAGTGAGCACGCTGCGA |
| SR503 | gctcactagtATGGTGAGCAAGGGCGAG |
| SR504 | gggatccttaagatctTTACTTGTCGTCATCGTCCTT |
| SR505 | cgacaagtaaagatctTAAGGATCCCCGCTCCGTG |
| SR506 | gcgcaagaaagaagcttgatatcCGCTTCAAATACGCCCAGC |
| SR510 | atgtggcggccgcTGGAAAAGCGTTTCGGAAGG |
| SR773 | CGCCTTTAAAGCTGAAGTGG |
| SR789 | CAGCTGCGTCTCCGTTTGC |
| SR793 | CCTTCACCATTTAAGACGGAGCAGTAAACAGTTGCTG |
| SR797 | CTGCTCCGTCTTAAATGGTG |
| SR818 | CGGCATGCCGCTACCCGC |
| SR819 | GGGTAGCGGCATGCCGCC |
| SR828 | tttgctcacatgtggcggccgcCAGCCCTGTACACCAGCTC |
| SR829 | gcgcaagaaagaagcttgatATCTCGGCGCCAGGTTTAC |
| SR834 | ccatatcgaaggtcgtcatatgATGGCAATCGCAGACGCTG |
| SR835 | gctttgttagcagccggatctcaGCCGAGGACGGTCATCAG |
| SR836 | GACGTCATCCACTGCCTGTG |
| SR837 | CGACGCATCCTCAACACACC |
| SR851 | TGTGCGCCTTCAATTTGAGC |
| SR852 | GCTCAAATTGAAGGCGCACA |
| SR853 | TAGCCCTTCGTTACCATCGTC |
| HT7 | GCAAACGGAGACGCAGCTG |
| KP235 | CTCCATCACAATTGCCTGCA |
| KP337 | GTGTGGTCGGGCCGTCTAGAA |
| KP342 | TGGTCCGCCGGAACAGATCTTCC |
| KP344 | CTTGTCGTCATCGTCCTTGTAGTCGATGTCGTGATCCTTATAGTCACCGTCATGGTCCTTGTAGTCCATGCCGCTACCCGCCCCA |
| KP345 | GGACGATGACGACAAGGGCAGCAGCCCGCCCAGCCCTTGTAGCAGCAG |
| KP346 | GTCAGCCCTGTTCTGCCC |
| KP347 | AACCCTAAACCCGCTGG |
| qRT_SULTR2_Fw | ACGTGGCATGCAGCTCAT |
| qRT_SULTR2_Rv | CTTGCCACTTTGCCAGGT |
| qRT_LHCBM9_Fw | TGGTGGTGCTTTCCCTTCAGAC |
| qRT_LHCBM9_Rv | TGGACACAACTGCAGGCTTTGC |
| qRT_HSP22F_Fw | TGCGCACGCGACATTATCAAAG |
| qRT_HSP22F_Rv | GTACAAACCAGCATGCGCTCAG |
| qRT_VIPP2_Fw | CATCATGCATTTGGCAGGCTCTC |
| qRT_VIPP2_Rv | AATGAGAGGTGCGACGACCAAC |
| qRT_SNOAL_Fw | TGCTGTGGGCAACTGTGCATAC |
| qRT_SNOAL_Rv | TCCGTGCTTGACGCTACCATTC |
| qRT_LHCSR3.1_Fw | CACAACACCTTGATGCGAGATG |
| qRT_LHCSR3.1_Rv | CCGTGTCTTGTCAGTCCCTG |
| qRT_PSBS1_Fw | TAAACCGTGTATTGGAACTCCG |
| qRT_PSBS1_Rv | CTCTGCACGCGGCGTGTT |
| qRT_CPLD29_Fw | AACCGGGTCTTCTTCGCCTTTG |
| qRT_CPLD29_Rv | GTGTGCCGCCATTCCAAAGAAC |
| qRT_GBLP_Fw | CAAGTACACCATTGGCGAGC |
| qRT_GBLP_Rv | CTTGCAGTTGGTCAGGTTCC |
Additional files
-
Source code 1
ImageJ macroscripts used to process and quantify YFP fluorescence and growth area of candidate mutant colonies on 384-well arrays.
- https://cdn.elifesciences.org/articles/49577/elife-49577-code1-v2.docx
-
Supplementary file 1
Detailed information about peptide spectra sequences and post-translation modifications detected in Mars1 protein upon metronidazole treatment.
- https://cdn.elifesciences.org/articles/49577/elife-49577-supp1-v2.xlsx
-
Supplementary file 2
Average RPKM values for all Chlamydomonas transcripts in WT and mars1-1 mutant upon high light exposure (for 40 min or 70 min) or ClpP1 down-regulation for 68 hr.
- https://cdn.elifesciences.org/articles/49577/elife-49577-supp2-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/49577/elife-49577-transrepform-v2.pdf
