Mannose receptor is an HIV restriction factor counteracted by Vpr in macrophages
- Department of Microbiology and Immunology, University of Michigan, United States
- Cellular and Molecular Biology Program, University of Michigan, United States
- Department of Internal Medicine, University of Michigan, United States
- Graduate Program in Immunology, University of Michigan, United States
- University of Michigan, United States
Figures
Figure 1 with 1 supplement
HIV Vpr reduces steady state levels of host mannose receptor in MDM and increases steady state levels of viral Env protein.
(A) Diagram of the HIV 89.6 proviral genome. The shaded box shows the location of vpr, which was disrupted by a frame shift mutation to create the Vpr-null version (Mashiba et al., 2014). HIV-1 89.6 …
Figure 1—figure supplement 1
HIV Vpr reduces steady state levels of MR but not GBP5, STING or IFITM3.
(A) Western blot analysis of whole cell lysates from MDM infected with wild-type or vpr-null HIV-1 89.6 for 10 days. (B) Western blot analysis of whole cell lysates from MDM infected with wild-type …
Figure 2 with 1 supplement
Combined effects of Nef and Vpr completely remove MR from a significant proportion of infected cells at early time points.
(A) Diagram of HIV NL4-3 ∆GPE-GFP. (B) Western blot analysis of whole cell lysates from 293T cells transfected with the indicated viral expression construct. (C) Flow cytometry plots indicating the …
Figure 2—figure supplement 1
HIV Vpr reduces steady state levels of UNG2 but not MR in co-transfected 293T cells.
(A) Flow cytometric plots of 293T cells co-transfected with NL4-3 ∆GPE-GFP, pCDNA3.1-hMR, and pMSCV 3x FLAG UNG2 IRES-GFP as indicated. (B) Western blot analysis of 293T cells co-transfected exactly …
Figure 3 with 1 supplement
Vpr reduces transcription of MRC1.
(A) Diagram of HIV NL4-3 ∆GPE-GFP. (B) Flow cytometry plots indicating the gating strategy used to sort live GFP+ vs GFP- cells for subsequent qPCR analysis. (C) Summary graph of mannose receptor (MR…
Figure 3—figure supplement 1
Vpr reduces transcription of MRC1.
(A) Summary graph of mannose receptor (MRC1), RNA Polymerase 2A (POL2A) and GAPDH mRNA expression in MDM transduced with Vpr-competent or Vpr-null HIV NL4-3 ∆GPE-GFP and sorted for GFP expression by …
Figure 4
Combined effect of Vpr and Nef dramatically enhances Env levels in primary human MDM.
(A) Western blot analysis of whole cell lysate from 293T transfected with the indicated HIV construct. (B) Summary graph of virion release from 293T cells transfected as in A and measured by Gag p24 …
Figure 5 with 1 supplement
HIV YU2, which lacks a mannose-rich patch, does not require Vpr for robust Env protein expression and spread in MDM.
(A) Virion release over time by primary human MDM infected with the indicated HIV as measured by ELISA (n = 2 independent donors). (B) Western blot analysis of whole cell lysates from MDM infected …
Figure 5—figure supplement 1
Raw p24 ELISA and intracellular Gag stain data following infection by NL4-3 envYU2.
(A) Summary graph shoing Gag p24 concentration of supernatant from MDM cultures 10 days post infection with the indicated virus. (B) Summary graph showing the fraction of MDM that are Gag+ 10 days …
Figure 6 with 1 supplement
Deletion of N-linked glycosylation sites in env reduces the requirement for Vpr and Nef for virion release and Env expression in HIV-1 infected primary human MDM.
(A) Upper panel, diagram of HIV genome encoding the mutations N230D and N339E (indicated in red) to prevent N-linked glycosylation at those sites. Lower panel, diagram of HIV 89.6 N230D N339E mutant …
Figure 6—figure supplement 1
Raw p24 ELISA and intracellular Gag stain data following infection by 89.6 N230D N339E.
(A) Summary graph showing Gag p24 concentration of supernatant from MDM cultures 10 days post infection with the indicated virus, which were allowed to spread in culture. Data correspond to Figure 6G…
Figure 7 with 1 supplement
Knockdown of MR enhances Env expression and spread to T cells in vpr-null infection of MDM.
(A) Western blot analysis of MDM from two independent donors treated with the indicated silencing vector and infected with the indicated HIV for 10 days. The shRNA sequences encoded by the negative …
Figure 7—figure supplement 1
Cell-to-cell infection from macrophages to autologous CD4+ T cells is highly efficient and enhanced by Vpr.
(A) Diagram of the MDM and T cell co-culture experiments depicted in parts B, D, and E. (B) Representative flow cytometric plots and gating strategy used to identify MDM and T cells in co-culture …
Tables
Key resources table
| Reagent type (species) | Designation | Source or reference | Identifiers | Additional Information |
|---|---|---|---|---|
| Recombinant DNA reagent | p89.6 | Collman et al. (1992) PMID: 1433527 | NIH AIDS Reagent Program 3552 | |
| Recombinant DNA reagent | p89.6 vpr-null | Mashiba et al. (2014); PMID 25464830 | ||
| Recombinant DNA reagent | p89.6 nef-null | Carter et al. (2010); PMID 20208541 | ||
| Recombinant DNA reagent | p89.6 vpr-nef-null | this paper | Produces HIV 89.6 vpr-nef-null double mutant | |
| Recombinant DNA reagent | p89.6 env N230D N339E | this paper | Produces HIV 89.6 env N230D N339E mutant | |
| Recombinant DNA reagent | p89.6 env N230D N339E vpr-null | this paper | Produces HIV 89.6 env N230D N339E vpr-null mutant | |
| Recombinant DNA reagent | p89.6 env N230D N339E vpr-nef-null | this paper | Produces HIV 89.6 env N230D N339E vpr-nef-null mutant | |
| Recombinant DNA reagent | pNL4-3 | Adachi et al. (1986); PMID 3016298 | NIH AIDS Reagent Program 114 | |
| Recombinant DNA reagent | pNL4-3 envYU2 | this paper | Produces HIV NL4-3 envYU2 chimera | |
| Recombinant DNA reagent | pNL4-3 envYU2vpr-null | this paper | Produces HIV NL4-3 envYU2vpr-null chimera | |
| Recombinant DNA reagent | pHCMV-G | ATCC | 75497 | Expresses VSV-G |
| Recombinant DNA reagent | pCMV-HIV-1 | Gasmi et al., 1999; PMID 9971760 | Expresses HIV structural proteins | |
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP | McNamara et al. (2012); PMID 22718820 | ||
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP vpr-null | this paper | Produces NL4-3 ∆GPE vpr-null | |
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP vpr-Q65R | this paper | Produces NL4-3 ∆GPE vpr-Q65R | |
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP nef-null | this paper | Produces NL4-3 ∆GPE nef-null | |
| Recombinant DNA reagent | pNL4-3 ∆GPE-GFP vpr-nef-null | this paper | Produces NL4-3 ∆GPE vpr-nef-null | |
| Recombinant DNA reagent | pYU2 | Li et al. (1991); PMID 1830110 | NIH AIDS Reagent Program 1350 | |
| Recombinant DNA reagent | pYU2 vpr-null | this paper | Produces YU-2 vpr-null | |
| Recombinant DNA reagent | pREJO.c/2864 | Ochsenbauer et al. (2012); PMID 22190722 | NIH AIDS Reagent Program 11746 | |
| Recombinant DNA reagent | pREJO.c/2864 vpr-null | this paper | Produces REJO vpr-null | |
| Recombinant DNA reagent | pSIV3+ | Pertel et al. (2011); PMID 21696578 | ||
| Recombinant DNA reagent | pSIV3+ vpr-null | this paper | Produces SIV3+ vpr-null | |
| Recombinant DNA reagent | pSPAX2 | Pertel et al. (2011); PMID 21696578 | ||
| Recombinant DNA reagent | pAPM-1221 | Pertel et al. (2011); PMID 21696578 | Silences luciferase mRNA | |
| Recombinant DNA reagent | pAPM-MRC1-C | this paper | Silences MR mRNA | |
| Recombinant DNA reagent | pMD2.G | Pertel et al. (2011); PMID 21696578 | Expresses VSV-G | |
| Recombinant DNA reagent | pYU2 env | Sullivan et al. (1995); PMID 7769703 | ||
| Recombinant DNA reagent | pCDNA3.hMR | Liu et al. (2004); PMID 15047828 | Expresses MR | |
| Recombinant DNA reagent | pPROA-3FLAG-UNG2-EYFP | Akbari et al. (2010); PMID 20466601 | ||
| Recombinant DNA reagent | pMSCV IRES-GFP | Van Parijs et al., 1999; PMID 10514006 | ||
| Recombinant DNA reagent | pMSCV 3xFLAG UNG2 IRES-GFP | this paper | Expresses 3x FLAG-tagged UNG2 | |
| Recombinant DNA reagent | pUC19 | Norrander et al. (1983); PMID 6323249 | ||
| Chemical compound, drug | Ficoll-Paque Plus | GE Healthcare | 17-1440-02 | |
| Chemical compound, drug | rhM-CSF | R and D Systems | 216-MC-025/CF | |
| Chemical compound, drug | rhGM-CSF | R&D Systems | 215 GM-050 | |
| Chemical compound, drug | IL-2 | R&D Systems | 202-IL-010 | |
| Chemical compound, drug | phytohaemagglutinin-L | Calbiohem | 431784 | |
| Chemical compound, drug | Enzyme-free cell dissociation buffer, HBSS-based | ThermoFisher | 13150016 | |
| Chemical compound, drug | Blue loading buffer | Cell Signaling Technology | 7722 | |
| Chemical compound, drug | AMD3100 | Hendrix et al., 2000; PMID 10817726 | NIH AIDS Reagent Program 8128 | |
| Chemical compound, drug | Maraviroc | Emmelkamp and Rockstroh, 2007; PMID 17933722 | NIH AIDS Reagent Program 11580 | |
| Chemical compound, drug | streptavidin-HRP | Fitzgerald | 65R-S104PHRP | |
| Chemical compound, drug | 3,3',5,5'-tetramethylbenzidine | Sigma | T8665-IL | |
| Chemical compound, drug | Gag p24 standard | ViroGen | 00177 V | |
| Chemical compound, drug | Protein G Column | GE Healthcare | 45-000-054 | |
| Commercial assay, kit | Q5 site-directed mutagenesis kit | New England Biolabs | E0554S | |
| Commercial assay, kit | EasySep Human CD14 Positive Selection Kit II | Stemcell Technologies | 17858 | |
| Commercial assay, kit | CD8 Dynabeads | ThermoFisher | 11147D | |
| Commercial assay, kit | RNeasy micro RNA isolation kit | Qiagen | 74004 | |
| Commercial assay, kit | qScript cDNA Supermix | Quantabio | 95048 | |
| Commercial assay, kit | TaqMan Gene Expression Master Mix | ThermoFisher | 4369016 | |
| Commercial assay, kit | EZ-link Micro Sulfo-NHS-Biotinylation kit | ThermoFisher | PI-21925 | |
| Sequence-based reagent | 896 dNef-F | this paper | PCR primer | CACCATTATCGTTTCAGACCCT |
| Sequence-based reagent | 896 dNef-R | this paper | PCR primer | TCTCGAGTTTAAACTTAT AGCAAAGCCCTTTCCA |
| Sequence-based reagent | NL43 vprQ65R-Forward | this paper | PCR primer | AGAATTCTGCGACAACTGCTG |
| Sequence-based reagent | NL43 vprQ65R-Reverse | this paper | PCR primer | TATTATGGCTTCCACTCC |
| Sequence-based reagent | 3xFLAG UNG2 F | this paper | PCR primer | CTAGCTCGAGACCATGGACT ACAAAGACCATGAC |
| Sequence-based reagent | 3xFLAG UNG2 R | this paper | PCR primer | GTTAACTCACAGCTCCTTC CAGTCAATGGGCTT |
| Sequence-based reagent | GeneExpression assay for ACTB | ThermoFisher | Hs99999903 | |
| Sequence-based reagent | GeneExpression assay for MRC1 | ThermoFisher | Hs00267207 | |
| Sequence-based reagent | GeneExpression assay for POL2A | ThermoFisher | Hs02786624 | |
| Sequence-based reagent | GeneExpression assay for GAPDH | ThermoFisher | Hs00172187 | |
| Sequence-based reagent | APM-MRC1-C Forward oligo | Sigma | DNA oligo | TCGAGAAGGTATATTGCT GTTGACAGTGAGCGAGTA ACTTGACTGATAATCAATT AGTGAAGCCACAGATGTA ATTGATTATCAGTCAAGTT ACTTGCCTACTGCCTCGG |
| Sequence-based reagent | APM-MRC1-C Reverse oligo | Sigma | DNA oligo | AATTCCGAGGCAGTAGGC AAGTAACTTGACTGATAA TCAATTACATCTGTGGCT TCACTAATTGATTATCAG TCAAGTTACTCGCTCACT GTCAACAGCAATATACCTTC |
| Biological sample (Homo sapiens) | Buffy coats/LeukoPaks | New York Blood Center | Buffy coats made from whole blood | |
| Biological sample (adenovirus) | Adeno-nef | Leonard et al. (2011); PMID 21543478 | ||
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-3216 | |
| Cell line (Mus musculus) | anti-gp41 hybridoma CHESSIE-8 | Abacioglu et al. (1994); PMID 8068416 | NIH AIDS Reagent Program 526 | Purified ab used for WB (2 µg/mL) |
| Cell line (Mus musculus) | anti-p24 hybridoma 183-H12-5C | NIH AIDS Reagent Program | 1513 | Purified ab used for ELISA (1 µg/mL) |
| Cell line (Mus musculus) | anti-p24 hybridoma 31-90-25 | ATCC (discontinued) | HB-9725 | Purified ab used for ELISA (0.5 µg/mL) |
| Antibody | anti-mannose receptor-PE (mouse monoclonal) | Becton Dickinson | clone 19.2 cat# 555954 | FC (1 µL per test) |
| Antibody | anti-Gag CA p24-PE (mouse monoclonal) | Beckman Coulter | clone KC57 cat# 6604667 | FC (0.25 µL per test) |
| Antibody | anti-Gag CA p24-FITC (mouse monoclonal) | Beckman Coulter | clone KC57 cat# 6604665 | FC (0.25 µL per test) |
| Antibody | anti-FLAG (mouse monoclonal) | Sigma | clone M2 cat# F3165 | FC (1 µL per test), WB (1:1000) |
| Antibody | anti-CD4-APC (mouse monoclonal) | ThermoFisher | clone OKT4 cat# 17-0048-42 | FC (1 µL per test) |
| Antibody | anti-CD3-PacBlue (mouse monoclonal) | BioLegend | clone OKT3 cat# 317313 | FC (1 µL per test) |
| Antibody | anti-CD14-APC (mouse monoclonal) | BioLegend | clone HCD14 cat# 325608 | FC (1 µL per test) |
| Antibody | anti-mannose receptor (rabbit polyclonal) | Abcam | ab64693 | WB (1:1000) |
| Antibody | anti-rabbit-AF647 (goat polyclonal) | ThermoFisher | A21244 | WB (1:4000) |
| Antibody | anti-GAPDH (mouse monoclonal) | Abnova | clone 3C2 cat# H00002597-M01 | WB (1:2000) |
| Antibody | anti-mouse IgG1-AF647 (goat polyclonal) | ThermoFisher | A21240 | FC (1 µL per test), WB (1:4000) |
| Antibody | HIV-Ig (human polyclonal) | Cummins et al. (1991); PMID 1995097 | NIH AIDS Reagent Program 3957 | WB (1:2000) |
| Antibody | anti-human-AF647 (goat polyclonal) | ThermoFisher | A21445 | WB (1:4000) |
| Antibody | anti-gp120 (sheep polyclonal) | Hatch et al., 1992; PMID 1374448 | NIH AIDS Reagent Program 288 | WB (1:1000) |
| Antibody | anti-sheep-HRP (rabbit polyclonal) | Dako | P0163 | WB (1:20,000) |
| Antibody | anti-gp41 (human monoclonal) | Zwick et al. (2001); PMID 11602729 | NIH AIDS Reagent Program 11557 | WB (1:1000) |
| Antibody | anti-human (goat polyclonal) | ThermoFisher | 62–8420 | WB (1:10,000) |
| Antibody | anti-Nef (rabbit polyclonal) | Shugars et al. (1993); PMID 8043040 | NIH AIDS Reagent Program 2949 | WB (1:1000) |
| Antibody | anti-Vpr (rabbit polyclonal) | Dr. Jeffrey Kopp | NIH AIDS Reagent Program 11836 | WB (1:1000) |
| Antibody | anti-rabbit (goat polyclonal) | ThermoFisher | 65–6120 | WB (1:10,000) |
| Antibody | anti-GFP (chicken polyclonal) | Abcam | ab13970 | WB (1:1000) |
| Antibody | anti-chicken-HRP (goat polyclonal) | ThermoFisher | A16054 | WB (1:10,000) |
| Antibody | anti-STING (rabbit monoclonal) | Cell Signaling Technology | clone D2P2F cat# 13647 | WB (1:500) |
| Antibody | anti-GBP5 (goat polyclonal) | Dr. Frank Kicrhhoff | sc-160353 | WB (1:500) |
| Antibody | anti-IFITM3 (rabbit polyclonal) | Proteintech | 11714–1-AP | WB (1:1000) |
| Antibody | anti-Env 2G12 (human monoclonal) | Buchacher et al. (1994); PMID 7520721 | NIH AIDS Reagent Program 1476 | neutralization (1 µg/mL) |
| Software, algorithm | FlowJo 10 | BD | 10.6.1 | |
| Software, algorithm | ABI Sequence Detection Software | ThermoFisher | 1.4 | |
| Software, algorithm | ImageQuant TL | GE | 8.2.0 | |
| Software, algorithm | Photoshop CC | Adobe | 20.0.6 | |
| Software, algorithm | shRNA retriever | http://katahdin.mssm.edu/siRNA/RNAi.cgi?type=shRNA |
Additional files
-
Supplementary file 1
Key resources table.
- https://cdn.elifesciences.org/articles/51035/elife-51035-supp1-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/51035/elife-51035-transrepform-v1.docx
