1. Immunology and Inflammation
  2. Microbiology and Infectious Disease
Download icon

Mannose receptor is an HIV restriction factor counteracted by Vpr in macrophages

  1. Jay Lubow
  2. Maria C Virgilio
  3. Madeline Merlino
  4. David R Collins
  5. Michael Mashiba
  6. Brian G Peterson
  7. Zana Lukic
  8. Mark M Painter
  9. Francisco Gomez-Rivera
  10. Valeri Terry
  11. Gretchen Zimmerman
  12. Kathleen L Collins  Is a corresponding author
  1. Department of Microbiology and Immunology, University of Michigan, United States
  2. Cellular and Molecular Biology Program, University of Michigan, United States
  3. Department of Internal Medicine, University of Michigan, United States
  4. Graduate Program in Immunology, University of Michigan, United States
  5. University of Michigan, United States
Research Article
  • Cited 4
  • Views 1,050
  • Annotations
Cite this article as: eLife 2020;9:e51035 doi: 10.7554/eLife.51035


HIV-1 Vpr is necessary for maximal HIV infection and spread in macrophages. Evolutionary conservation of Vpr suggests an important yet poorly understood role for macrophages in HIV pathogenesis. Vpr counteracts a previously unknown macrophage-specific restriction factor that targets and reduces the expression of HIV Env. Here, we report that the macrophage mannose receptor (MR), is a restriction factor targeting Env in primary human monocyte-derived macrophages. Vpr acts synergistically with HIV Nef to target distinct stages of the MR biosynthetic pathway and dramatically reduce MR expression. Silencing MR or deleting mannose residues on Env rescues Env expression in HIV-1-infected macrophages lacking Vpr. However, we also show that disrupting interactions between Env and MR reduces initial infection of macrophages by cell-free virus. Together these results reveal a Vpr-Nef-Env axis that hijacks a host mannose-MR response system to facilitate infection while evading MR’s normal role, which is to trap and destroy mannose-expressing pathogens.

eLife digest

Human cells have defense mechanisms against viral infection known as restriction factors. These are proteins that break down parts of a virus including its DNA or proteins. To evade these defenses, viruses in turn make proteins that block or break down restriction factors. This battle between human and viral proteins determines which types of cells are infected and how quickly a virus can multiply and spread to new cells.

HIV produces a protein called Vpr that counteracts a restriction factor found in immune cells called macrophages. However, the identity of the restriction factor targeted by Vpr is a mystery. When Vpr is missing, this unknown restriction factor breaks down a virus protein called Env. Env is a glycoprotein, which is a protein with sugars attached. When Env levels are low, HIV cannot spread to other cells and multiply. Identifying the restriction factor that breaks down Env may lead to new ways of treating and preventing HIV infections.

Now, Lubow et al. reveal that the unknown restriction factor in macrophages is a protein called the mannose receptor. This protein binds and destroys proteins containing mannose, a type of sugar found on bacteria and some viruses. The experiments revealed that the mannose receptor grabs mannose on the HIV protein Env. This causes Env to be broken down and stops HIV from spreading.

Lubow et al. also find that Vpr works with another protein produced by HIV called Nef to reduce the number of mannose receptors on macrophages. The two proteins do this by targeting different steps in the assembly of mannose receptors, allowing the virus to multiply and spread more efficiently. The experiments suggest that drugs that simultaneously block Vpr and Nef might prevent or suppress HIV infections. More studies are needed to develop and test potential HIV-treatments targeting Vpr and Nef.


Vpr is a highly conserved HIV accessory protein that is necessary for optimal replication in macrophages (Balliet et al., 1994) but its mechanism of action is poorly understood. Studies using human lymphoid tissue (HLT), which are rich in both T cells and macrophages, have found that loss of Vpr decreases virus production (Rucker et al., 2004) but only when the virus strain used is capable of efficiently infecting macrophages (Eckstein et al., 2001). These studies provide evidence that Vpr enhances infection of macrophages and increases viral burden in tissues where macrophages reside. Because Vpr is packaged into the virion (Cohen et al., 1990) and localizes to the nucleus (Lu et al., 1993), it may enhance early viral replication events. However, in mononuclear phagocytes vpr-null virus in which Vpr protein is provided by trans-complementation in the producer cells replicates poorly compared to wild-type virus (Connor et al., 1995), indicating that Vpr’s role in the HIV replication cycle continues into late stages.

Previous work by our group demonstrated that Vpr counteracts an unidentified macrophage-specific restriction factor that targets Env and Env-containing virions for lysosomal degradation (Mashiba et al., 2014; Collins et al., 2015). This restriction could be conferred to permissive 293T cells by fusing them with MDM to create 293T-MDM heterokaryons. A follow up study demonstrated that by increasing steady state levels of Env, Vpr increases formation of virological synapses between infected MDM and autologous uninfected T cells, enhancing HIV infection of T cells (Collins et al., 2015). This enhances spread to T cells and dramatically increases levels of Gag p24 in the culture supernatant. This finding helps explain the paradoxical observations that Vpr is required for maximal infection of T cells in vivo (Hoch et al., 1995) but numerous studies have shown Vpr only marginally impacts infection of pure T cell cultures in vitro (e.g. Mashiba et al., 2014).

Our goal in the current study was to identify and characterize the myeloid restriction factor targeting Env that is counteracted by Vpr. We reasoned that macrophage-specific Env-binding proteins, including the carbohydrate binding protein mannose receptor (MR), were candidates. MR is expressed on several types of macrophages in vivo (Liang et al., 1996; Linehan et al., 1999) and is known to mediate innate immunity against various pathogens (Macedo-Ramos et al., 2014; Subramanian et al., 2019). MR recognizes mannose-rich structures including high-mannose glycans, which are incorporated in many proteins during synthesis. In eukaryotic cells most high-mannose glycans are cleaved by α-mannosidases and replaced with complex-type glycans as they transit through the secretory pathway. By contrast, in prokaryotic cells, high-mannose residues remain intact, making them a useful target of pattern recognition receptors including MR. Some viral proteins, including HIV-1 Env, evade mannose trimming (Coss et al., 2016) and retain enough high-mannose to bind MR (Trujillo et al., 2007; Lai et al., 2009). There is evidence that HIV-1 proteins Nef and Tat decrease expression of MR based on studies performed in monocyte derived macrophages (MDM) and the monocytic U937 cell line, respectively (Caldwell et al., 2000; Vigerust et al., 2005). Nef dysregulates MR trafficking using an SDXXLΦ motif in MR’s cytoplasmic tail (Vigerust et al., 2005), which is similar to the sequence in CD4’s tail that Nef uses to remove it from the cell surface (Bresnahan et al., 1998; Greenberg et al., 1998; Cluet et al., 2005). Whether MR or its modulation by viral proteins alters the course of viral replication has not been established.

Here we confirm that Nef reduces MR expression in primary human MDM, although in our system, the effect of Nef alone was relatively small. In contrast, we report that co-expression of Vpr and Nef dramatically reduced MR expression. In the absence of both Vpr and Nef, MR levels normalized indicating that Tat did not play a significant, independent role in MR downmodulation. Deleting mannose residues on Env or silencing MR alleviated mannose-dependent interactions between MR and Env and reduced the requirement for Vpr. Although the post-infection interactions between MR and Env reduced Env levels and inhibited viral release, we provide evidence that these same interactions were beneficial for initial infection of MDM. Together these results reveal that mannose residues on Env and the accessory proteins Nef and Vpr are needed for HIV to utilize and then disable an important component of the myeloid innate response against pathogens intended to thwart infection.


Identification of a restriction factor counteracted by Vpr in primary human monocyte-derived macrophages

Because we had previously determined that Vpr functions in macrophages to counteract a macrophage specific restriction factor that targets Env, we reasoned that Env-binding proteins selectively expressed by macrophages were potential candidate restriction factors. To determine whether any factors fitting this description were targeted by Vpr, we cultured macrophages under conditions that achieve a saturating infection by both wild-type and Vpr-null mutant viruses (Figure 1A and B). We found that mannose receptor (MR), which is highly expressed on macrophages and has been previously shown to bind Env (Trujillo et al., 2007; Fanibunda et al., 2008; Lai et al., 2009), was significantly decreased by wild-type HIV 89.6 but not by 89.6 vpr-null (Figure 1C and D, p<0.01). In contrast, we observed no significant effect of Vpr on the expression of GAPDH. We also observed that stimulator of interferon genes (STING) was unaffected by Vpr (Figure 1—figure supplement 1). Relative expression of known restriction factors GBP5 and IFITM3 varied in infected MDM from multiple donors (Figure 1—figure supplement 1), but unlike MR they were not consistently reduced in the wild-type condition, indicating they are not targeted by Vpr.

Figure 1 with 1 supplement see all
HIV Vpr reduces steady state levels of host mannose receptor in MDM and increases steady state levels of viral Env protein.

(A) Diagram of the HIV 89.6 proviral genome. The shaded box shows the location of vpr, which was disrupted by a frame shift mutation to create the Vpr-null version (Mashiba et al., 2014). HIV-1 89.6 is a dual CXCR4/CCR5-tropic HIV molecular clone isolated from the peripheral blood of an AIDS patient (Collman et al., 1992). (B) Summary graph depicting MDM infected by HIV 89.6 wild-type and vpr-null with matched infection frequencies of at least 50% 10 days post infection as measured flow cytometrically by intracellular Gag p24 staining. This subset with high frequencies of infection was selected to examine potential effects on host factors. (C) Western blot analysis of whole cell lysates from MDM prepared as in B. (D) Summary graph displaying relative expression of MR in wild-type and mutant 89.6 from blots as shown in C. Western blot protein bands were quantified using a Typhoon scanner. Values for MR expression in MDM infected with Vpr-null HIV were normalized to GAPDH and then to wild-type for each donor. Statistical significance was determined using a two-tailed, ratio t-test. **p=0.005 (E) Western blot analysis of HIV protein expression in MDM infected as in B. (F) Summary graph of HIV protein expression from western blot analysis as in E and quantified as described in methods. The ratio of expression in wild-type to vpr-null infection is shown. Data from 9 independent donors with similar frequencies of infection (within 2-fold) following ten days of infection are shown. Statistical significance was determined using a two-tailed, ratio t-test, N.S. – not significant, p=0.31, **p<0.01, ***p<0.001. Data from each donor is represented by the same symbol in all charts. Mean values are indicated.

To confirm the effect of Vpr on Env during HIV infection of primary human macrophages in which MR was downmodulated, we performed quantitative western blot analysis. As shown in Figure 1E and F, we confirmed that amounts of Vpr sufficient for MR downmodulation were also sufficient for stabilizing expression of Env (gp160, gp120, gp41). Compiled data from nine donors clearly demonstrated results that were similar to our prior publication (Mashiba et al., 2014); under conditions of matched infection in which there was no significant difference in HIV Gag pr55 levels between wild-type and vpr-null infections, all three forms of Env were significantly more abundant in the wild-type infection (gp160: 4-fold, p<0.002; gp120: 6-fold, p<0.002; gp41: 3-fold, p<0.001).

Vpr and Nef counteract MR expression in infected macrophages via independent and additive mechanisms

Because an earlier report indicated that Nef decreases surface expression of MR (Vigerust et al., 2005), we asked whether Nef was playing a role in MR downmodulation in our systems. Because HIVs lacking Vpr and Nef spread too inefficiently in MDM to observe effects on host proteins by western blot analysis, we utilized a replication defective HIV with a GFP marker (NL4-3 ∆GPE-GFP, Figure 2A) to allow measurement of MR expression via flow cytometry following single-round transduction. This construct has the additional advantage that it eliminates potentially confounding effects of differences between wild-type and mutant HIV viral spread. We generated truncation mutations in nef and vpr and confirmed that these mutations only affected expression of the altered gene product in transfected 293T (Figure 2B). For these experiments, primary MDM were harvested earlier than the experiments described in Figure 1 (five days versus ten days) because the viruses could not replicate and the GFP marker allowed identification of transduced cells (Figure 2C). Under these conditions, we found that MR expression was dramatically reduced in a subset of GFP+ cells when both Vpr and Nef were expressed (Figure 2C–E). Both Nef and Vpr contributed to MR downmodulation; loss of function mutation in either Vpr or Nef reduced the severity of MR downmodulation similarly, and there was no statistical difference between MR levels in macrophages expressing either Vpr or Nef alone (Figure 2E). In addition, complete elimination of downmodulation required mutation of both Vpr and Nef (Figure 2C–E). These results indicate that both Vpr and Nef are required for maximal MR downmodulation in HIV-infected macrophages and that neither alone is sufficient.

Figure 2 with 1 supplement see all
Combined effects of Nef and Vpr completely remove MR from a significant proportion of infected cells at early time points.

(A) Diagram of HIV NL4-3 ∆GPE-GFP. (B) Western blot analysis of whole cell lysates from 293T cells transfected with the indicated viral expression construct. (C) Flow cytometry plots indicating the gating strategy used to identify live GFP+ vs GFP- cells and the fraction of cells that are MRlow. (D) Representative flow cytometric analysis of MDM at five days post transduction by the indicated virus. The percentage of GFP+ cells that fell into the MRlow gate is indicated in each panel. (E) Summary graph depicting the percentage of GFP+ cells that fell into the MRlow gate in transduced MDM. For the uninfected column the results from GFP- cells are displayed. (Each dot indicates an independent donor, range 3–11). (F) Western blot analysis of whole cell lysates from 293T cells transfected with the indicated viral expression construct. (G) Summary graph depicting the frequency of transduced (GFP+) MDM at the time of harvest. (H) Representative flow cytometric plots of MDM transduced with the indicated adenoviral vector (n = 3 independent donors). For parts E and F mean +/- standard deviation is shown. Statistical significance was determined by a two-tailed, paired t-test. N.S. not significant, **p<0.01, ***p<0.001, ****p<0.0001.

Vpr was previously demonstrated to interact with a cellular co-factor called DCAF1, a component of the cellular DCAF1-DDB1-CUL4 E3 ubiquitin ligase complex. (Hrecka et al., 2007; Le Rouzic et al., 2007; McCall et al., 2008; Lahouassa et al., 2016; Wu et al., 2016; Zhou et al., 2016). The interaction between Vpr and DCAF1 can be disrupted through a Vpr mutation (Q65R) that inhibits many Vpr-dependent functions, including reversal of Env degradation in macrophages (Mashiba et al., 2014). To determine whether this mutant is defective at MR downmodulation, we generated the mutation in the NL4-3 ∆GPE-GFP parent (Figure 2A), confirmed expression in transfected 293T cells (Figure 2F) and tested the effect of the mutation on MR levels in macrophages. As expected, we found that in transduced MDM the vpr-Q65R mutant behaves similarly to vpr-null (Figure 2E). These results indicate interactions between Vpr and DCAF1 are required to mediate Vpr’s effects on MR.

The differences in MR downmodulation we observed using this system were not due to variations in multiplicity of infection of the different viral constructs as MDM transduced with the mutant viral constructs had roughly similar transduction rates as the parental construct (Figure 2G) but demonstrated less MR downmodulation (Figure 2E).

To determine whether the relatively modest effect of Nef alone on MR levels was due to using HIV to deliver Nef as compared to an adenoviral vector delivery system used in a prior publication (Vigerust et al., 2005), we repeated the experiment using an adenoviral vector expressing Nef. These experiments confirmed that levels of Nef sufficient to downmodulate the HIV receptor, CD4, on nearly all MDM in the culture achieved only modest effects on MR in a subset of cells (Figure 2H) similar to what was observed using the HIV reporter construct (Figure 2E). Thus, Nef and Vpr have modest but significant effects on MR when expressed individually, however the combined effects of both proteins can achieve nearly complete downmodulation at least in a subset of infected cells.

While the effect of Nef has been previously reported and found to be due to disruption of MR intracellular trafficking (Vigerust et al., 2005), the effect of Vpr on MR is a novel observation. Vpr is known to target cellular proteins involved in DNA repair pathways for proteasomal degradation via interactions with Vpr binding protein [DCAF1, (McCall et al., 2008)]. Using this mechanism, Vpr degrades the uracil deglycosylases UNG2 and SMUG1 in 293T cells following co-transfection (Schröfelbauer et al., 2005; Schröfelbauer et al., 2007). To determine whether Vpr directly targets MR using a similar strategy, we co-transfected NL4-3 ∆GPE-GFP or a vpr-null derivative with expression vectors encoding an UNG2-FLAG fusion protein or MR (Liu et al., 2004) in 293T cells. We then analyzed expression of MR or UNG2 by flow cytometry and western blot (Figure 2—figure supplement 1). We found that Vpr in 293T cells virtually eliminated UNG2 expression when measured by flow cytometry and noticeably reduced UNG2 by western blot. However, Vpr had no effect on expression of MR measured by either method. Thus, we concluded that Vpr does not degrade MR by the direct, proteasomal mechanism it uses to degrade UNG2. Because MR expression in this system is controlled by a heterologous CMV promoter; the lack of effect by Vpr suggested its action may depend on MR’s native promoter.

Vpr reduces transcription of MRC1

In addition to targeting proteins for degradation, Vpr also functions to inhibit transcription of genes such as IFNA1 (Laguette et al., 2014; Mashiba et al., 2014). Therefore, we hypothesized that Vpr may reduce MR expression via inhibition of transcription. To examine this, we assessed transcriptional activity in primary human MDM transduced with the wild-type or Vpr-null reporter virus (Figure 3A) using cells isolated based on GFP expression (Figure 3B). We found that the MR gene (MRC1) was consistently reduced in cells transduced by vpr-competent virus compared to cells transduced by vpr-null virus (Figure 3C and D, p=0.001). In contrast, any effects of Vpr on the housekeeping genes ACTB (β-actin) and POL2A (RNA polymerase 2A) were significantly smaller (Figure 3D, p<0.01). Similar results were obtained when each gene was normalized to ACTB instead of GAPDH (Figure 3—figure supplement 1A–B). The magnitude of the effect on MRC1 is consistent with prior reports of HIV-1 inhibiting MRC1 transcription− though this was not previously linked to Vpr (Koziel et al., 1998; Sukegawa et al., 2018). Relative MRC1 expression in untransduced MDM was heterogeneous, varying over a ten-fold range. When compiled across donors, MRC1 levels in mock-transduced samples were not significantly different than transduced (Figure 3—figure supplement 1C–F).

Figure 3 with 1 supplement see all
Vpr reduces transcription of MRC1.

(A) Diagram of HIV NL4-3 ∆GPE-GFP. (B) Flow cytometry plots indicating the gating strategy used to sort live GFP+ vs GFP- cells for subsequent qPCR analysis. (C) Summary graph of mannose receptor (MRC1), β-actin (ACTB) and RNA Polymerase 2A (POL2A) mRNA expression in MDM transduced with the indicated HIV reporter and sorted for GFP expression by FACS. All data are normalized to GAPDH mRNA expression. (D) Summary graph of MRC1, ACTB and POL2A expression normalized to the Vpr-null condition in each donor. (n = 7 independent donors). Geometric mean +/- geometric standard deviation is shown. Statistical significance was determined by a two-tailed, ratio t-test. N.S. = not significant p=0.81, **p<0.01.

Combined effect of Vpr and Nef dramatically enhances Env levels in primary human MDM

To determine whether the striking downmodulation of MR we observed with expression of both Nef and Vpr affected viral spread in MR+ macrophages, we generated additional mutations in HIV-1 89.6 to create a nef-null mutant and a vpr-nef-null double mutant. As expected, in transfected 293T cells these mutations did not alter Env protein levels (Figure 4A) or release of virions as assessed by measuring Gag p24 in the supernatant by ELISA (Figure 4B). However, in primary human MDM infected with these HIVs, the mutants demonstrated defects in viral spread, with the double mutant having the greatest defect (Figure 4C and D). The defect in spread was caused in part by diminished virion release, which we previously showed occurred in the absence of Vpr (Mashiba et al., 2014); MDM infected with the HIV mutants released less Gag p24 even after adjusting for the frequency of infected cells (Figure 4D, right panel).

Combined effect of Vpr and Nef dramatically enhances Env levels in primary human MDM.

(A) Western blot analysis of whole cell lysate from 293T transfected with the indicated HIV construct. (B) Summary graph of virion release from 293T cells transfected as in A and measured by Gag p24 ELISA. (n = 5 independent transfections). The mean +/- standard deviation is shown. Statistical significance was determined by one-way ANOVA. (N.S. – not significant) (C) Frequency of infected primary human MDM infected with the indicated HIV and analyzed over time by flow cytometric analysis of intracellular Gag. (For parts C-E, n = 2 independent donors). (D) Virion release by primary human MDM infected with the indicated HIV and analyzed by Gag p24 ELISA 10 days post infection. In the right panel, virion release was adjusted for frequency of infected cells as measured in part C. (E) Western blot analysis of whole cell lysate from primary human MDM infected with the indicated HIV. Within each donor, lanes 2–6 are a serial dilution series of the wild-type sample. The arrows below the Gag pr55 bands indicate the dilution of wild-type that has approximately the same amount of Gag pr55 as the vpr-nef-null double mutant.

To determine whether combined effects of Nef and Vpr on MR expression affected Env restriction, we assessed Env levels in primary human MDM infected with each construct. Because the frequency of infected cells as assessed by intracellular Gag staining (Figure 4C) and Gag pr55 western blot (Figure 4E) was lower in the mutants than in the wild-type infection, lysate from the wild-type sample was serially diluted to facilitate comparisons. Remarkably, we found that the vpr-nef-null double mutant, which retains near normal MR levels, exhibited the greatest defect in Env expression (Figure 4E, compare lanes with similar Gag as indicated). In sum, Vpr and Nef-mediated downmodulation of MR correlated inversely with Env levels, consistent with MR being the previously described but unidentified HIV restriction factor that targets Env for lysosomal degradation in macrophages and is counteracted by Vpr (Mashiba et al., 2014). Combined effects of Nef on MR and other Env binding proteins including CD4 (Aiken et al., 1994) and chemokine receptors (Michel et al., 2006) may also play a role in stabilization of Env.

Mannose-containing glycans in Env are required for macrophage restriction of HIV in the absence of Vpr

A particularly dense mannose-containing structure on Env, known as the mannose patch, may mediate interactions between Env and MR. This structure is present on all HIV Env proteins that require Vpr for stability in macrophages [89.6, NL4-3 and AD8 (Mashiba et al., 2014; Collins et al., 2015). Interestingly, a macrophage tropic strain YU-2, which was isolated from the CNS of an AIDS patient (Li et al., 1991), lacks a mannose patch. This structure is the target of several broadly neutralizing antibodies including 2G12, to which YU-2 is highly resistant (Trkola et al., 1996). If Vpr targets MR to counteract detrimental interactions between MR and mannose residues on Env, we hypothesized that HIV Envs lacking a mannose patch would have a reduced requirement for Vpr. To test this hypothesis, we first examined the extent to which virion release and Env expression were influenced by Vpr in primary human MDM infected with YU-2 or 89.6 HIVs. Consistent with our hypothesis, we observed no significant difference in Gag p24 release between wild-type and vpr-null YU-2 infection of MDM (Figure 5A). Moreover, the vpr-null mutant of YU2 displayed only a minor defect in Env expression compared to Vpr null versions of 89.6 and NL4-3 (Figure 5B).

Figure 5 with 1 supplement see all
HIV YU2, which lacks a mannose-rich patch, does not require Vpr for robust Env protein expression and spread in MDM.

(A) Virion release over time by primary human MDM infected with the indicated HIV as measured by ELISA (n = 2 independent donors). (B) Western blot analysis of whole cell lysates from MDM infected for 10 days with the indicated HIV. Because NL4-3 infects MDM poorly, NL4-3 was pseudotyped with a YU-2 Env expression plasmid co-transfected in the producer cells as described in Methods. Subsequent spread was blocked in all samples by the addition of entry inhibitors AMD3100 and maraviroc initially added 48 hr post-infection and maintained throughout the culture period. (C) Diagram of the HIV NL4-3 genome. The shaded portion represents the sequence that was replaced with sequence from HIV YU2 to create the NL4-3 envYU-2 chimera. (D) Western blot analysis of 293T cells transfected with the indicated HIV constructs. YU-2 gp41 is detected by the monoclonal antibody z13e1 and NL4-3 gp41 is detected by the monoclonal antibody CHESSIE-8. (E) Virion release from 293T transfected as in D as measured by p24 ELISA. (n = 3 experimental replicates). (F) Relative infection of MOLT4-R5 cells 48 hr after inoculation with the indicated viruses and treatment with entry inhibitors as indicated. The frequency of infected cells was measured by intracellular Gag stain and normalized to the untreated condition for each infection. (G) Western blot analysis of primary human MDM infected for 10 days with the indicated virus as in B. (n = 2 independent donors). (H) Summary graph showing virion release as measured by p24 ELISA from primary human MDM infected as in G. Virus production was adjusted for infection frequency as determined flow cytometrically using an intracellular Gag stain. The mean +/- standard deviation is shown. (n = 4 independent donors). N.D. – no difference. Statistical significance was determined using a two-tailed, ratio t-test. N.S. – not significant, *p<0.05.

Because there are a number of other genetic differences between YU-2 and the other HIVs, we constructed a chimeric virus, which restricted the differences to the env open reading frame. As shown in Figure 5C, a fragment of the YU-2 genome containing most of env but none of vpr (Figure 5C, shaded portion) was cloned into NL4-3 and NL4-3 vpr-null. As expected, these genetic alterations did not affect Env protein levels or virion release in transfected 293T cells (Figure 5D and E). To confirm that the chimeric Env was still functional, we examined infectivity in T cells prior to performing our analyses in primary human MDM. Conveniently, sequence variation within the gp120 region allows YU-2 Env to only utilize the co-receptor CCR5 for entry, whereas NL4-3 can only utilize CXCR4. Thus, we expected the NL4 3envYU2 chimera would switch from being CXCR4- to CCR5-tropic. To test this, we utilized a T cell line expressing both chemokine receptors (MOLT4-R5) and selectively blocked entry via CXCR4 and CCR5 entry inhibitors [AMD3100 and maraviroc, respectively (Figure 5F)]. As expected, entry into MOLT4-R5 cells by NL4-3 was blocked by AMD3100 but not maraviroc, indicating CXCR4-tropism. The chimeric NL4-3 envYU2 and wild-type YU-2 demonstrated the inverse pattern, indicating CCR5-tropism. These results demonstrated that we had made the expected changes in the chimeric Env without disrupting its capacity to infect cells.

To determine whether swapping a limited portion of YU-2 env into NL4-3 alleviated the requirement for Vpr, we examined Env expression and virion release in primary human MDM infected with these viruses. Because the parental NL4-3 virus required pseudotyping with a macrophage-tropic Env for entry and was unable to spread in MDM, all infections were treated with entry inhibitors AMD3100 and maraviroc starting at 48 hr after inoculation and maintained throughout the culture period to block subsequent rounds of infection. Consistent with our hypothesis that YU-2 Env lacked determinants necessary for the restriction that was alleviated by Vpr, we observed that wild-type NL4-3 Env but not chimeric NL4-3 envYU2 required Vpr for maximal expression (Figure 5G). Moreover, MDM infected with the chimeric HIV had a reduced requirement for Vpr for maximal virion release (Figure 5H and Figure 5—figure supplement 1). This experiment provides strong evidence that the requirement for Vpr can be alleviated by genetic changes within the env open reading frame. These results are consistent with a model in which YU-2 env confers resistance to the effects of MR due to the absence of the mannose-rich structure on the YU-2 Env glycoprotein.

Deletion of N-linked glycosylation sites in Env reduces Env restriction in HIV infected human primary MDM and diminishes the need for Vpr and Nef

To more directly assess the role of mannose in restricting expression of Env in HIV-1 infected primary human MDM, we engineered a version of 89.6 Env in which two N-linked glycosylation sites, N230 and N339 (HIV HxB2 numbering) were deleted by substituting non-glycosylated amino acids found at analogous positions in YU-2 Env (Figure 6A). The glycosylation sites N230 and N339 were selected because they contain high-mannose glycan structures (Leonard et al., 1990) that are absent in YU-2 Env. Loss of N230 limits neutralization by glycan specific antibodies (Huang et al., 2014). Loss of N339 decreases the amount of oligomannose (Man9GlcNAc2) present on gp120 by over 25%, presumably by opening up the mannose patch to processing by α-mannosidases (Pritchard et al., 2015). These substitutions (N230D and N339E) in 89.6 did not alter virion production (Figure 6B) or Env protein expression (Figure 6C) in transfected 293T cells.

Figure 6 with 1 supplement see all
Deletion of N-linked glycosylation sites in env reduces the requirement for Vpr and Nef for virion release and Env expression in HIV-1 infected primary human MDM.

(A) Upper panel, diagram of HIV genome encoding the mutations N230D and N339E (indicated in red) to prevent N-linked glycosylation at those sites. Lower panel, diagram of HIV 89.6 N230D N339E mutant Env protein. Branched symbols represent N-linked glycans. (B) Summary graph showing virion release from 293Ts transfected with the indicated HIV construct as measured by p24 ELISA. (n = 3 experimental replicates). Statistical significance was determined by one-way ANOVA. (C) Western blot analysis of 293T transfected as in B. (D) Summary graph showing relative infection frequency of MOLT4-R5 T cells by the indicated HIV following treatment as indicated with the neutralizing antibody 2G12. The percentage of infected cells was measured by intracellular Gag stain and normalized to the untreated condition for each virus. (n = 2 independent experiments, both are plotted) (E) Summary graphs of relative infection of the indicated cell type by mutant or parental wild-type HIV. The frequency of infected cells was measured flow cytometrically by intracellular Gag stain and normalized to the wild-type virus. (n = 5 experimental replicates for MOLT4-R5; n = 2 experimental replicates for MDM from four independent donors). (F) Summary graph depicting relative infection of the indicated cell type by each virus plus or minus increasing concentrations of mannan as indicated. The frequency of infected cells was measured by intracellular Gag stain and normalized to the uninhibited (0 mg/mL mannan) condition for each virus. 89.6 pVSV-G indicates 89.6 ∆env pseudotyped with VSV-G protein. (n = 2 independent donors for 89.6 wild-type and 89.6 ∆env pVSV-G; n = 1 donor for 89.6 env N230D N339E) (G) Summary graph of virion release from primary human MDM following 10 days of infection by the indicated HIV as measured by p24 ELISA. Virion release was normalized to the infection frequency assessed flow cytometrically by intracellular Gag stain. The result for each vpr-null mutant was normalized to the vpr-competent virus encoding the same env. (n = 6 independent donors) (H) Summary graph of virion release from primary human MDM following 10 days of infection by the indicated HIV as measured by p24 ELISA. Virion release was normalized to the infection frequency assessed flow cytometrically by intracellular Gag stain. For this single round infection assay, all viruses were pseudotyped with YU2 Env and viral spread was blocked 48 hr later by addition of AMD3100 and maraviroc. (n = 8 independent donors) The result for each vpr-null or vpr-nef-null mutant was normalized to the vpr- and nef-competent virus encoding the same env. (I) Western blot analysis of MDM infected as in G. The lysates from the vpr-competent and nef-competent infections were diluted to facilitate comparisons to vpr- and nef-null mutants. (n = 2 independent donors) For summary graphs, the mean +/- standard deviation is shown. In panels E, G and H statistical significance was determined by a two-tailed, paired t-test *p=0.01, **p<0.01, ***p<0.001.

To confirm that mutation of N230 and N339 disrupted the mannose patch on Env, we assayed the ability of 2G12, which recognizes epitopes in the mannose patch (Sanders et al., 2002; Scanlan et al., 2002) to neutralize wild-type and mutant Env. As shown in Figure 6D, wild-type but not mannose deficient N230D N339E Env was neutralized by 2G12. In addition, we found that these substitutions did not disrupt infection of a T cell line that does not express MR (Figure 6E). However, somewhat unexpectedly, we found that HIV containing the N230D N339E Env substitutions was approximately 40% less infectious to primary human macrophages expressing MR than the wild-type parental virus (Figure 6E, p=0.002). This macrophage-specific difference in infectivity suggested that mannose on Env may facilitate initial infection through interactions with MR, which is highly expressed on differentiated macrophages. To examine this possibility further, we asked whether soluble mannan, which competitively inhibits MR interactions with mannose containing glycans (Shibata et al., 1997), was inhibitory to HIV infection of macrophages. As a negative control, we tested 89.6 ∆env pseudotyped with vesicular stomatitis virus G-protein Env (VSV-G) which has only two N-linked glycosylation sites, both of which contain complex-type rather than high-mannose glycans (Reading et al., 1978). Therefore VSV-G should not bind MR or be inhibited by mannan. As expected, we found that infection of a T cell line lacking MR was not sensitive to mannan (Figure 6F, left panel). However, infection of MDM by wild-type HIV-1 was inhibited up to 16-fold by mannan (Figure 6F, right panel). This was specific to HIV Env because mannan did not inhibit infection by HIV lacking env and pseudotyped with heterologous VSV-G Env. Interestingly, mannan also inhibited baseline macrophage infection by mannose-deficient Env (89.6 Env N230D N339E), indicating that N230D N339E substitutions did not completely abrogate glycans on Env that are beneficial to initial infection. In sum, our results demonstrate that interactions with mannose binding receptors are advantageous for initial HIV infection of macrophages and that the glycans remaining on Env N230D N339E retain some ability to bind glycan receptors on macrophages that facilitate infection.

While interactions between high-mannose residues on Env and MR were advantageous for viral entry, we hypothesized that they interfered with intracellular Env trafficking and were deleterious to egress of Env-containing virions in the absence of Vpr and/or Nef. To test this, we examined virion release and Env expression by HIVs encoding the mannose-deficient Env N230D N339E in the presence or absence of Vpr. In a spreading infection of MDM, we found that virus expressing mannose-deficient Env had a reduced requirement for Vpr for maximal virus release compared with the parental wild-type virus (Figure 6G, p<0.001). In addition, in single-round infections of MDM, the mannose-deficient Env had a reduced requirement for both Nef and Vpr (Figure 6H and Figure 6—figure supplement 1, p<0.001). Single round infection assays cultured for ten days were used to assess the vpr-nef double mutant because depletion of mannose on Env did not rescue spread under conditions that were most comparable to our ten day spreading infections. The defect in spread is likely due to pleiotropic effects of Nef that disrupt interference by the HIV receptors, CD4, CXCR4 and CCR5 (Lama et al., 1999; Michel et al., 2005; Venzke et al., 2006) combined with the reduced infectivity of the mannose deficient Env.

Finally, we asked whether the mannose-deficient Env had increased stability in primary human MDM lacking Vpr and/or Nef by western blot analysis. We found that the Env mutant (N230D. N339E) was more stable in the absence of Vpr (Figure 6I, right side, black bars) and Nef (Figure 6I, right side, gray bars) once differences in infection frequency were accounted for by matching pr55 expression in the dilution series. These data provide strong support for a model in which MR restricts Env expression via direct interaction with high-mannose residues on Env and this restriction is counteracted by Vpr and Nef.

Silencing MR alleviates restriction of Env in primary human MDM lacking Vpr

To directly test the hypothesis that MR is a restriction factor in MDM that is counteracted by Vpr, we examined the effect of MR silencing on Env expression in HIV-infected MDM lacking Vpr. Consistent with our hypothesis, we observed that silencing MR stabilized Env relative to Gag pr55 (Figure 7A). These results support the conclusion that the Env restriction observed in the absence of Vpr is dependent on expression of MR.

Figure 7 with 1 supplement see all
Knockdown of MR enhances Env expression and spread to T cells in vpr-null infection of MDM.

(A) Western blot analysis of MDM from two independent donors treated with the indicated silencing vector and infected with the indicated HIV for 10 days. The shRNA sequences encoded by the negative control vector (shNC) and the MR silencing vector (shMR) are described in Methods. (B) Schematic diagram of experimental protocol used for silencing experiments. (C) Representative flow cytometric plots showing frequency of infected (Gag+) primary T cells following two days of co-culture with autologous, HIV 89.6 infected primary MDM. T cells were identified in co-culture by gating on CD3+ CD14- cells as shown in Figure 7—figure supplement 1B. (D) Summary graph displaying relative infection of MDM and T cells as measured in C (n = 5 independent donors). Data in the left panel are unnormalized. In the right panel the data have been normalized to the wild-type condition for each donor and shRNA.

Previous work in our laboratory demonstrated that restriction of Env in primary human MDM disrupted formation of virological synapses and cell-to-cell spread of HIV from infected MDM to T cells (Collins et al., 2015). Expression of Vpr alleviated these effects, dramatically increasing viral transmission – especially under conditions of low initial inoculum of free virus. To expand on these findings, we measured Vpr-dependent HIV-1 spread from primary human MDM to autologous T cells, as diagrammed in Figure 7—figure supplement 1A. Co-cultured cells were stained for CD3 to distinguish T cells and CD14 to distinguish MDM as shown in Figure 7—figure supplement 1B, accounting for differences in autofluorescent background in the two cell types by using isotype controls (Figure 7—figure supplement 1C) We confirmed our prior finding that Vpr enhances HIV-1 89.6 spread from MDM to T cells (Figure 7—figure supplement 1D) and extended this finding to the transmitted/founder (T/F) clone REJO (Figure 7—figure supplement 1E). Consistent with our previous findings, we observed that a higher frequency of T cells became infected following co-culture with infected MDM as compared to incubation with high titer cell free virus [47-fold (89.6, p=0.0002) and 38-fold (REJO, p=0.048)].

To determine whether Vpr stimulated spread from macrophages to T cells by counteracting MR restriction, we measured spread to T cells from macrophages in which MR had been silenced as diagrammed in Figure 7B. Using the gating strategy shown in Figure 7—figure supplement 1B, infected MDM and infected T cells were identified by intracellular Gag stain (Figure 7C). We found that silencing MR reduced the difference between wild type and Vpr-null infected macrophage spread to T cells from 7-fold (p=0.003) to 2-fold (p=0.02) (Figure 7D). These results provide strong evidence that MR is the previously described but unidentified restriction factor in macrophages that reduces HIV spread from macrophages to T lymphocytes in the absence of Vpr.


We previously reported that Env and Env-containing virions are degraded in macrophage lysosomes in the absence of Vpr, impairing virion release, virological synapse formation, and spread of HIV to T cells (Mashiba et al., 2014; Collins et al., 2015). Moreover, this requirement for Vpr was conferred to heterokaryons comprised of macrophages and permissive cells, suggesting the existence of a previously unidentified host restriction factor that is counteracted by Vpr in macrophages (Mashiba et al., 2014). Results presented here clearly define mannose receptor (MR) as the HIV restriction factor counteracted by Vpr in macrophages to enhance viral dissemination. We provide strong evidence that Env mannosylation is required for restriction of Env and virion release in macrophages in the absence of Vpr, and that MR silencing relieves a requirement for Vpr to overcome this restriction. Moreover, we confirm and extend a prior report that Nef also acts to downmodulate MR from the macrophage cell surface (Vigerust et al., 2005) and demonstrate that Vpr and Nef cooperate to counteract MR in an additive fashion through independent mechanisms.

Other investigators have reported that HIV inhibits MRC1 transcription in macrophages and that MR inhibits virion egress upon exogenous expression in 293T cells (Sukegawa et al., 2018). In contrast to results we report here, the prior study observed effects on virions that were Env-independent and did not examine effects of Vpr on MR. In primary macrophages, Vpr-sensitive virion restriction only occurs when virions contain Env (Mashiba et al., 2014) and genetic changes in the env open reading frame – especially those that alter N-linked glycosylation sites – critically affect the requirement for Vpr. The effect of MR on Env and Env-containing virion release reported here helps explain previous observations that primate lentivirus infection reduces MR activity in humans (Koziel et al., 1993; Koziel et al., 1998) and monkeys (Holder et al., 2014). By confirming and extending our prior finding that Vpr-mediated stabilization of Env promotes macrophage to T cell spread (Collins et al., 2015) we also provide an explanation for how Vpr increases infection of human lymphoid tissue ex vivo (Eckstein et al., 2001; Rucker et al., 2004), which contain macrophages and T cells in a highly physiological, three-dimensional environment.

As Nef had already been shown to reduce MR surface expression (Vigerust et al., 2005), the observation that HIV encodes a second protein, Vpr, to reduce MR expression was unanticipated, but not unprecedented; other host proteins are known to be affected by more than one lentiviral accessory protein. The HIV receptor, CD4, is simultaneously targeted by Vpu, Nef and Env in HIV-1 (Chen et al., 1996) and tetherin is alternately targeted by Vpu, Nef, or Env in different strains of primate lentiviruses (Harris et al., 2012). Nef has also been shown to downmodulate the viral co-receptors CXCR4 (Venzke et al., 2006) and CCR5 (Michel et al., 2005), which may also interfere with Env expression and viral egress in infected cells. Nef’s activity against CXCR4, CCR5, and MR presumably has the same ultimate purpose as its activity against CD4, namely to stabilize Env, enhance virion release and prevent superinfection of the producer cell (Lama et al., 1999; Ross et al., 1999). The impact of these deleterious interactions is clearly demonstrated by the profound loss of Env we observed in HIV-infected macrophages lacking both Vpr and Nef.

The need for both Vpr and Nef to counteract MR may be explained by the high level of MR expression, estimated at 100,000 copies per macrophage (Stahl et al., 1980). The potent combined effect likely derives from synergistic targeting of MR at two different stages of MR synthesis. Nef was shown to alter MR trafficking (Vigerust et al., 2005) and we show Vpr inhibits MR transcription.

In addition, our results suggest that maximal MR downmodulation is time-dependent in macrophages, which have the capacity to survive while infected for weeks; western blot analysis of whole cell lysates from saturated, ten-day infected cultures achieved a more striking reduction than was observed by flow cytometric analysis of five day cultures of macrophages infected with non-spreading viruses expressing GFP. This time dependency is potentially explainable in part by the very long half-life of MR [33 hr (Lennartz et al., 1989)] combined with the large amount of MR expressed per cell discussed above.

In sharp contrast to the effect we observed in MDM, Vpr did not affect MR protein levels when MR was expressed via a heterologous promoter in the 293T cell line, which is derived from human embryonic kidney cells and is not a natural target of HIV. The cell type selectivity in these experiments is likely due to differences in the promoters driving MR expression, however, we cannot rule out the existence of other macrophage specific pathways required to recreate the effect of Vpr on MR. Further work will be needed to examine these questions and determine other mechanistic details.

Our findings also implicate the Vpr binding protein VprBP/DCAF1 (McCall et al., 2008), a component of the cellular DCAF1-DDB1-CUL4 E3 ubiquitin ligase complex, in downmodulation of MR by Vpr. This complex is required for most of the known functions of Vpr, including: disruption of the cell cycle, disruption of cellular DNA repair pathways in dividing cells (Belzile et al., 2007; Hrecka et al., 2007; Le Rouzic et al., 2007; Wen et al., 2007; Lahouassa et al., 2016; Wu et al., 2016; Zhou et al., 2016) and transcriptional inhibition of type I interferons in response to infection in macrophage cultures (Laguette et al., 2014; Mashiba et al., 2014). Additional research is now needed to determine how interactions between Vpr and DCAF1 mediate these pleiotropic effects.

Deleterious interactions between MR and Env that are alleviated by Vpr and Nef, likely occur along the secretory pathway and continue at the cell surface. This is based on previously published work showing that Env-containing virions are retained at the cell surface and targeted to lysosomes in macrophages lacking Vpr (Collins et al., 2015). Our prior studies also provided evidence that unprocessed Env gp160 is affected and targeted to lysosomal compartments albeit to a lesser degree (Mashiba et al., 2014). Because Env processing occurs via furin-mediated cleavage in the trans-Golgi network (TGN), the effect on unprocessed Env provides evidence that in addition to acting at the surface, MR likely also interacts with Env along the secretory pathway prior to its arrival and processing in the TGN.

MR’s interaction with Env appears to be mediated by the unusually high density of N linked glycosylation sites on Env that retain high-mannose glycans, which is a known pathogen-associated molecular pattern (Stahl and Ezekowitz, 1998; McGreal et al., 2006). Here, we show that selective deletion of mannose residues alleviated the requirement for Vpr. Deletion of individual glycosylation sites is known to lead to changes in the processing of neighboring glycans and deletions at certain sites lead to larger than expected losses of oligomannose (Balzarini, 2007) presumably because their removal allows greater access to mannosidases and facilitates trimming of surrounding glycans. Selective pressure to maintain mannose residues on Env may be due to the enhanced attachment they mediate. Indeed, we provide strong evidence that Env’s interaction with MR boosts initial infection of MDM. This finding is supported by a prior report that MR enhances HIV-1 binding to macrophages and transmission of the bound virus to co-cultured T cells (Nguyen and Hildreth, 2003). Our study adds to these findings by providing evidence that interactions with mannose binding receptors also enhance direct infection of macrophages. Moreover, the capacity of Vpr and Nef to mitigate the effect of detrimental intracellular interactions during viral egress limits the negative impact of retaining high-mannose on Env. In addition, the dense glycan packing, which is privileged from antibody recognition through immune tolerance, is believed to play a role in evasion of the antibody response (Stewart-Jones et al., 2016).

Because MR has both positive and negative effects on infection, the interpretation of some experiments examining spreading infection in the setting of MR silencing or mutations in Env that reduced mannose content were complex to interpret. Some donors had increased infection resulting from MR silencing whereas others had a small decrease at the ten-day time point (data not shown). By using viral systems that allowed us to focus independently on viral entry and exit, we nevertheless clearly discerned that MR can serve as a positive factor for entry and a negative factor for egress.

Thus far, all viral Envs we have tested (NL4-3, AD8 and 89.6) require Vpr for stable expression in macrophages except YU-2. We show here that genetically altering the mannose patch on 89.6 so that it mirrored changes in the YU-2 mannose patch altered the behavior of 89.6 to resemble that of YU-2 with respect to Vpr phenotypes. This is strong evidence supporting our model that Vpr alleviates deleterious interactions caused by the Env mannose patch. Interestingly, YU-2 was cloned from the central nervous system and 89.6 was directly cloned from peripheral blood. Because the blood-brain barrier limits exposure to antibodies, CNS isolates may have a diminished requirement for high mannose residues, which protect from antibody responses.

Here we also confirm and extend our prior observation (Collins et al., 2015) that co-culturing T cells with infected MDM boosted HIV infection compared to direct infection of T cells with cell-free virus. Similar to clone 89.6, T cell infection by the transmitter/founder virus REJO was enhanced by co-culture with MDM, and spread from MDM to T cells was enhanced by Vpr. In the context of natural person-to-person transmission, accelerated spread to T cells may be critical to establishing a persistent infection before innate and adaptive immune responses are activated. The strong selective pressure to retain Vpr despite its limited effect on T cell-only cultures indicates there is more to learn about the role of Vpr, macrophages and T/F viruses in HIV transmission and pathogenesis. Collectively, these studies suggest that novel therapeutic approaches to inhibit the activity of Vpr and Nef in macrophages would potentially represent a new class of antiretroviral drug that could be an important part of a treatment or prophylactic cocktail.

Materials and methods

Key resources table
Reagent type
DesignationSource or

Recombinant DNA reagentp89.6Collman et al. (1992) PMID: 1433527NIH AIDS Reagent Program 3552
Recombinant DNA reagentp89.6 vpr-nullMashiba et al. (2014); PMID 25464830
Recombinant DNA reagentp89.6 nef-nullCarter et al. (2010); PMID 20208541
Recombinant DNA reagentp89.6 vpr-nef-nullthis paperProduces HIV 89.6 vpr-nef-null double mutant
Recombinant DNA reagentp89.6 env N230D N339Ethis paperProduces HIV 89.6 env N230D N339E mutant
Recombinant DNA reagentp89.6 env N230D N339E vpr-nullthis paperProduces HIV 89.6 env N230D N339E vpr-null mutant
Recombinant DNA reagentp89.6 env N230D N339E vpr-nef-nullthis paperProduces HIV 89.6 env N230D N339E vpr-nef-null mutant
Recombinant DNA reagentpNL4-3Adachi et al. (1986); PMID 3016298NIH AIDS Reagent Program 114
Recombinant DNA reagentpNL4-3 envYU2this paperProduces HIV NL4-3 envYU2 chimera
Recombinant DNA reagentpNL4-3 envYU2vpr-nullthis paperProduces HIV NL4-3 envYU2vpr-null chimera
Recombinant DNA reagentpHCMV-GATCC75497Expresses VSV-G
Recombinant DNA reagentpCMV-HIV-1Gasmi et al., 1999; PMID 9971760Expresses HIV structural proteins
Recombinant DNA reagentpNL4-3 ∆GPE-GFPMcNamara et al. (2012); PMID 22718820
Recombinant DNA reagentpNL4-3 ∆GPE-GFP vpr-nullthis paperProduces NL4-3 ∆GPE vpr-null
Recombinant DNA reagentpNL4-3 ∆GPE-GFP vpr-Q65Rthis paperProduces NL4-3 ∆GPE vpr-Q65R
Recombinant DNA reagentpNL4-3 ∆GPE-GFP nef-nullthis paperProduces NL4-3 ∆GPE nef-null
Recombinant DNA reagentpNL4-3 ∆GPE-GFP vpr-nef-nullthis paperProduces NL4-3 ∆GPE vpr-nef-null
Recombinant DNA reagentpYU2Li et al. (1991); PMID 1830110NIH AIDS Reagent Program 1350
Recombinant DNA reagentpYU2 vpr-nullthis paperProduces YU-2 vpr-null
Recombinant DNA reagentpREJO.c/2864Ochsenbauer et al. (2012); PMID 22190722NIH AIDS Reagent Program 11746
Recombinant DNA reagentpREJO.c/2864 vpr-nullthis paperProduces REJO vpr-null
Recombinant DNA reagentpSIV3+Pertel et al. (2011); PMID 21696578
Recombinant DNA reagentpSIV3+ vpr-nullthis paperProduces SIV3+ vpr-null
Recombinant DNA reagentpSPAX2Pertel et al. (2011); PMID 21696578
Recombinant DNA reagentpAPM-1221Pertel et al. (2011); PMID 21696578Silences luciferase mRNA
Recombinant DNA reagentpAPM-MRC1-Cthis paperSilences MR mRNA
Recombinant DNA reagentpMD2.GPertel et al. (2011); PMID 21696578Expresses VSV-G
Recombinant DNA reagentpYU2 envSullivan et al. (1995); PMID 7769703
Recombinant DNA reagentpCDNA3.hMRLiu et al. (2004); PMID 15047828Expresses MR
Recombinant DNA reagentpPROA-3FLAG-UNG2-EYFPAkbari et al. (2010); PMID 20466601
Recombinant DNA reagentpMSCV IRES-GFPVan Parijs et al., 1999; PMID 10514006
Recombinant DNA reagentpMSCV 3xFLAG UNG2 IRES-GFPthis paperExpresses 3x FLAG-tagged UNG2
Recombinant DNA reagentpUC19Norrander et al. (1983); PMID 6323249
Chemical compound, drugFicoll-Paque PlusGE Healthcare17-1440-02
Chemical compound, drugrhM-CSFR and D Systems216-MC-025/CF
Chemical compound, drugrhGM-CSFR&D Systems215 GM-050
Chemical compound, drugIL-2R&D Systems202-IL-010
Chemical compound, drugphytohaemagglutinin-LCalbiohem431784
Chemical compound, drugEnzyme-free cell dissociation buffer, HBSS-basedThermoFisher13150016
Chemical compound, drugBlue loading bufferCell Signaling Technology7722
Chemical compound, drugAMD3100Hendrix et al., 2000; PMID 10817726NIH AIDS Reagent Program 8128
Chemical compound, drugMaravirocEmmelkamp and Rockstroh, 2007; PMID 17933722NIH AIDS Reagent Program 11580
Chemical compound, drugstreptavidin-HRPFitzgerald65R-S104PHRP
Chemical compound, drug3,3',5,5'-tetramethylbenzidineSigmaT8665-IL
Chemical compound, drugGag p24 standardViroGen00177 V
Chemical compound, drugProtein G ColumnGE Healthcare45-000-054
Commercial assay, kitQ5 site-directed mutagenesis kitNew England BiolabsE0554S
Commercial assay, kitEasySep Human CD14 Positive Selection Kit IIStemcell Technologies17858
Commercial assay, kitCD8 DynabeadsThermoFisher11147D
Commercial assay, kitRNeasy micro RNA isolation kitQiagen74004
Commercial assay, kitqScript cDNA SupermixQuantabio95048
Commercial assay, kitTaqMan Gene Expression Master MixThermoFisher4369016
Commercial assay, kitEZ-link Micro Sulfo-NHS-Biotinylation kitThermoFisherPI-21925
Sequence-based reagent896 dNef-Fthis paperPCR primerCACCATTATCGTTTCAGACCCT
Sequence-based reagent896 dNef-Rthis paperPCR primerTCTCGAGTTTAAACTTAT AGCAAAGCCCTTTCCA
Sequence-based reagentNL43 vprQ65R-Forwardthis paperPCR primerAGAATTCTGCGACAACTGCTG
Sequence-based reagentNL43 vprQ65R-Reversethis paperPCR primerTATTATGGCTTCCACTCC
Sequence-based reagentGeneExpression assay for ACTBThermoFisherHs99999903
Sequence-based reagentGeneExpression assay for MRC1ThermoFisherHs00267207
Sequence-based reagentGeneExpression assay for POL2AThermoFisherHs02786624
Sequence-based reagentGeneExpression assay for GAPDHThermoFisherHs00172187
Biological sample (Homo sapiens)Buffy coats/LeukoPaksNew York Blood CenterBuffy coats made from whole blood
Biological sample (adenovirus)Adeno-nefLeonard et al. (2011); PMID 21543478
Cell line (Homo sapiens)HEK293TATCCCRL-3216
Cell line (Mus musculus)anti-gp41 hybridoma CHESSIE-8Abacioglu et al. (1994); PMID 8068416NIH AIDS Reagent Program 526Purified ab used for WB (2 µg/mL)
Cell line (Mus musculus)anti-p24 hybridoma 183-H12-5CNIH AIDS Reagent Program1513Purified ab used for ELISA (1 µg/mL)
Cell line (Mus musculus)anti-p24 hybridoma 31-90-25ATCC (discontinued)HB-9725Purified ab used for ELISA (0.5 µg/mL)
Antibodyanti-mannose receptor-PE (mouse monoclonal)Becton Dickinsonclone 19.2 cat# 555954FC (1 µL per test)
Antibodyanti-Gag CA p24-PE (mouse monoclonal)Beckman Coulterclone KC57 cat# 6604667FC (0.25 µL per test)
Antibodyanti-Gag CA p24-FITC (mouse monoclonal)Beckman Coulterclone KC57 cat# 6604665FC (0.25 µL per test)
Antibodyanti-FLAG (mouse monoclonal)Sigmaclone M2 cat# F3165FC (1 µL per test), WB (1:1000)
Antibodyanti-CD4-APC (mouse monoclonal)ThermoFisherclone OKT4 cat# 17-0048-42FC (1 µL per test)
Antibodyanti-CD3-PacBlue (mouse monoclonal)BioLegendclone OKT3 cat# 317313FC (1 µL per test)
Antibodyanti-CD14-APC (mouse monoclonal)BioLegendclone HCD14 cat# 325608FC (1 µL per test)
Antibodyanti-mannose receptor (rabbit polyclonal)Abcamab64693WB (1:1000)
Antibodyanti-rabbit-AF647 (goat polyclonal)ThermoFisherA21244WB (1:4000)
Antibodyanti-GAPDH (mouse monoclonal)Abnovaclone 3C2 cat# H00002597-M01WB (1:2000)
Antibodyanti-mouse IgG1-AF647 (goat polyclonal)ThermoFisherA21240FC (1 µL per test), WB (1:4000)
AntibodyHIV-Ig (human polyclonal)Cummins et al. (1991); PMID 1995097NIH AIDS Reagent Program 3957WB (1:2000)
Antibodyanti-human-AF647 (goat polyclonal)ThermoFisherA21445WB (1:4000)
Antibodyanti-gp120 (sheep polyclonal)Hatch et al., 1992; PMID 1374448NIH AIDS Reagent Program 288WB (1:1000)
Antibodyanti-sheep-HRP (rabbit polyclonal)DakoP0163WB (1:20,000)
Antibodyanti-gp41 (human monoclonal)Zwick et al. (2001); PMID 11602729NIH AIDS Reagent Program 11557WB (1:1000)
Antibodyanti-human (goat polyclonal)ThermoFisher62–8420WB (1:10,000)
Antibodyanti-Nef (rabbit polyclonal)Shugars et al. (1993); PMID 8043040NIH AIDS Reagent Program 2949WB (1:1000)
Antibodyanti-Vpr (rabbit polyclonal)Dr. Jeffrey KoppNIH AIDS Reagent Program 11836WB (1:1000)
Antibodyanti-rabbit (goat polyclonal)ThermoFisher65–6120WB (1:10,000)
Antibodyanti-GFP (chicken polyclonal)Abcamab13970WB (1:1000)
Antibodyanti-chicken-HRP (goat polyclonal)ThermoFisherA16054WB (1:10,000)
Antibodyanti-STING (rabbit monoclonal)Cell Signaling Technologyclone D2P2F cat# 13647WB (1:500)
Antibodyanti-GBP5 (goat polyclonal)Dr. Frank Kicrhhoffsc-160353WB (1:500)
Antibodyanti-IFITM3 (rabbit polyclonal)Proteintech11714–1-APWB (1:1000)
Antibodyanti-Env 2G12 (human monoclonal)Buchacher et al. (1994); PMID 7520721NIH AIDS Reagent Program 1476neutralization (1 µg/mL)
Software, algorithmFlowJo 10BD10.6.1
Software, algorithmABI Sequence Detection SoftwareThermoFisher1.4
Software, algorithmImageQuant TLGE8.2.0
Software, algorithmPhotoshop CCAdobe20.0.6
Software, algorithmshRNA retrieverhttp://katahdin.mssm.edu/siRNA/RNAi.cgi?type=shRNA

Viruses, viral vectors, and expression plasmids

Request a detailed protocol

The following molecular clones were obtained via the AIDS Reagent Program: p89.6 [cat# 3552 from Dr. Ronald G. Collman), pNL4-3 (cat# 114 from Dr. Malcolm Martin), pREJO.c/2864 (cat# 11746 from Dr. John Kappes and Dr. Christina Ochsenbauer) and pYU2 (cat# 1350 from Dr. Beatrice Hahn and Dr. George Shaw). Vpr-null versions of 89.6, NL4-3, and YU2 were created by cutting the AflII site within vpr and filling in with Klenow fragment. The vpr-null version of REJO was created by doing the same at the AvrII site. A nef-null version of 89.6 was created by deleting nef from its start codon to the XhoI site. To do this, a PCR amplicon was generated from the XhoI site in env to env’s stop codon. The 3’ reverse primer added a XhoI site after the stop codon. The 89.6 genome and the amplicon were digested with XhoI and ligated together. (5’ primer CACCATTATCGTTTCAGACCCT and 3’ primer TCTCGAGTTTAAACTTATAGCAAAGCCCTTTCCA). The NL4-3 envYU2 chimera consists of the pNL4-3 plasmid in which the fragment from the KpnI site in env to the BamHI site in env has been replaced with the equivalent fragment of pYU-2. Because the KpnI site is not unique within the plasmid, the fragment from the SalI site to BamHI site (which are unique) was cloned into pUC19, the change was made in env, and the fragment from SalI to BamHI was inserted back into pNL4-3. To generate p89.6 N230D N339E a synthetic DNA sequence (ThermoFisher, Waltham, Massachusetts) was purchased commercially. The synthetic gene contained the following nucleotide mutations, counting from the start of 89.6 env: 694 A > G, 701 C > A, 1018 A > G, 1020 T > A. This sequence was substituted into p89.6 using the KpnI and BsaBI sites within env. pSIV3+, pSPAX2, pAPM-1221 and pMD2.G were obtained from Dr. Jeremy Luban (Pertel et al., 2011). pSIV3+ vpr-null was generated using a synthesized DNA sequence (ThermoFisher) containing a fragment of the SIV genome in which the Vpr start codon was converted to a stop codon (TAG). This was substituted into pSIV3+ using the sites BstBI and SapI. pYU2 env was obtained from Dr. Joseph Sodroski (Sullivan et al., 1995). Creation of pNL4-3 ∆GPE-GFP was described previously (Zhang et al., 2004; McNamara et al., 2012). Notably, the transcript containing the gfp gene retains the first 42 amino acids of env, including the signal peptide, which creates a fully fluorescent Env-GFP fusion protein. The vpr-Q65R mutant of NL4-3 ∆GPE-GFP was created using the Q5 site-directed mutagenesis kit from New England Biolabs (Ipswich, MA). The forward primer was AGAATTCTGCGACAACTGCTG and the reverse primer TATTATGGCTTCCACTCC. After synthesis by PCR, the entire provirus was confirmed by sequencing.

pCDNA.3.hMR was obtained from Dr. Johnny J. He (Liu et al., 2004). pPROA-3FLAG-UNG2-EYFP was obtained from Dr. Marit Otterlei (Akbari et al., 2010) and 3x FLAG tagged UNG2 was amplified using the 5’ primer CTAGCTCGAGACCATGGACTACAAAGACCATGAC, which added an XhoI site, and the 3’ primer GTTAACTCACAGCTCCTTCCAGTCAATGGGCTT, which added an HpaI site. The amplicon was cloned into the XhoI and HpaI sites of pMSCV IRES-GFP (Van Parijs et al., 1999) to generate pMSCV 3xFLAG UNG2 IRES-GFP.

Primary MDM and T cell isolation and culture

Request a detailed protocol

Leukocytes isolated from anonymous donors by apheresis were obtained from the New York Blood Center Component Laboratory. The use of human blood from anonymous, de-identified donors was classified as non-human subject research in accordance with federal regulations and thus not subjected to formal IRB review. Peripheral blood mononuclear cells (PBMCs) were purified by Ficoll density gradient. CD14+ monocytes were positively selected using a CD14 sorting kit (cat# 17858, StemCell Technologies, Vancouver, Canada) following the manufacturer’s instructions. Monocyte-derived macrophages (MDM) were obtained by culturing monocytes in R10 [RPMI-1640 with 10% certified endotoxin-low fetal bovine serum (Invitrogen, ThermoFisher), penicillin (100 Units/mL), streptomycin (100 μg/mL), L-glutamine (292 μg/mL), carrier-free M-CSF (50 ng/mL, R and D Systems, Minneapolis, Minnesota) and GM-CSF (50 ng/mL, R and D Systems)] for seven days. Monocytes were plated at 5 × 105 cells/well in a 24 well dish, except for those to be transduced with lentivirus and puromycin selected, which were plated at 1 × 106 cells/well.

CD4+ T lymphocytes were prepared from donor PBMCs as follows: anti-CD8 Dynabeads (cat# 11147D, ThermoFisher) were used to deplete CD8+ T lymphocytes and the remaining cells, which were mainly CD4+ lymphocytes, were maintained in R10 until the time of stimulation. Lymphocytes were stimulated with 5 μg/mL phytohemagglutinin (PHA-L, Calbiochem, Millipore Sigma, Burlington, Massachusetts) overnight before addition of 50 IU/mL recombinant human IL-2 (R and D Systems).

Cell lines

Request a detailed protocol

The 293T cell line was obtained from ATCC and independently authenticated by STR profiling. It was maintained in DMEM medium (Gibco) supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin, 2 mM glutamine (Pen-Strep-Glutamine, Invitrogen), 10% fetal bovine serum (Invitrogen), and 0.022% plasmocin (Invivogen). The MOLT-R5 cell line was obtained from the NIH AIDS Reagent Repository, which confirmed the lot is mycoplasma negative. It was maintained in RPMI-1640 medium (Gibco) supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin, 2 mM glutamine (Pen-Strep-Glutamine, Invitrogen), 10% fetal bovine serum (Invitrogen), and 0.022% plasmocin (Invivogen).

Silencing by shRNA

Request a detailed protocol

Sequences within MRC1 suitable for shRNA-based targeting were identified using the program available at http://katahdin.mssm.edu/siRNA/RNAi.cgi?type=shRNA maintained by the laboratory of Dr. Ravi Sachidanandam. The sequence chosen, 5’-AGTAACTTGACTGATAATCAAT-3’ was synthesized as part of larger DNA oligonucleotides with the sequences TCGAGAAGGTATATTGCTGTTGACAGTGAGCGAGTAACTTGACTGATAATCAATTAGTGAAGCCACAGATGTAATTGATTATCAGTCAAGTTACTTGCCTACTGCCTCGG (forward) and AATTCCGAGGCAGTAGGCAAGTAACTTGACTGATAATCAATTACATCTGTGGCTTCACTAATTGATTATCAGTCAAGTTACTCGCTCACTGTCAACAGCAATATACCTTC (reverse). These oligos were annealed, which created overhangs identical to those produced by digestion with the enzymes EcoRI and XhoI. This double stranded DNA oligomer was inserted into the EcoRI and XhoI sites of pAPM-1221 to generate pAPM-MRC1-C.

Short hairpin RNA-mediated silencing was performed as previously described (Pertel et al., 2011; Mashiba and Collins, 2013; Collins et al., 2015). Briefly, we spinoculated freshly isolated primary monocytes with VSV-G-pseudotyped SIV3+ vpr-null at 2500 rpm for 2 hr with 4 μg/mL polybrene to allow Vpx-dependent degradation of SAMHD1. Cells were then incubated overnight in R10 with M-CSF (50 ng/mL) and GM-CSF (50 ng/mL) plus VSV-G-pseudotyped lentivirus containing an shRNA cassette targeting luciferase (pAPM-1221 or ‘shNC’) or MR (pAPM-MRC1-C or ‘shMR’). The following day, media was removed and replaced with fresh R10 with M-CSF (50 ng/mL) and GM-CSF (50 ng/mL). Three days later 10 μg/mL puromycin was added and cells were cultured for three additional days prior to HIV-1 infection. shRNA target sequences used: Luciferase: 5'-TACAAACGCTCTCATCGACAAG-3', MRC1: 5’-ATTGATTATCAGTCAAGTTACT-3’.

Virus production

Request a detailed protocol

Virus stocks were obtained by transfecting 293T cells (ATCC, Manassas, Virginia) with viral DNA and polyethylenimine (PEI). Cells were plated at 2.5 × 106 cells per 10 cm dish and incubated overnight. The following day 12 µg of total DNA was combined with 48 µg of PEI, mixed by vortexing, and added to each plate of cells. For NL4-3 ∆GPE-GFP, cells were transfected with 4 µg viral genome, 4 µg pCMV-HIV, and 4 µg pHCMV-V (VSV-G expression plasmid). For SIV3+ vpr-null the cells were transfected with 10.5 µg of viral genome and 1.5 µg pHCMV-V. For shLentivirus (shNC or shMR) cells were transfected with 6 µg pAPM-1221 or pAPM-MRC1-C, 4.5 µg pSPAX2, and 1.5 µg pMD2.G. Viral supernatant was collected 48 hr post-transfection and centrifuged at 1500 rpm (500 x g) 5 min to remove cellular debris. SIV3+ vpr-null was pelleted by centrifugation at 14,000 rpm (23,700 x g) for 4 hr at 4°C and resuspended at 10x concentration. Virus stocks were aliquoted and stored at −80°C.


Request a detailed protocol

Co-transfections of HIV and MR or UNG2 were performed in 293T cells. Cells were plated at 1.6 × 105 per well in a 12-well dish. The following day 10 ng of pcDNA.3.hMR or 10 ng of pMSCV 3xFLAG UNG2 IRES-GFP, 250 ng of NL4-3 ∆GPE-GFP, and 740 ng pUC19 plasmid was combined with 4 µg PEI, mixed by vortexing, and added to each well. 48 hr later, cells were lifted using enzyme free cell dissociation buffer (ThermoFisher, cat# 13150016) and analyzed by flow cytometry or lysed in 500 µL blue loading buffer (cat# 7722, Cell Signaling Technology, Danvers, Massachusetts) and analyzed by western blot.

HIV infections of MDM

Request a detailed protocol

Prior to infection, 500 µL of medium was removed from each well and this ‘conditioned’ medium was saved to be replaced after the infection. MDM were infected by equal inocula of HIV as measured by Gag p24 mass in 500 µL of R10 for 6 hr at 37°C. After 6 hr, infection medium was removed and replaced with a 1:2 mixture of conditioned medium and fresh R10. Where indicated, HIV spread was blocked by AMD3100 (10 µg/mL, AIDS Reagent Program cat# 8128) and/or maraviroc (20 µM, AIDS Reagent Program cat# 11580) added 48 hr post-infection and replenished with each media change every three days.

Spin transduction of MDM with NL4-3 ∆GPE-GFP

Request a detailed protocol

MDM were centrifuged at 2500 rpm (1049 x g) for 2 hr at 25°C with equal volume of NL4-3 ∆GPE-GFP or an isogenic mutant in 500 uL total medium. Following infection, medium was removed and replaced with a 1:2 mixture of conditioned medium and fresh R10.

Adenoviral transduction of MDM

Request a detailed protocol

Adenovirus was prepared by the University of Michigan Vector Core, and the transduction of MDM was performed as previously described (Leonard et al., 2011) at an MOI of 1000 based on 293T cell infection estimations and the concentration of particles as assessed by OD280.

Infection of T cells

Request a detailed protocol

Activated T cells were infected by two methods as indicated. For direct infection, 5 × 105 cells were plated per well with 50 µg HIV p24 in 500 µL R10 +50IU/mL of IL-2 and incubated at 37°C for 48 hr. For co-culture with autologous, infected MDM medium was removed from MDM wells and 5 × 105 T cells were added in 1mL R10 + 50IU/mL of IL-2. All T cell infections were collected 48 hr post infection.

Flow cytometry

Request a detailed protocol

Intracellular staining of cells using antibodies directed against HIV Gag p24, MR and FLAG-UNG2 was performed by permeabilizing paraformaldehyde-fixed cells with 0.1% Triton-X in PBS for 5 min, followed by incubation with antibody for 20 min at room temperature. For Gag and MR, PE-conjugated primary antibodies were used. For FLAG-UNG2, cells were stained with a PE-conjugated goat anti-mouse IgG1 secondary antibody for 20 min at room temperature. Surface staining for CD4, CD3 and CD14 was performed before fixation as described previously (Collins et al., 2015). Flow cytometric data was acquired using a FACSCanto instrument with FACSDiva collection software (BD, Franklin Lakes, New Jersey) or a FACScan (Cytek, BD) with FlowJo software (TreeStar, Ashland, Oregon) and analyzed using FlowJo software. Live NL4-3 ∆GPE-GFP transduced cells were sorted using a FACSAria III (BD) or MoFlo Astrios (Beckman Coulter) and gating on GFP+ cells.

Quantitative RT-PCR

Request a detailed protocol

MDM sorted as described above in ‘Flow cytometry’ were collected into tubes containing RLT buffer (Qiagen, Hilden, Germany) and RNA was isolated using RNeasy Kit (Qiagen) with on-column DNase I digestion. RNA was reverse transcribed using qScript cDNA SuperMix (Cat #95048, Quantabio, Beverly, Massachusetts). Quantitative PCR was performed using TaqMan Gene Expression MasterMix (ThermoFisher, cat# 4369016) on an Applied Biosystems 7300 Real-Time PCR System using TaqMan Gene Expression primers with FAM-MGB probe. The primer/probe sets for ACTB (Hs99999903), MRC1 (Hs00267207), POL2A (Hs02786624), and GAPDH (Hs00172187) were purchased from ThermoFisher. Reactions were quantified using ABI Sequence Detection software compared to serial dilutions of cDNA from mock-treated cells. Measured values for all genes were normalized to measured values of GAPDH or ACTB as indicated.


Request a detailed protocol

MDM cultures were lysed in Blue Loading Buffer (cat# 7722, Cell Signaling Technology), sonicated with a Misonix sonicator (Qsonica, LLC., Newtown, Connecticut), boiled for 5 min at 95°C and clarified by centrifugation at 8000 RPM (7,000 x g) for 3 min. Lysates were analyzed by SDS-PAGE immunoblot. The proteins MR, GAPDH and pr55 were visualized using AlexFluor-647 conjugated secondary antibodies on a Typhoon FLA 9500 scanner (GE, Boston, Massachusetts) and quantified using ImageQL (GE). The proteins gp160, gp120, gp41, Nef, Vpr, GFP, Env-GFP, STING, GBP5, and IFITM3 were visualized using HRP-conjugated secondary antibodies on film. Immunoblot films were scanned and the mean intensity of each band, minus the background, was calculated using the histogram function of Photoshop CC (Adobe, San Jose, California).

Virion quantitation

Request a detailed protocol

Supernatant containing viral particles was lysed in Triton X lysis buffer (0.05% Tween 20, 0.5% Triton X-100, 0.5% casein in PBS). Gag p24 antibody (clone 183-H12-5C, AIDS Reagent Program cat# 1519 from Dr. Bruce Cheseboro and Dr. Hardy Chen) was bound to Nunc MaxiSorp plates (ThermoFisher cat# 12-565-135) at 4°C overnight. Lysed samples were captured for 2 hr and then incubated with biotinylated antibody to Gag p24 (clone 31-90-25, ATCC cat# HB-9725) for 1 hr. Clone 31-90-25 was biotinylated with the EZ-Link Micro Sulfo-NHS-Biotinylation Kit (ThermoFisher cat# PI-21925). Clones 31-90-25 and 182-H12-5C were purified using Protein G columns (GE Healthcare, cat# 45-000-054) following the manufacturer’s instructions. Samples were detected using streptavidin-HRP (Fitzgerald, Acton, Massachusetts) and 3,3′,5,5′-tetramethylbenzidine substrate (Sigma cat# T8665-IL). CAp24 concentrations were measured by comparison to recombinant CAp24 standards (cat# 00177 V, ViroGen, Watertown, Massachusetts).


Antibodies to CAp24 (clone KC57-PE cat# 6604667 and KC57-FITC cat# 6604665, Beckman Coulter, Brea, California), CD3 (clone OKT3-Pacific Blue, cat# 317313, BioLegend, San Diego, California), CD14 (clone HCD14-APC, cat# 325608, BioLegend), CD4 (clone OKT4, cat#17-0048-42, Invitrogen, ThermoScientific), FLAG (clone M2, cat#F3165, Sigma), and MR (clone 19.2-PE, cat# 555954, BD) were used for flow cytometry. Antibodies to the following proteins were used for immunoblot analysis: MR (cat# ab64693, Abcam, Cambridge, Massachusetts), GAPDH (clone 3C2, cat# H00002597-M01, Abnova, Taipei, Taiwan), Gag pr55 (HIV-Ig AIDS Reagent Program cat# 3957), Env gp160/120 (AIDS Reagent Program cat# 288 from Dr. Michael Phelan), 89.6 and YU-2 Env gp41 (clone z13e1, AIDS Reagent Program cat# 11557 from Dr. Michael Zwick), NL4-3 Env gp41 (clone CHESSIE-8, AIDS Reagent Program cat# 526 from Dr. George Lewis), Vpr (AIDS Reagent Program cat# 3951 from Dr. Jeffrey Kopp), GFP (cat# ab13970, Abcam), Nef (AIDS Reagent Program cat# 2949 from Dr. Ronald Swanstrom), FLAG (clone M2, cat# F3165, Sigma), STING (D2P2F, cat# 13647, Cell Signaling Technology), GBP5 (sc-160353, which was a generous gift from Dr. Frank Kirchhoff), and IFITM3 (cat# 11714–1-AP, Proteintech, Rosemont, IL). Neutralizing antibody 2G12 (AIDS Reagent Program cat# 1476 from Dr. Hermann Katinger) was used at a 1 μg/mL at the time of infection. Antibody clone CHESSIE-8 was purified using Protein G columns (GE Healthcare, cat# 45-000-054) following the manufacturer’s instructions.

Data availability

The study did not generate large data sets. All necessary data are included in figures.


    1. Emmelkamp JM
    2. Rockstroh JK
    CCR5 antagonists: comparison of efficacy, side effects, pharmacokinetics and interactions-review of the literature
    European Journal of Medical Research 12:409–417.
    1. Hatch WC
    2. Tanaka KE
    3. Calvelli T
    4. Rashbaum WK
    5. Kress Y
    6. Lyman WD
    Persistent productive HIV-1 infection of a CD4- human fetal thymocyte line
    Journal of Immunology 148:3055–3061.
    1. Lennartz MR
    2. Cole FS
    3. Stahl PD
    Biosynthesis and processing of the mannose receptor in human macrophages
    The Journal of Biological Chemistry 264:2385–2390.
    1. Leonard CK
    2. Spellman MW
    3. Riddle L
    4. Harris RJ
    5. Thomas JN
    6. Gregory TJ
    Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 recombinant human immunodeficiency virus envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells
    The Journal of Biological Chemistry 265:10373–10382.
    1. Lu YL
    2. Spearman P
    3. Ratner L
    Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions
    Journal of Virology 67:6542–6550.
    1. Reading CL
    2. Penhoet EE
    3. Ballou CE
    Carbohydrate structure of vesicular stomatitis virus glycoprotein
    The Journal of Biological Chemistry 253:5600–5612.
    1. Shibata Y
    2. Metzger WJ
    3. Myrvik QN
    Chitin particle-induced cell-mediated immunity is inhibited by soluble mannan: mannose receptor-mediated phagocytosis initiates IL-12 production
    Journal of Immunology 159:2462–2467.

Decision letter

  1. Julie Overbaugh
    Reviewing Editor; Fred Hutchinson Cancer Research Center, United States
  2. Satyajit Rath
    Senior Editor; Indian Institute of Science Education and Research (IISER), India

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This paper ties together observations that HIV replicates to low levels in monocytes and that the accessory gene vpr plays a role in this lower replication with recent findings that vpr counteracts a macrophage specific factor that targets Env. As a result, expression of Vpr increases steady-state levels of Env in infected macrophages. The present study focused on the mannose receptor, which was previously shown to bind HIV Env and is highly expressed in macrophages. Here they show that vpr downregulates mannose receptor expression, thereby avoiding an innate response driven by this receptor and increasing Env expression and HIV replication. Given that macrophages are an important cell type for HIV replication in vivo, this study advances our understanding of how virus replication is regulated in this key host cell of HIV.

Decision letter after peer review:

Thank you for sending your article entitled "Mannose receptor is a restriction factor of HIV in macrophages and is counteracted by the accessory protein Vpr" for peer review at eLife. Your article is being evaluated by 3 peer reviewers, and the evaluation is being overseen by a Reviewing Editor and Satyajit Rath as the Senior Editor.

This work from Lubow et all seeks to build on previous publications from the lab and identify an antiviral restriction factor of HIV in macrophage cells that is overcome by the accessory gene Vpr. They identified Manose Receptor (MR) as a target of both Vpr and Nef. They focus on Vpr because this role of Nef has been described and Vpr appears to have a similar level of effect as Nef. The authors make a solid case that MR affects Env expression in the absence of Vpr and Nef and that MR is responsible for limiting virus spread from MDM to T cells in the absence of Vpr. The overall finding is interesting although the results are disjointed at times – changes of virus types that make it harder to tell what is driving differences and some key controls are needed. But overall, with proper controls, the study identifies an interest virus/host cell interaction that may help explain aspects HIV replication in macrophages

The reviewers were generally positive but had a fairly long list of major concerns that would need to be addressed. Some common and important themes of the reviewers include: Some controls are needed, including for the degradation assay such as including a Vpr mutant control and a substrate control. Controls, transparency of the data were common themes of the reviews that need to be addressed. A more balanced view of the role of Nef and Vpr in this activity given Nef effect is at least as potent as Vpr so if it is modest, then Vpr is also modest. Figure 7 should be removed as it is peripheral and based on limited data. Ideally, including studies with more relevant viruses would strengthen the paper and at the very least, describing this limitation in the studies and the fact that different viruses were used for different experiments, which could confound interpretation in the Discussion. Likewise, statements about the work explaining vpr conservation seem unfounded overall, and even more so given the viruses tested, so these reviewers' issues needed to be addressed. Statistical tests should be applied to support conclusions where appropriate. Also, many errors were evident in the figures and legends and these should be looked at carefully.

Reviewer #1:

This paper pulls together observations that HIV replicates to low levels in monocytes and that vpr plays a role in this lower replication with recent findings that vpr counteracts a macrophage specific factor that targets Env. The present study focused on the mannose receptor, which was previously shown to bind HIV Env and is highly expressed in macrophages. Here they show that vpr downregulates MR expression, thereby avoiding an innate response driven by this receptor and increasing HIV replication. The overall finding is interesting although the results are disjointed at times – changes of virus types that make it harder to tell what is driving differences, a study of T cell infection that seems peripheral, as discussed below.

1) The author suggests Figure 5E shows differences in infectivity of select mutants. That is not evident from the figure as differences are subtle and less than two fold and there are no significant differences indicated. If the differences are not statistically significant the authors should tone down these claims that MR is important for entry/replication throughout. This would include removing –the end of the fifth paragraph of the Discussion.

2) In the shMR cells, it would be nice to see a traditional virus replication study to get a better sense of the KO effects, rather than a single time point since this is an important part of the paper.

3) I don't understand how Figure 7 fits in this study. It does not examine the MR or vpr and it now shifts to the study of T/F viruses, which are not used elsewhere (which is too bad – see below). It seems like an ad on. Related to that, the second paragraph of the Discussion does not appear to be accurate as they did not demonstrate effects of vpr and MR on virus spread to T cells. If they want to do the experiments to show this, that would be a good addition and allow for some nice conclusions and strengthen the paper. Otherwise the T cell spread aspect and Figure 7 should be removed. And the last paragraph of the Discussion.

4) 89.6 is such a weird HIV variant, it would be nice to see this using a virus that is actually representative of circulating macrophage-tropic viruses. Likewise, for NL4.3 – very culture adapted. This may be especially relevant given YU2 behaves differently from these viruses, which may or may not be due to the mannose patch differences since there are many other glycans on env. Making vpr and nef mutants and even the mannose patch mutants in REJO or a similar stain and showing and testing them in wt versus shMR cells would help tie this story together. The changing of strains for different experiments makes interpretations more difficult and a clean set of key experiments with one macrophage tropic virus that is not highly adapted in culture would make this a stronger paper.

Reviewer #2:

This work from Lubow et all seeks to build on previous publications from the lab and identify an antiviral restriction factor of HIV in macrophage cells that is overcome by the accessory gene Vpr. They identified Manose Receptor (MR) as a target of both Vpr and Nef. While the data is overall convincing to support repression of MR by both Vpr and Nef, the authors chose to focus on Vpr and largely ignore Nef, even though it has a greater effect on MR levels. Moreover, the mechanistic details of how Vpr alters MR are very underdeveloped, as are their investigations into how MR inhibits Env and virion production. Finally, the overall flow of the paper was disjointed, and felt like two partially complete studies fused into one. In summary, while the data showing that both Vpr and Nef downregulate MR expression are convincing, the mechanistic insights into how and why this is achieved by two distinct lentiviral accessory proteins is lacking. This would help to make the paper more well-rounded and complete.

1) It is difficult to assess whether the effect of Vpr on MR/MRC1 is direct, or simply due to the many cellular effects of Vpr expression. Moreover, the authors do not sufficiently investigate how Vpr inhibits MR expression. For example:

a) In Figure 1, the authors screened "candidate Env binding proteins" but only show data for MR. It would help to show additional candidates to highlight the specificity of MR degradation.

b) In Figure 2, roughly 20-45% of GFP+ (HIV infected cells) have decreased MR despite being targeted by two viral proteins – why is this, and what does it suggest about MR downregulation?

c) In Figure 2 and Figure 2—figure supplement 1 the authors use an overexpression assay in 293T cells and qRT-PCR of MRC1 to suggest that MR is not degraded by Vpr, however no controls for their degradation assay are shown (such as UNG), no western blots to show expression of MR or Vpr are shown, and only MRC1 mRNA levels are looked at, which is concerning given the large effects of Vpr on cellular transcription.

2) Figures 2 and 3 clearly show that Nef functions slightly better than Vpr at inhibiting MR expression, yet the authors state that the effect of Nef is "modest" and "the effect of Nef alone was relatively small". Subsequently, Nef is largely ignored throughout the rest of the manuscript. It would be beneficial for the authors to clearly demonstrate why they think Vpr, and not Nef, is the primary driver of the observed phenotypes.

3) There are experimental details and controls missing throughout the manuscript. While some of these are minor on their own, given that much of the data is normalized, this lack of transparency and controls makes the data difficult to truly assess overall.

Some examples: a) "Relative p24 release" is shown for many of the later figures, when p24 or GFP is used in early figures. Why is p24/GFP not shown throughout?

b) Many of the figures rely on quantification of western blots; however, HRP was used for many panels and compared to AlexaFluor antibodies. HRP is not a quantitative reagent, and should not be used as such.

c) Loading controls are missing from some western blots (ex 3A, 3E, 5C, 5I, etc).

d) MDMs are differentiated using both M-CSF and GM-CSF; this is concerning as those cytokines lead to different macrophage phenotypes (such as highlighted here https://www.jimmunol.org/content/188/11/5752). Figure 1 shows MDMs more like GM-CSF MDMs, but Figure 6 indicates MDMs that sit somewhere in the middle. In addition, the MDMs seem to be CD3 positive (Supplementary Figure 2), which they should not be.

e) It is unclear why the authors use 10-day single round infections, which is unconventional. Moreover, the authors do not explain their methodology. For example, are the entry inhibitors replenished in the 8 days between their addition and experimental completion? It is highly doubtful the inhibitors can last for 8 days, so if they are not changed then the infection will not likely be single round.

f) Different y-axis scales are used even when discussing the same assay like p24 ELISA results (i.e. 4A vs. 4E.). Sometimes log 10, log 2, or linear…

g) Figure 7 is n=1 donor. Given the slight differences observed, given how variable different donor primary cells can be, and given the conclusions generated from this figure, this must be repeated with multiple donors.

4) The authors repeatedly use 293T cells as a control to show the observed effects are macrophage specific. However, 293Ts are highly transformed, rapidly cycling, lab adapted cells that do not make a good biological control cell when comparing to primary MDMs. THP-1 +/- PMA (to show cycling vs. non-cycling monocytic cell lines) or even primary T cells would be a better control to allow for biologically relevant conclusions.

5) I am wrestling with the biological significance of MR in HIV replication, spread, and evolution, especially given the statement that this work "provide(s) an explanation for the evolutionary conservation of Vpr"… The authors highlight the lack of manose patch naturally found in the macrophage-tropic YU-2 HIV isolate. If this is indeed a central target of MR and YU-2 has evolved without the manose patch in order to circumvent this restriction, then one would assume other macrophage-tropic viruses would also be selected to have lost similar glycan structures to increase viral fitness and avoid MR restriction. Have the authors looked for this? That said, if macrophage-tropic viruses are more fit by losing the manose patch to avoid MR, then why would two accessory genes (Vpr and Nef) be needed to deplete MR through two potentially independent mechanisms? Have the authors looked at Vpr and Nef from these macrophage-tropic viruses to see if they still inhibit MR expression? This might help explain the potential discrepancy.

Reviewer #3:

The authors previously reported that HIV-1 Vpr counteracts an unidentified macrophage-specific factor that targets Env and Env-containing virions for lysosomal degradation. Thus, expression of Vpr increases steady-state levels of Env in infected MDM. In the current study, the authors investigate the possible involvement of mannose receptor (MR). MR expression was previously shown to be downmodulated in HIV-infected MDM and HIV Tat and Nef were implicated in this phenomenon. Tat was proposed to cause transcriptional repression of the MR promoter whereas Nef was shown to cause cell-surface downmodulation of MR without effect on MR steady-state levels. Here the authors confirm the reported effect of Nef on MR surface expression. The authors did not specifically look at a possible inhibitory effect of Tat on MR transcription and, as far as I am concerned, their data do not categorically rule out a contribution of Tat. However, the data presented here are indeed more consistent with the authors' conclusion that it is Vpr that induces transcriptional repression of MR. Somewhat surprisingly, Vpr appeared to be sufficient to cause efficient inhibition of MR expression in MDM in a spreading infection experiment (Figure 1C), but had only a partial effect on MR surface expression in a single cycle infection study (Figure 2D) and required the additional presence of Nef for efficient downmodulation of MR. I am not quite sure what to make of that. Nevertheless, the authors go on to demonstrate that the previously reported effect of Vpr on Env expression involves MR and silencing of MR reduced the requirement for Vpr for efficient Env expression. Overall, this is an interesting study that is timely and provides novel insights into the interplay of Env, Vpr, Nef, and mannose receptor. The authors make a convincing case that MR affects Env expression in the absence of Vpr and Nef and that MR is responsible for limiting virus spread from MDM to T cells in the absence of Vpr. The manuscript is well written and the experiments are for the most part well-designed and executed. I do have a few issues as detailed below that require the authors attention.

1) Figure 1: Multiple studies have documented that replication of Vpr-deficient HIV-1 in macrophages is severely restricted when compared to wild type (wt) virus (e.g. Connor et al., 1995). I find it therefore astonishing that in panels C and E of Figure 1, there is only a minor difference in the pr55 levels of cells infected with wt and vpr-null virus. At 10 days post infection I would have expected a much larger difference in the Gag levels. In the figure legend and in the text the authors talk about "matched infection frequencies" but they don't explain how this was accomplished.

2) Also, I find it interesting that the authors go out of their way to document differences in Env levels by showing not only gp160 (the Env equivalent of pr55) but, in addition gp120 and gp41. Yet, they don't show p24 (CA). Showing the entire Gag blots (or at least inclusion of CA) might be informative since p24 antibodies typically have a higher affinity to p24 than to the pr55 precursor.

3) How does the strong reduction of MR in Figure 1C at the protein level by just Vpr fit with the data from Figure 2D where both Nef and Vpr were required for efficient cell-surface down-modulation of MR in a single round infection?

4) Figure 2D and G: How do the authors explain that only a subset of GFP+ cells downregulate MR? They skirt this issue both in the text and in the Discussion. In their Discussion, the authors make a statement concerning the importance of Env expression for Vpr-sensitive restriction in MDM. Since the construct used here is Env-defective, cells should be stained for intracellular p24 to see whether the Gag expression pattern matches that of GFP or MR (obviously it can't be both).

5) Figure 1—figure supplement 1: The authors should include a Q65R mutant of Vpr in the analysis to strengthen the argument that Vpr-mediated downmodulation of MR is DCAF1-independent.

6) Figure 3C/D: Donor 2: The% Gag-positive cells on day 10 is almost identical for wt and vpr-null samples. In contrast, virus output in panel D on day 10 is significantly lower for the vpr-null virus. Does that mean virus spreads mostly in a cell-to-cell manner in MDM? Does it correlate with low MR levels?

7) Nef does a lot of things but I am not aware of any literature reporting an effect of Nef on Env stability. What did I miss?

8) Figure 3E: Deletion of Nef alone reduces Env expression almost as much as deleting both Nef and Vpr. How can this be explained? Is it correlated with effect on MR expression? A MR western blot should be included here. But even if the effect of Nef deletion involves MR how can this work if Nef only affects MR surface expression and not total cellular pool of MR?

9) Figure 5I: The authors conclude from this experiment that MR restricts Env expression via direct interaction with high-mannose residues on Env. Where in the cell is this happening? What happens if cells are treated with Brefeldin A, which traps Env and MR in the ER? Will it exacerbate/alleviate the effect of MR on Env?

10). “MR is the restriction factor”.… – I would suggest softening this statement to "MR is a restriction factor".

11) Discussion: "In the primary macrophage system, Vpr-sensitive virion restriction depends entirely on an intact env open reading frame (Mashiba et al., 2014)". What are the implications of this statement for the data shown in Figure 2 where Env was replaced by GFP?

12) Discussion:" The magnitude of the effect and the fraction of cells affected increased when both proteins were expressed". What does the "fraction of cells" statement mean? Are the authors suggesting that this is an "either-or" phenomenon where Nef downmodulates MR in one fraction of the cells and Vpr does the same but in another fraction and only together do we see downmodulation in the two fractions combined? That would be fantastic from a mechanistical point of view and would explain the results from but is very unrealistic, I am afraid.

13) The fourth paragraph of the Discussion is somewhat trivial and can be deleted without loss to content and clarity of the paper. Instead, the authors should simply include the Q65R control as suggested for Figure 1—figure supplement 1 above. That's a quick and easy experiment to do.


Author response

Reviewer #1:

This paper pulls together observations that HIV replicates to low levels in monocytes and that vpr plays a role in this lower replication with recent findings that vpr counteracts a macrophage specific factor that targets Env. The present study focused on the mannose receptor, which was previously shown to bind HIV Env and is highly expressed in macrophages. Here they show that vpr downregulates MR expression, thereby avoiding an innate response driven by this receptor and increasing HIV replication. The overall finding is interesting although the results are disjointed at times – changes of virus types that make it harder to tell what is driving differences, a study of T cell infection that seems peripheral, as discussed below.

1) The author suggests Figure 5E shows differences in infectivity of select mutants. That is not evident from the figure as differences are subtle and less than two fold and there are no significant differences indicated. If the differences are not statistically significant the authors should tone down these claims that MR is important for entry/replication throughout. This would include removing –the end of the fifth paragraph of the Discussion.

In revised Figure 6E (was 5E in the first draft), data from MDM from 6 independent donors are compiled. They show that infection by the mannose-depleted Env mutant is consistently reduced about 40% compared to the wild-type Env and that these differences are statistically significant in MDM but not in MOLT4-R5 T cells, which lack MR. Additionally, our claim is supported by Figure 5F showing that mannan inhibits infection of MR-expressing macrophages, but not infection of the MOLT4-R5 T cell line. Moreover, we show that VSV-G pseudotyping HIV rescues this inhibition, which makes sense as VSV-G is not mannosylated.

2) In the shMR cells, it would be nice to see a traditional virus replication study to get a better sense of the KO effects, rather than a single time point since this is an important part of the paper.

As shown in Figure 6 and discussed above, MR has both positive and negative effects on infection; our data indicate it is a positive factor for entry and a negative factor for egress, which is somewhat analogous to CD4 and chemokine receptors in the sense that they are needed for entry but can interfere with viral egress and spread. Thus, the effects of silencing on overall infection are complicated to interpret. Some donors had increased infection resulting from MR silencing whereas others had a small decrease at the ten-day time point. Variations in baseline MR expression likely also contributed to a degree of heterogeneity in our results. We added a paragraph in the Discussion to address this interesting point.

3) I don't understand how Figure 7 fits in this study. It does not examine the MR or vpr and it now shifts to the study of T/F viruses, which are not used elsewhere (which is too bad – see below). It seems like an ad on. Related to that, the second paragraph of the Discussion does not appear to be accurate as they did not demonstrate effects of vpr and MR on virus spread to T cells. If they want to do the experiments to show this, that would be a good addition and allow for some nice conclusions and strengthen the paper. Otherwise the T cell spread aspect and Figure 7 should be removed. And the last paragraph of the Discussion.

In response to the reviewer’s concern, we added Vpr data and moved these results as they largely confirmed findings from a prior study (Collins et al., 2015). These data are now included in Figure 7—figure supplement 1. In addition, we added data from additional donors to revised Figure 7, which strengthened our conclusion that Vpr modulated spread from macrophages to T lymphocytes in an MR-dependent manner.

4) 89.6 is such a weird HIV variant, it would be nice to see this using a virus that is actually representative of circulating macrophage-tropic viruses. Likewise, for NL4.3 – very culture adapted. This may be especially relevant given YU2 behaves differently from these viruses, which may or may not be due to the mannose patch differences since there are many other glycans on env. Making vpr and nef mutants and even the mannose patch mutants in REJO or a similar stain and showing and testing them in wt versus shMR cells would help tie this story together. The changing of strains for different experiments makes interpretations more difficult and a clean set of key experiments with one macrophage tropic virus that is not highly adapted in culture would make this a stronger paper.

In previously published work, we demonstrated that 89.6, NL4-3 and AD8 behave similarly with respect to these assays. In other words, Vpr from each of these molecular clones similarly stabilizes Env, promotes virion release and stimulates spread from T cells to macrophages (Mashiba et al., 2014) and (Collins et al., 2015). In the revised manuscript, we provide new data on the transmitter/founder virus REJO that demonstrate it behaves similarly.

Thus far, YU2 is the only variant we have tested that has a diminished requirement for Vpr in macrophages and this property may be unique to this molecular clone. We show here that genetically altering the mannose patch on 89.6 so that it mirrored changes in the YU-2 mannose patch altered the behavior of 89.6 to resemble that of YU-2 with respect to Vpr phenotypes. This is strong evidence supporting our model that Vpr alleviates deleterious interactions caused by the Env mannose patch. Interestingly, YU-2 was cloned from the central nervous system (CNS) and 89.6 was directly cloned from peripheral blood. Because the blood-brain barrier limits exposure to antibodies, CNS isolates may have a diminished requirement for high mannose residues, which protect from antibody responses. We have revised the Discussion to include these points. In future experiments we will commit a focused effort towards examining a panel of CNS-derived HIV isolates to further test this interesting hypothesis.

Reviewer #2:

This work from Lubow et all seeks to build on previous publications from the lab and identify an antiviral restriction factor of HIV in macrophage cells that is overcome by the accessory gene Vpr. They identified Manose Receptor (MR) as a target of both Vpr and Nef. While the data is overall convincing to support repression of MR by both Vpr and Nef, the authors chose to focus on Vpr and largely ignore Nef, even though it has a greater effect on MR levels. Moreover, the mechanistic details of how Vpr alters MR are very underdeveloped, as are their investigations into how MR inhibits Env and virion production. Finally, the overall flow of the paper was disjointed, and felt like two partially complete studies fused into one. In summary, while the data showing that both Vpr and Nef downregulate MR expression are convincing, the mechanistic insights into how and why this is achieved by two distinct lentiviral accessory proteins is lacking. This would help to make the paper more well-rounded and complete.

1) It is difficult to assess whether the effect of Vpr on MR/MRC1 is direct, or simply due to the many cellular effects of Vpr expression. Moreover, the authors do not sufficiently investigate how Vpr inhibits MR expression. For example:

a) In Figure 1, the authors screened "candidate Env binding proteins" but only show data for MR. It would help to show additional candidates to highlight the specificity of MR degradation.

In revised Figure 1—figure supplement 1, we provide these data, which provide evidence for a selective effect of Vpr on MR. We also provide additional RNA data for cellular genes other than MR that supports this conclusion (Figures 3 and Figure 3—figure supplement 1).

b) In Figure 2, roughly 20-45% of GFP+ (HIV infected cells) have decreased MR despite being targeted by two viral proteins – why is this, and what does it suggest about MR downregulation?

The reviewer is correct about these results collected 5 days post transduction. Western blot analysis of whole cell lysates from our ten-day culture (Figure 1D) suggests more uniform effects at longer time points and suggest MR downregulation is time-dependent in macrophages, which tolerate HIV infection for weeks. This time dependency is potentially explainable in part by very long half-life of MR (33 hours) (Lennartz, Cole and Stahl, 1989). Additionally, as we mention in the Discussion, MR is present at very high levels on macrophages (100,000 per cell) and it is likely that Vpr and Nef both require high level expression to achieve maximal effect.

c) In Figure 2 and Figure 2—figure supplement 1 the authors use an overexpression assay in 293T cells and qRT-PCR of MRC1 to suggest that MR is not degraded by Vpr, however no controls for their degradation assay are shown (such as UNG), no western blots to show expression of MR or Vpr are shown, and only MRC1 mRNA levels are looked at, which is concerning given the large effects of Vpr on cellular transcription.

An updated Figure 2—figure supplement 1 contains flow cytometry data and western blots demonstrating that under the conditions of our expression assay in 293T cells, Vpr degrades UNG2 but has no effect on MR.

As mentioned above, the qPCR data examining MR RNA expression in primary human macrophages have been strengthened significantly. We extended our analysis to additional cellular genes (GAPDH and POL2A) and increased the number of donors tested. We consistently observed that Vpr expression reduced MR mRNA levels but did not alter those of GAPDH or POL2A.

2) Figures 2 and 3 clearly show that Nef functions slightly better than Vpr at inhibiting MR expression, yet the authors state that the effect of Nef is "modest" and "the effect of Nef alone was relatively small". Subsequently, Nef is largely ignored throughout the rest of the manuscript. It would be beneficial for the authors to clearly demonstrate why they think Vpr, and not Nef, is the primary driver of the observed phenotypes.

Our conclusions are based on the compiled data, which summarizes results from multiple donors. Across 7 donors as shown in Figure 2E, the difference between Vpr and Nef-null viral mutants was not statistically significant. Our data indicate that both Vpr and Nef are required for MR downmodulation, but neither is sufficient. Compared to the Vpr-Nef-null double mutant, the Vpr-null mutant (which has Nef) had a small effect, as did the Nef-null mutant (which has Vpr). The results have been re-written to make this point clearer and the representative image in Figure 2D is more reflective of the compiled data.

While both Vpr and Nef play a role in MR downmodulation, the discovery of this role for Vpr has not been previously reported whereas Nef’s effects on MR are not novel. Thus, we focused on Vpr.

3) There are experimental details and controls missing throughout the manuscript. While some of these are minor on their own, given that much of the data is normalized, this lack of transparency and controls makes the data difficult to truly assess overall.

Some examples: a) "Relative p24 release" is shown for many of the later figures, when p24 or GFP is used in early figures. Why is p24/GFP not shown throughout?

GFP is used in our single round infections shown in Figure 2 to identify the subset of cells that are infected by flow cytometry. Our full length, wild type viruses do not include any marker genes, so GFP cannot be used in any subsequent figures. In these cases, we use intracellular Gag in place of GFP to identify infected cells and this allows us to determine a rough assessment of “burst size” (p24 produced per infected cell frequency). In most figures the p24 production and infection rates varied significantly across donors, but p24 release per cell was always lower in the mutants than the wild type. To show this result clearly, all values for the mutants were normalized to Wt before being compiled. To improve transparency, the revised manuscript includes raw p24 ELISA and Gag+ frequency data. The corresponding data for Figures 5 and 6 are provided in Figure 5—figure supplement 1 and Figure 6—figure supplement 1 respectively. For Figure 4, these data were provided as part of the main figure.

b) Many of the figures rely on quantification of western blots; however, HRP was used for many panels and compared to AlexaFluor antibodies. HRP is not a quantitative reagent, and should not be used as such.

We agree that HRP and ECL have a lower dynamic range than fluorescent antibodies coupled with imaging systems. However, AlexaFluor secondary antibodies did not produce reliable results for the Env proteins. To overcome this limitation, we made great effort to demonstrate that we were operating under conditions of relative linearity by providing serial dilutions of wild-type infected lysates for blots stained with ECL. This semi-quantitative analysis provided reproducible fold-differences between wild type and mutant Env expression levels across multiple donors.

c) Loading controls are missing from some western blots (ex 3A, 3E, 5C, 5I, etc).

All western blots for host proteins have GAPDH as a loading control. For western blots of viral proteins, we feel that pr55 is the most useful control as it is a proxy for viral protein expression. For blots that analyze both host and viral proteins, GAPDH and pr55 are both shown.

d) MDMs are differentiated using both M-CSF and GM-CSF; this is concerning as those cytokines lead to different macrophage phenotypes (such as highlighted here https://www.jimmunol.org/content/188/11/5752). Figure 1 shows MDMs more like GM-CSF MDMs, but Figure 6 indicates MDMs that sit somewhere in the middle.

While differences were seen between macrophages treated with each cytokine individually in the published paper provided by the reviewer, in our study all donor macrophages were treated with both cytokines. Similar to other investigators, we have noted significant donor variability but we do not have any reason to believe this is due to the cytokines used to prepare them. The dual cytokine protocol we used for macrophage differentiation and infection was communicated to us by the Siliciano lab as an experimental approach that facilitates macrophage infection by HIV. This protocol is fairly standard in the field, being utilized and published by other HIV investigators e.g. (Lahouassa, Daddacha et al. 2012, Mashiba et al., 2014, Collins et al., 2015, Chougui, Munir-Matloob et al., 2018, Clayton, Collins et al. 2018).

In addition, the MDMs seem to be CD3 positive (Supplementary Figure 2), which they should not be.

Macrophages have more autofluorescence than T cells because of their larger size. We have added flow cytometry plots (Figure 7—figure supplement 1C) to demonstrate that the PacBlue signal observed in macrophages is roughly equal in unstained, isotype-control stained, and anti-CD3-stained MDM, indicating there is no significant CD3 expression on MDMs as expected. By contrast PBMCs show a clear CD3-specific signal compared to isotype control, indicating CD3 expression.

e) It is unclear why the authors use 10-day single round infections, which is unconventional. Moreover, the authors do not explain their methodology. For example, are the entry inhibitors replenished in the 8 days between their addition and experimental completion? It is highly doubtful the inhibitors can last for 8 days, so if they are not changed then the infection will not likely be single round.

We thank the reviewers for pointing out these methodological points that are potentially confusing to readers. We have clarified in the revised manuscript that this methodology was chosen to make the single round infection experiments as similar as possible to the 10 day spreading infections, which we believed showed stronger phenotypes due to the long half-life of mannose receptor. Also, the legends and Materials and Methods have been amended to clarify that entry inhibitors were replenished in culture medium every 3 days.

f) Different y-axis scales are used even when discussing the same assay like p24 ELISA results (i.e. 4A vs. 4E.). Sometimes log 10, log 2, or linear…

All ELISA results from MDM are now displayed on a log scale.

g) Figure 7 is n=1 donor. Given the slight differences observed, given how variable different donor primary cells can be, and given the conclusions generated from this figure, this must be repeated with multiple donors.

In response to this concern, we performed additional experiments to increase the number of donors included in this analysis. In the revised manuscript, these data were moved to Figure 7—figure supplement 1E because they largely replicate our previously published results with a different HIV strain.

4) The authors repeatedly use 293T cells as a control to show the observed effects are macrophage specific. However, 293Ts are highly transformed, rapidly cycling, lab adapted cells that do not make a good biological control cell when comparing to primary MDMs. THP-1 +/- PMA (to show cycling vs. non-cycling monocytic cell lines) or even primary T cells would be a better control to allow for biologically relevant conclusions.

The 293T cells were useful due to their high transfectability to demonstrate that the mutations we made in various genes did not disrupt expression of other HIV proteins unintentionally. We will clarify that as the primary conclusion of these experiments in the revised manuscript.

We have tested THP-1 cells; however, they were difficult to infect with non-pseudotyped wild type viruses and do not express MR or demonstrate Vpr dependent phenotypes. We do include infections of the T cell line MOLT4-R5 in Figure 5 and we use primary T cells as controls in Figure 7. In two prior publications we demonstrated that activated primary T cells do not display Vpr infection and virion production phenotypes when cultured alone under the conditions of our assay (Mashiba et al., 2014, Collins et al., 2015). We considered performing western blots using primary T cells to examine the effect of Vpr-Nef double mutants on Env. However, it’s known that Nef downmodulates CD4, which is expressed at high levels in T cells and this activity of Nef likely stabilizes Env expression in T cells. Thus, this experiment is of limited utility in the context of the question being asked here. A paragraph in the Discussion (3rd paragraph) has been amended to discuss how effects of Nef on MR likely contribute to but do not fully explain the downmodulation of Env we observe in the Nef and Nef-Vpr double mutants. Beyond that, we respectfully request clarification about what question the reviewer wants addressed that affects our conclusion that Vpr overcomes a restriction of HIV infection in macrophages that is mediated by MR.

5) I am wrestling with the biological significance of MR in HIV replication, spread, and evolution, especially given the statement that this work "provide(s) an explanation for the evolutionary conservation of Vpr"… The authors highlight the lack of manose patch naturally found in the macrophage-tropic YU-2 HIV isolate. If this is indeed a central target of MR and YU-2 has evolved without the manose patch in order to circumvent this restriction, then one would assume other macrophage-tropic viruses would also be selected to have lost similar glycan structures to increase viral fitness and avoid MR restriction. Have the authors looked for this? That said, if macrophage-tropic viruses are more fit by losing the manose patch to avoid MR, then why would two accessory genes (Vpr and Nef) be needed to deplete MR through two potentially independent mechanisms? Have the authors looked at Vpr and Nef from these macrophage-tropic viruses to see if they still inhibit MR expression? This might help explain the potential discrepancy.

Thus far, all the viruses we have tested in this and previous publications have yielded a consistent pattern with respect to Env restriction in macrophages and Vpr alleviation of that restriction with the exception of YU-2.

As we have written in the revised manuscript, we hypothesize that YU-2 has distinct characteristics with respect to the mannose patch because of its localization within the CNS, which changes the balance of selective factors experienced by the virus. Macrophage-tropic HIVs are selected within the CNS because macrophages are abundant and T cells are rare within this compartment (Joseph, Arrildt et al. 2014). Highly macrophage tropic HIVs evolve the capacity to bind low levels of CD4, and YU2 is one example of this phenomenon (Thomas, Dunfee et al. 2007).

The mannose patch is beneficial because it is protective against antibody recognition. Thus, antibodies serve as a selective force for maintenance of the mannose patch. Because antibodies are expressed at very low levels in the CNS they likely impose substantially less selective pressure on HIVs present in the CNS, such as YU-2.

In addition, interactions between MR and Env are beneficial to the virus because these interactions facilitate initial infection by free virus. (Figures 6E and 6F), Because YU-2 utilizes low levels of CD4 so efficiently, YU-2 likely benefits less from interactions between MR and Env.

Through Nef and Vpr, the virus has evolved mechanisms to derive maximal benefit from the positive effects of the mannose patch, while avoiding detrimental ones. We clarified these points in the revised manuscript.

Reviewer #3:

The authors previously reported that HIV-1 Vpr counteracts an unidentified macrophage-specific factor that targets Env and Env-containing virions for lysosomal degradation. Thus, expression of Vpr increases steady-state levels of Env in infected MDM. In the current study, the authors investigate the possible involvement of mannose receptor (MR). MR expression was previously shown to be downmodulated in HIV-infected MDM and HIV Tat and Nef were implicated in this phenomenon. Tat was proposed to cause transcriptional repression of the MR promoter whereas Nef was shown to cause cell-surface downmodulation of MR without effect on MR steady-state levels. Here the authors confirm the reported effect of Nef on MR surface expression. The authors did not specifically look at a possible inhibitory effect of Tat on MR transcription and, as far as I am concerned, their data do not categorically rule out a contribution of Tat. However, the data presented here are indeed more consistent with the authors' conclusion that it is Vpr that induces transcriptional repression of MR. Somewhat surprisingly, Vpr appeared to be sufficient to cause efficient inhibition of MR expression in MDM in a spreading infection experiment (Figure 1C), but had only a partial effect on MR surface expression in a single cycle infection study (Figure 2D) and required the additional presence of Nef for efficient downmodulation of MR. I am not quite sure what to make of that. Nevertheless, the authors go on to demonstrate that the previously reported effect of Vpr on Env expression involves MR and silencing of MR reduced the requirement for Vpr for efficient Env expression. Overall, this is an interesting study that is timely and provides novel insights into the interplay of Env, Vpr, Nef, and mannose receptor. The authors make a convincing case that MR affects Env expression in the absence of Vpr and Nef and that MR is responsible for limiting virus spread from MDM to T cells in the absence of Vpr. The manuscript is well written and the experiments are for the most part well-designed and executed. I do have a few issues as detailed below that require the authors attention.

We thank the reviewer for the positive comments. As discussed above, we provided clarification in the revised manuscript that both Nef and Vpr are required but neither are sufficient for maximal MR downregulation.

1) Figure 1: Multiple studies have documented that replication of Vpr-deficient HIV-1 in macrophages is severely restricted when compared to wild type (wt) virus (e.g. Connor et al., 1995). I find it therefore astonishing that in panels C and E of Figure 1, there is only a minor difference in the pr55 levels of cells infected with wt and vpr-null virus. At 10 days post infection I would have expected a much larger difference in the Gag levels. In the figure legend and in the text the authors talk about "matched infection frequencies" but they don't explain how this was accomplished.

Please see reply to reviewer 1’s comment #5. Briefly, as previously reported (Mashiba et al., 2014), the effect of Vpr on infection frequency is reduced over time as the virus saturates the macrophage culture. Additionally, we have observed that the requirement for Vpr can be minimized by increasing the viral MOI. Thus, by adjusting the inoculum and the duration of the infection, we can often achieve saturating infection of both viruses that allow more direct comparison than if the infection frequencies were very different. For more attenuated viruses, such as those lacking both Vpr and Nef or both Vpr and mutant Env, it was not possible to obtain comparable infection frequencies. These experiments required more adjustments to account for infection frequency differences. This was clarified in the revised manuscript.

2) Also, I find it interesting that the authors go out of their way to document differences in Env levels by showing not only gp160 (the Env equivalent of pr55) but, in addition gp120 and gp41. Yet, they don't show p24 (CA). Showing the entire Gag blots (or at least inclusion of CA) might be informative since p24 antibodies typically have a higher affinity to p24 than to the pr55 precursor.

Blots for Gag p24 were included in the analysis for a previously published paper by (Mashiba et al., 2014). In that study we demonstrated no consistent differences in intracellular p24 mediated by Vpr expression across multiple donors. However, we observed more variability with p24 western blots than pr55 western blots – perhaps because p24 is in the mature virion and can be variably retained in macrophages. Nevertheless, because of the variability, we utilize unprocessed pr55 to normalize for infection in our western blot analyses.

3) How does the strong reduction of MR in Figure 1C at the protein level by just Vpr fit with the data from Figure 2D where both Nef and Vpr were required for efficient cell-surface down-modulation of MR in a single round infection?

As mentioned above, Vpr and Nef are both required but neither is sufficient for maximal MR downregulation. The wild-type virus used in Figure 1C expresses both Nef and Vpr. The loss of Vpr alone causes a significant increase in MR expression relative to wildtype, which is consistent with our findings in Figure 2 that both Nef and Vpr are required to observe strong downmodulation of MR protein

4) Figure 2D and G: How do the authors explain that only a subset of GFP+ cells downregulate MR? They skirt this issue both in the text and in the Discussion. In their Discussion, the authors make a statement concerning the importance of Env expression for Vpr-sensitive restriction in MDM. Since the construct used here is Env-defective, cells should be stained for intracellular p24 to see whether the Gag expression pattern matches that of GFP or MR (obviously it can't be both).

Please see also responses to reviewer 2 question 2:

The assays depicted in Figure 2D and 2E (previously 2G) were performed 5 days post transduction whereas the western blots of whole cell lysates were from ten-day cultures (Figure 1D). These data indicate that more striking effects on MR are observed at later time points post infection and suggest MR downregulation is time-dependent in macrophages, which tolerate HIV infection for weeks. This time dependency is potentially explainable in part by the very long half-life of MR (33 hours) (Lennartz, Cole and Stahl, 1989). Additionally, as we mention in the Discussion, MR is present at very high levels on macrophages (100,000 per cell) and it is likely that Vpr and Nef both must achieve high level expression to achieve maximal effect.

Adding a gag stain to the flow cytometry depicted in Figure 2D and E would not be informative, because, as shown in 2A, this construct lacks Gag. GFP, which is in the env ORF as a fusion with the first few amino acids of Env, should effectively mark all infected cells.

5) Figure 1—figure supplement 1: The authors should include a Q65R mutant of Vpr in the analysis to strengthen the argument that Vpr-mediated downmodulation of MR is DCAF1-independent.

We have completed the experiment with the Q65R mutant as suggested. As shown in Figure 2D and E, the vpr-Q65R mutant has a similar defect to vpr-null, which is consistent with a model in which DCAF1 binding is required to downmodulate MR. This was the expected result given our previous findings that the vpr-Q65R mutation was defective at reversing the macrophage-selective restriction of Env expression (Mashiba et al., 2014).

6) Figure 3C/D: Donor 2: The% Gag-positive cells on day 10 is almost identical for wt and vpr-null samples. In contrast, virus output in panel D on day 10 is significantly lower for the vpr-null virus. Does that mean virus spreads mostly in a cell-to-cell manner in MDM? Does it correlate with low MR levels?

We have clarified this important point in the revised manuscript. At earlier time points, the infection rate in the Vpr mutant is lower, indicating that the lower p24 release correlates with slower spread. As discussed above, by day 10 we often see that Wt and Vpr-null infections approach parity because nearly all the cells in the culture become infected.

7) Nef does a lot of things but I am not aware of any literature reporting an effect of Nef on Env stability. What did I miss?

We agree that our results showing that mutating Nef reduces Env stability in macrophages are novel. A likely related effect of Nef in other cell types was previously reported (Lama, Mangasarian and Trono, 1999). This paper demonstrates that CD4 reduces Env levels in virions. This effect of CD4 is thought to be due to CD4 binding Env within infected cells. It is reversed by Nef and Vpu-mediated CD4 downmodulation. We discuss this and how it parallels our model that Env binding to MR interferes with Env trafficking in the revised manuscript. We previously demonstrated that without Vpr, Env and Env containing virions are trafficked to lysosomes and degraded at an accelerated rate. The Vpr/Nef-mediated downmodulation of MR reverses this effect.

8) Figure 3E: Deletion of Nef alone reduces Env expression almost as much as deleting both Nef and Vpr. How can this be explained? Is it correlated with effect on MR expression? A MR western blot should be included here. But even if the effect of Nef deletion involves MR how can this work if Nef only affects MR surface expression and not total cellular pool of MR?

Our data indicate that both Vpr and Nef are required for maximal MR downmodulation, but neither is sufficient. In the revised version of Figure 4E (previously 3E) we provide additional data from a second donor in which the effects of Nef and Vpr mutation are more equal. Similarly, in the single round experiments depicted in 2E we observe some variation in the relative activity of Nef and Vpr. Overall, the compiled results did not show a significant difference between the Vpr mutant and the Nef mutant.

Because the infection frequencies for the mutant viruses shown in this figure are quite low, adding western blots of MR to Figure 4E would not allow us to properly assess the effect of viral proteins on MR. The Nef-null single mutant is defective at spread due to the multifactorial effects of Nef. In the case of Nef-null only about half of MDMs are infected. In the case of Vpr-Nef-null <20% are infected. Thus, the whole cell lysates largely reflect MR levels of uninfected cells in those samples.

9) Figure 5I: The authors conclude from this experiment that MR restricts Env expression via direct interaction with high-mannose residues on Env. Where in the cell is this happening? What happens if cells are treated with Brefeldin A, which traps Env and MR in the ER? Will it exacerbate/alleviate the effect of MR on Env?

This is an interesting idea but given the broad effects of brefeldin on trafficking and the potential for complex indirect effects, results will be difficult to interpret. For example, brefeldin treatment of Nef expressing cells leads to non-specific reduction of most proteins found on the cell surface and a modest increase in MHC-I. The experiment does not answer the question as to where in the cell Nef is acting. This question asked by the reviewer is better addressed by considering the forms of Env that are affected as well as effects on Env-containing virions that we previously published. We previously showed that Env-containing virions are retained at the cell surface and targeted to lysosomes in macrophages lacking Vpr (Collins et al., 2015). Our prior studies also provided evidence that unprocessed Env is affected and targeted to lysosomal compartments albeit to a lesser degree (Mashiba et al., 2014). Because Env processing occurs via furin-mediated cleavage in the TGN, the effect on unprocessed Env provides evidence that MR interacts with Env along the secretory pathway prior to its arrival and processing in the TGN. A paragraph discussing this interesting question has been added to the revised manuscript.

10) “MR is the restriction factor” – I would suggest softening this statement to "MR is a restriction factor".

This line was softened as suggested.

11) Discussion: "In the primary macrophage system, Vpr-sensitive virion restriction depends entirely on an intact env open reading frame (Mashiba et al., 2014)". What are the implications of this statement for the data shown in Figure 2 where Env was replaced by GFP?

We have clarified in the revised manuscript that Env is required for us to observe effects of Vpr on virion release. We propose that this is because MR requires interactions with Env to retain virions. In our model, Env expression is not required for us to observe effects of Vpr or Nef on MR, as demonstrated in Figure 2E.

12) Discussion:" The magnitude of the effect and the fraction of cells affected increased when both proteins were expressed". What does the "fraction of cells" statement mean? Are the authors suggesting that this is an "either-or" phenomenon where Nef downmodulates MR in one fraction of the cells and Vpr does the same but in another fraction and only together do we see downmodulation in the two fractions combined? That would be fantastic from a mechanistical point of view and would explain the results from but is very unrealistic, I am afraid.

We have clarified our interpretation that Vpr and Nef act synergistically in the same cells. Our evidence suggests Vpr and Nef each has a partial effect on its own that is dramatically enhanced in the presence of the other factor. Regarding the fact that only a subset of GFP+ cells are dramatically affected on day five post-infection, as described above, this is likely related to the time-dependent nature of the process.

13) The fourth paragraph of the Discussion is somewhat trivial and can be deleted without loss to content and clarity of the paper. Instead, the authors should simply include the Q65R control as suggested for Supplementary Figure 1 above. That's a quick and easy experiment to do.

In response to the reviewer’s concern, we tested the ability of the Q65R mutant to downmodulate MR and determined that it behaves similarly to Vpr-null viruses which is consistent with our model (Figure 2E).


Article and author information

Author details

  1. Jay Lubow

    Department of Microbiology and Immunology, University of Michigan, Ann Arbor, United States
    Conceptualization, Resources, Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7125-453X
  2. Maria C Virgilio

    Cellular and Molecular Biology Program, University of Michigan, Ann Arbor, United States
    Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4940-188X
  3. Madeline Merlino

    Department of Internal Medicine, University of Michigan, Ann Arbor, United States
    Investigation, Visualization
    Competing interests
    No competing interests declared
  4. David R Collins

    Department of Microbiology and Immunology, University of Michigan, Ann Arbor, United States
    Conceptualization, Resources, Formal analysis, Funding acquisition, Investigation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7903-346X
  5. Michael Mashiba

    Graduate Program in Immunology, University of Michigan, Ann Arbor, United States
    Conceptualization, Resources, Formal analysis, Funding acquisition
    Competing interests
    No competing interests declared
  6. Brian G Peterson

    Department of Biological Chemistry, University of Michigan, Ann Arbor, United States
    Formal analysis, Investigation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6871-2336
  7. Zana Lukic

    Department of Internal Medicine, University of Michigan, Ann Arbor, United States
    Resources, Investigation
    Competing interests
    No competing interests declared
  8. Mark M Painter

    Graduate Program in Immunology, University of Michigan, Ann Arbor, United States
    Competing interests
    No competing interests declared
  9. Francisco Gomez-Rivera

    Graduate Program in Immunology, University of Michigan, Ann Arbor, United States
    Competing interests
    No competing interests declared
  10. Valeri Terry

    Department of Internal Medicine, University of Michigan, Ann Arbor, United States
    Resources, Investigation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2499-3882
  11. Gretchen Zimmerman

    Graduate Program in Immunology, University of Michigan, Ann Arbor, United States
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6014-9101
  12. Kathleen L Collins

    1. Cellular and Molecular Biology Program, University of Michigan, Ann Arbor, United States
    2. Department of Internal Medicine, University of Michigan, Ann Arbor, United States
    3. Graduate Program in Immunology, University of Michigan, Ann Arbor, United States
    Conceptualization, Supervision, Funding acquisition
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-1712-5809


National Institute of Allergy and Infectious Diseases (R21AI132379)

  • Jay Lubow
  • Maria C Virgilio
  • Brian G Peterson
  • Kathleen L Collins

National Institute of Allergy and Infectious Diseases (R56AI120954)

  • David R Collins
  • Michael Mashiba
  • Kathleen L Collins

National Institute of Allergy and Infectious Diseases (R56AI130004)

  • Jay Lubow
  • Maria C Virgilio
  • Brian G Peterson
  • Kathleen L Collins

National Institute of Allergy and Infectious Diseases (RO1AI51192)

  • David R Collins
  • Michael Mashiba
  • Kathleen L Collins

National Institute of General Medical Sciences (T32GM008353-28)

  • Jay Lubow

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


This research was supported by the NIH (5T32GM008353-27 to JL, F31AI125090-01 to JL, R01AI046998 to KLC, R56AI130004 to KLC, R21AI32379 to KLC, T32GM007863 to MM, T32AI007413 to MM and T32AI007528 to DRC). We are grateful to the University of Michigan Vector Core and the NIH AIDS Reagent Program for reagents and to the University of Michigan Flow Cytometry Core for assistance with experiments. We thank Dr. Estelle Chiari for providing pMSCV 3xFLAG UNG2 IRES-GFP

Senior Editor

  1. Satyajit Rath, Indian Institute of Science Education and Research (IISER), India

Reviewing Editor

  1. Julie Overbaugh, Fred Hutchinson Cancer Research Center, United States

Publication history

  1. Received: August 12, 2019
  2. Accepted: January 25, 2020
  3. Version of Record published: March 2, 2020 (version 1)


© 2020, Lubow et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,050
    Page views
  • 161
  • 4

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Genetics and Genomics
    2. Immunology and Inflammation
    Terkild B Buus et al.
    Research Article

    Simultaneous measurement of surface proteins and gene expression within single cells using oligo-conjugated antibodies offers high-resolution snapshots of complex cell populations. Signal from oligo-conjugated antibodies is quantified by high-throughput sequencing and is highly scalable and sensitive. We investigated the response of oligo-conjugated antibodies towards four variables: concentration, staining volume, cell number at staining, and tissue. We find that staining with recommended antibody concentrations causes unnecessarily high background and amount of antibody used can be drastically reduced without loss of biological information. Reducing staining volume only affects antibodies targeting abundant epitopes used at low concentrations and is counteracted by reducing cell numbers. Adjusting concentrations increases signal, lowers background, and reduces costs. Background signal can account for a major fraction of total sequencing and is primarily derived from antibodies used at high concentrations. This study provides new insight into titration response and background of oligo-conjugated antibodies and offers concrete guidelines to improve such panels.

    1. Immunology and Inflammation
    2. Neuroscience
    Alessio Vittorio Colombo et al.
    Research Article

    Previous studies have identified a crucial role of the gut microbiome in modifying Alzheimer’s disease (AD) progression. However, the mechanisms of microbiome–brain interaction in AD were so far unknown. Here, we identify microbiota-derived short chain fatty acids (SCFA) as microbial metabolites which promote Aβ deposition. Germ-free (GF) AD mice exhibit a substantially reduced Aβ plaque load and markedly reduced SCFA plasma concentrations; conversely, SCFA supplementation to GF AD mice increased the Aβ plaque load to levels of conventionally colonized (specific pathogen-free [SPF]) animals and SCFA supplementation to SPF mice even further exacerbated plaque load. This was accompanied by the pronounced alterations in microglial transcriptomic profile, including upregulation of ApoE. Despite increased microglial recruitment to Aβ plaques upon SCFA supplementation, microglia contained less intracellular Aβ. Taken together, our results demonstrate that microbiota-derived SCFA are critical mediators along the gut-brain axis which promote Aβ deposition likely via modulation of the microglial phenotype.