Apolipoprotein L-1 renal risk variants form active channels at the plasma membrane driving cytotoxicity
- Department of Biological Sciences, Hunter College at City University of New York, United States
- Department of Ophthalmology, Margaret Dyson Vision Research Institute, Weill Cornell Medicine, United States
- Genosity, United States
Figures
Figure 1 with 1 supplement
Expression of APOL1-G1 and G2 cDNA leads to cytotoxicity in FT293 cells.
(a) Predicted linear structure of APOL1, using JPred, with major sites of amino acid variation highlighted in red (a deletion is represented as a dash). Haplotypes are organized by frequency in the …
Figure 1—figure supplement 1
Expressing APOL1 protein at levels found in podocytes leads to RRV cytotoxicity in FT293 cells.
(a) A time-course of APOL1 expression in FT293 cells treated with 50 ng/mL doxycycline reveals that RRV cytotoxicity occurs 24 hr post-induction (n = 3). Data are represented as mean ± s.d. (b) …
Figure 2
The APOL1 channel is permeable to Ca2+.
(a) Planar lipid bilayer setup. The starting buffer composition for (b–d) are shown. During each experiment the composition of the cis side is altered by the experimenter, whereas the trans side is …
Figure 3
Expression of the RRVs leads to a Ca2+ influx that precedes cell swelling and death.
(a) Fluorescence traces of representative GCaMP6f-positive cells demonstrating that G1 and G2 cause a Ca2+ influx prior to cell swelling. GCaMP6f-transfected FT293 cells were incubated with DRAQ7 …
-
Figure 3—source data 1
FT283 cells GCaMP6f microscopy, 30 hours after induction one way ANOVA.
- https://cdn.elifesciences.org/articles/51185/elife-51185-fig3-data1-v2.xlsx
Figure 4 with 2 supplements
Ca2+ influx and cytotoxicity of G1 and G2 requires trafficking from the ER.
(a) Schematic of the RUSH system. Streptavidin was expressed with a signal peptide and KDEL allowing for localization and retention in the ER lumen along with streptavidin-binding protein (SBP) …
Figure 4—figure supplement 1
Validation of protein expression and Ca2+-driven cytotoxicity of APOL1 in the RUSH system.
(a) Western blot of whole cell lysates displaying protein expression of RUSH-APOL1 in HEK293 cells 24 hr after transfection. Cells were not treated with biotin. (b) Fluorescent traces of all …
Figure 4—figure supplement 2
The G1 and G2-mediated cytoplasmic Ca2+ influx is not due to ER Ca2+ release.
(a) Validation for the simultaneous use of Ca2+ sensors GCaMP6f and ER-LAR-GECO from a representative cell. Co-transfected cells were treated with 10 µM thapsigargin to prevent Ca2+ reuptake in the …
Figure 5 with 1 supplement
APOL1 traffics to the PM prior to Ca2+ influx.
(a) Confocal images of transfected and permeabilized CHO cells depict RUSH-APOL1 (red) localized to the ER (stained via calnexin, green) without biotin followed by partial PM localization after 90 …
Figure 5—figure supplement 1
RUSH-APOL1 traffics to the peri-nuclear region and PM post-biotin treatment.
Additional confocal images of immunostained CHO cells from Figure 5a. All three APOL1 variants are found in the ER prior to biotin treatment, and then traffic to the peri-nuclear region or PM within …
Figure 6 with 4 supplements
RRV cytotoxicity is driven by the influx of both Na+ and Ca2+.
(a) Schematic of the planar lipid bilayer setup showing the sequence of cis buffer perfusions. (b) The APOL1 channel is readily permeable to Na+, but not choline+. In symmetrical KCl solutions Erev …
Figure 6—figure supplement 1
Replacement of Na+ with K+ significantly reduces cell viability.
RRV cytotoxicity is exacerbated with increased extracellular Ca2+. (a) Replacement of extracellular NaCl with KCl for 12 hr significantly reduces cell viability in RUSH-G0 transfected HEK293 cells …
Figure 6—figure supplement 2
Validation of the FliCR sensor.
Release of RUSH-G0 from the ER does not elicit a sustained increase in cytoplasmic Ca2+ or membrane depolarization. (a) Fluorescent trace of a representative CHO cell transfected with the plasma …
Figure 6—figure supplement 3
The RUSH-G2-mediated Ca2+ influx occurs concurrently with a modest depolarization of the cell (Na+ influx), followed by complete depolarization prior to cell death.
The G2-mediated Ca2+-influx occurs alongside a Na+ influx (as measured via membrane voltage) (n = 21). Cytoplasmic Ca2+ continues to increase for several hours while the membrane potential either …
Figure 6—video 1
The G2-mediated Ca2+ influx occurs concurrently with the influx of Na+.
CHO cells were co-transfected with RUSH-G2, GCaMP6f, and FliCR for 24 hr prior to imaging. On the day of the experiment cells were treated with 80 µM biotin and imaged every 5 min from 0.5 to 12 hr …
Figure 7
Acidic activation of APOL1 drives channel formation and cytotoxicity.
(a) Acidification and neutralization of RUSH-APOL1 transfected HEK293 cells causes G0 to become cytotoxic and exacerbates the cytotoxicity of G1 and G2. 24 hr after transfection cells were treated …
Figure 8
Model of RRV-mediated cytotoxicity: G1 and G2 form cation channels at the PM.
(a) Proposed model of APOL1 trafficking and cytotoxicity. All variants of APOL1 will traffic to the PM, en route they will encounter acidification and neutralization along the secretory pathway, …
Author response image 1
Author response image 2
Author response image 3
Videos
Video 1
Expression of G1 and G2 leads to a Ca2+ influx prior to cell swelling.
FT293 cells were transfected with GCaMP6f 24 hr before imaging. Cells were then incubated with 3 µM DRAQ7 and with or without 50 ng/mL doxycycline to induce APOL1 expression. Cells were imaged via …
Video 2
Expression of RUSH-G1 and G2 leads to Ca2+ influx, swelling, and lysis only after release from the ER.
HEK293 cells were co-transfected with RUSH-APOL1 and GCaMP6f for 24 hr. Prior to imaging, 3 µM DRAQ7 was added and cells were treated with or without 80 µM biotin to release APOL1 from the ER. Cells …
Video 3
Expression and ER release of RUSH-G1 and G2 leads to Ca2+ influx and lysis in CHO cells.
CHO cells were co-transfected with RUSH-APOL1 and GCaMP6f for 24 hr. Prior to imaging, cells were treated with or without 80 µM biotin to release APOL1 from the ER. Cells were imaged via widefield …
Video 4
Expression and release of RUSH-G1 and G2 does not induce ER Ca2+ release.
CHO cells were co-transfected with RUSH-APOL1, GCaMP6f, and ER-LAR-GECO for 24 hr prior to imaging. On the day of the experiment cells were treated with 80 µM biotin and imaged for 0.5–12 hr post …
Video 5
Replacement of NaCl with choline Cl or KCl does not affect the G2-mediated Ca2+ influx.
CHO cells were co-transfected with RUSH-G2 and GCaMP6f for 24 hr prior to imaging. On the day of the experiment cells were treated with 80 µM biotin and incubated in media containing 150 mM Na+ (130 …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Recombinant DNA reagent (Homo sapiens) | APOL1-G0 | NCBI | BC143038.1 | cDNA |
| Recombinant DNA reagent (Homo sapiens) | APOL1-G1 | NCBI | AF305428.1 | cDNA |
| Recombinant DNA reagent (Homo sapiens) | APOL1-G2 | 1000 genomes project, this paper | cDNA *Constructed from mutagenesis from APOL1-G0. Protein coding sequence based off of 1000 genomes data | |
| Recombinant DNA reagent PRG977 | PRG977 | Regeneron | ||
| Recombinant DNA reagent and transfected construct pcDNA5/FRT/TO | pcDNA5 | Thermo Fisher | V652020 | APOL1 variants cloned into this plasmid to generate stable cell line (FT293-APOL1_ |
| Recombinant DNA reagent and transfected construct pOG44 | p0G44 | Thermo Fisher | V600520 | |
| Recombinant DNA reagent and transfected pcDNA6/Tet-repressor | pcDNA6/Tet-repressor | Thermo Fisher | R25001 | |
| Recombinant DNA reagent and transfected Str-KDEL-SBP-EGFP-GPI | RUSH | Addgene | 65293 | Gift from Franck Perez. APOL1 variants cloned into this plasmid for transfection into cells (RUSH-APOL1). GFP and GPI anchor removed |
| Recombinant DNA reagent and transfected pGP-CMVB-GCaMP6f | GCaMP6f | Addgene | 40755 | A gift from Douglas Kim and the GENIE project |
| Recombinant DNA reagent and transfected CMV-ER-LAR-GECO1 | ER-LAR-GECO | Addgene | 61244 | A gift from Robert Campbell |
| Recombinant DNA reagent and transfected CMV-FliCR | FliCR | Addgene | 74142 | A gift from Robert Campbell |
| Sequence based reagent | APOL1_G0 K150E mutagenesis primers | This paper | PCR primer pair | F:5'TGAAAGAGTTTCCTCGGTTGAAAAGTGAGCTTGAGGATAAC R:5'GTTATCCTCAAGCTCACTTTTCAACCGAGGAAACTCTTTCA |
| Sequence based reagent | APOL1-G0 E150 Conversion to G1 mutagenesis Round 1 (S243G) | This paper | PCR primer pair | F:5'CGGATGTGGCCCCTGTAGGCTTCTTTCTTGTG R:5'CACAAGAAAGAAGCCTACAGGGGCCACATCCG |
| Sequence based reagent | APOL1-G0 E150 Conversion to G1 mutagenesis Round 2 (I384M) (Round 1 as template) | This paper | PCR primer pair | F:5'GGAGCTGGAGGAGAAGCTAAACATGCTCAACAATAATTATAAGA R:5'TCTTATAATTATTGTTGAGCATGTTTAGCTTCTCCTCCAGCTCC |
| Sequence based reagent | APOL1-G0 E150 Conversion to G12 mutagenesis | This paper | PCR primer pair | F: 5'AGCTAAACATTCTCAACAATAAGATTCTGCAGGCGGAC R: 5'GTCCGCCTGCAGAATCTTATTGTTGAGAATGTTTAGCT |
| Sequence based reagent | Insertion of APOL1 cDNA into pcDNA 5 vector | This paper | PCR primer pair | F: 5'ATGATATCGCCACCATGGAGGGAGCTG R: 5'ATCTCGAGTCATCACAGTTCTTGGTCCGCCTG |
| Sequence based reagent | Insertion of APOL1 cDNA into RUSH vector | This paper | PCR primer pair | F: 5'ATGCCCTGCAGGAGAGGAAGCTGGAGCGAGG R: 5'ATGCTCTAGACTATCACAGTTCTTGGTCCGCC |
| Cell line (Homo sapiens) | HEK293 | ATCC | CRL-1573 | |
| Cell line (Homo sapiens) | FlpIn HEK 293 | Thermo Fisher | Gift from Dr. Christian Brix Folsted Andersen. Converted into FlpIn TREX293 | |
| Cell line (Homo sapiens) | Conditionally Immortalized Human podocytes | Saleem et al., 2002 | Gift from Dr. Moin Saleem and Dr. Jeffrey Kopp | |
| Cell line (Cricetulus griseus) | CHO | ATCC | CCL-61 | |
| Antibody | Mouse anti-APOL1 | Proteintech | 66124–1-Ig | WB 1:2000 IF 1:800 |
| Antibody | Rabbit anti-APOL1 | Proteintech | 11486–2-AP | WB 1:5000 |
| Antibody | Rabbit anti-GAPDH | Proteintech | 10494–1-AP | WB 1:5000 |
| Antibody | Rabbit anti-Calnexin | Stressgen | SPA-860 | IF 1:200 |
| Antibody | Goat anti-mouse 680RD | LICOR | 92568070 | WB 1:10,000 |
| Antibody | Donkey anti-rabbit 800CW | LICOR | 925–32213 | WB 1:10,000 |
| Antibody | anti-rabbit Alexa 488 plus | Thermo Fisher | A32731 | IF 1:1500 |
| Antibody | anti-mouse Alexa 647 | Thermo Fisher | A21236 | IF 1:1000 |
| Chemical compound, drug | HCS Nuclear Mask | Thermo Fisher | H10325 | IF 1:400 |
| Chemical compound, drug | DRAQ7 | Abcam | ab109202 | Live cell microscopy 3 µM |
| Chemical compound, drug | Thapsigargin | Thermo Fisher | T7458 | |
| Chemical compound, drug | Interferon gamma | R and D Systems | 285IF100 | |
| Chemical compound, drug | Lactate dehydrogenase assay | Promega | G1781 | Cytotox 96 Non-Radioactive Cytotoxicity Assay |
| Commercial assay kit | MultiTox-Fluor Multiplex Cytotoxicity Assay | Promega | G9201 | |
| Commercial assay kit | Quik Change II Mutagenesis Kit | Agilent | 200523 | |
| Software | TrackMate | Tinevez et al., 2017 | ||
| Software | Prism | GraphPad | ||
| Software | R-multicomp package | Hothorn et al., 2008 |
