1. Cell Biology
  2. Human Biology and Medicine
Download icon

Apolipoprotein L-1 renal risk variants form active channels at the plasma membrane driving cytotoxicity

  1. Joseph A Giovinazzo  Is a corresponding author
  2. Russell P Thomson
  3. Nailya Khalizova
  4. Patrick J Zager
  5. Nirav Malani
  6. Enrique Rodriguez-Boulan
  7. Jayne Raper  Is a corresponding author
  8. Ryan Schreiner  Is a corresponding author
  1. Department of Biological Sciences, Hunter College at City University of New York, United States
  2. Department of Ophthalmology, Margaret Dyson Vision Research Institute, Weill Cornell Medicine, United States
  3. Genosity, United States
Research Article
  • Cited 2
  • Views 1,139
  • Annotations
Cite this article as: eLife 2020;9:e51185 doi: 10.7554/eLife.51185

Abstract

Recently evolved alleles of Apolipoprotein L-1 (APOL1) provide increased protection against African trypanosome parasites while also significantly increasing the risk of developing kidney disease in humans. APOL1 protects against trypanosome infections by forming ion channels within the parasite, causing lysis. While the correlation to kidney disease is robust, there is little consensus concerning the underlying disease mechanism. We show in human cells that the APOL1 renal risk variants have a population of active channels at the plasma membrane, which results in an influx of both Na+ and Ca2+. We propose a model wherein APOL1 channel activity is the upstream event causing cell death, and that the activate-state, plasma membrane-localized channel represents the ideal drug target to combat APOL1-mediated kidney disease.

Introduction

Apolipoprotein L-1 (APOL1) is a primate-specific innate immunity gene, (Smith and Malik, 2009) which provides protection against protozoan parasites (Hager et al., 1994; Samanovic et al., 2009) by forming cation channels within the pathogens (Molina-Portela et al., 2005; Thomson and Finkelstein, 2015). APOL1 circulates on specialized high-density lipoprotein particles termed trypanosome lytic factors, which are endocytosed by the parasites (Hager et al., 1994; Rifkin, 1978; Raper et al., 1999). Once inside, APOL1 leads to an ion flux that drives trypanolysis (Molina-Portela et al., 2005; Thomson and Finkelstein, 2015; Rifkin, 1984). Its activity is governed by a two-step process: Activation at acidic pH followed by channel opening at neutral pH (Thomson and Finkelstein, 2015). This mechanism is inhibited in human-infective Trypanosoma brucei rhodesiense (Pérez-Morga et al., 2005) and T.b. gambiense (Capewell et al., 2013; Uzureau et al., 2013), leading to sleeping sickness.

A molecular arms race between humans and African trypanosomes has led to the evolution of African APOL1 variants, G1 (rs73885319 - S342G, rs60910145 - I384M) and G2 (rs71785313 - ∆ 388:389 NY) (Genovese et al., 2010), which provide protection against the human infective trypanosomes (Cooper et al., 2017). This resistance, however, significantly increases the risk of developing a spectrum of chronic kidney diseases when two copies of these renal risk variants (RRVs) are present, including focal segmental glomerulosclerosis, hypertension-associated end stage kidney disease, and HIV-associated nephropathy (Genovese et al., 2010; Kopp et al., 2011; Tzur et al., 2010). The RRVs are also associated with sickle cell nephropathy (Ashley-Koch et al., 2011) and lupus nephritis (Freedman et al., 2014), and drive faster progression from chronic kidney disease to renal failure (Parsa et al., 2013). Importantly, 5 million African Americans are estimated to carry two copies of G1 or G2 (Friedman et al., 2011).

The major isoform of APOL1 encodes a signal peptide (Nichols et al., 2015; Monajemi et al., 2002) and likely traffics along the secretory pathway, thereby allowing for secretion from hepatocytes onto high density lipoprotein particles (Shukha et al., 2017) or localization to the endoplasmic reticulum (ER) and plasma membrane (PM) in other cell types (Cheng et al., 2015; O'Toole et al., 2018; Olabisi et al., 2016; Heneghan et al., 2015). The majority of intracellular APOL1 remains localized within the ER (Cheng et al., 2015). APOL1 is expressed by several kidney cell types including the podocyte (Nichols et al., 2015; Ma et al., 2015), and multiple studies point to kidney intrinsic APOL1 as the driver of disease (Reeves-Daniel et al., 2011; Lee et al., 2012a), rather than the circulating APOL1 associated with trypanosome lytic factors (Kozlitina et al., 2016). While the discovery of the RRVs provided an explanation for the increased rates of kidney disease in African Americans, there remains little consensus on how the variants cause disease or which pathways to target for therapeutic intervention.

Overexpression of the RRVs in multiple cell lines and transgenic mouse models causes cytotoxicity, however the mechanism responsible remains unclear. It has been proposed that RRV cytotoxicity is mediated by several possible pathways such as autophagy (Wan et al., 2008), lysosomal permeability (Lan et al., 2014), pyroptosis (Beckerman et al., 2017), mitochondrial dysfunction (Ma et al., 2017), impairment of vacuolar acidification (Kruzel-Davila et al., 2017), activation of stress-activated kinases (Olabisi et al., 2016), and ER stress (Wen et al., 2018). This lack of consensus is unsatisfactory and hinders progress towards developing therapeutics. However, whilst these pathways are seemingly unrelated, most are affected by or activated to combat pore-forming toxins (Huffman et al., 2004; Cancino-Rodezno et al., 2009; Kennedy et al., 2009). Therefore, as APOL1 forms cation channels within trypanosomes after endocytosis (Molina-Portela et al., 2005; Thomson and Finkelstein, 2015), we hypothesize cell intrinsic G1 and G2 also form cytotoxic channels, and that this mechanism links the disparate pathways together.

To perform this study, we focused on the channel forming properties of APOL1. Interestingly, APOL1 led to an intracellular accumulation of Ca2+ after 72 hr of overexpression in Xenopus oocytes (Heneghan et al., 2015), and Ca2+ signaling has been associated with the activation of several aforementioned pathways linked to APOL1 (Lee et al., 2012b; Rizzuto et al., 2012; Krebs et al., 2015). Additionally, treatment of African trypanosomes with human serum led uptake of Ca2+ (Rifkin, 1984). The APOL1 channel is permeable to monovalent Na+ and K+ (Thomson and Finkelstein, 2015), and its trypanolytic activity is inhibited by reducing extracellular Na+ (Molina-Portela et al., 2008). As the plasma membrane is already highly permeable to K+, we focused on the potential roles of extracellular Na+ and Ca2+ in driving APOL1 cytotoxicity. We utilized planar lipid bilayers to evaluate APOL1 as a possible non-selective cation channel, and live-cell fluorescent microscopy with the cytoplasmic Ca2+ indicator GCaMP6f (Chen et al., 2013) and membrane voltage sensor FliCR (Abdelfattah et al., 2016) to test for increased Ca2+ and Na+ flux linked to RRV-induced cytotoxicity. Furthermore, utilizing the retention using selective hooks (RUSH) system (Boncompain et al., 2012), in combination with live-cell and immunofluorescence microscopy, we evaluated the importance and timing of events leading up to RRV-induced cell death, including ER exit and the delivery of APOL1 to the PM.

Results

Expression of the APOL1 renal risk variants G1 and G2, but not G0, leads to cell death

As an innate immunity gene, APOL1 is induced by pro-inflammatory cytokines such as interferons (Nichols et al., 2015). Prolonged courses of interferon treatment caused acute emergence of collapsing focal segmental glomerulosclerosis in a small subset of patients who were revealed to carry two copies of the RRVs upon retrospective genotyping (Markowitz et al., 2010). This has led to the hypothesis that a sustained increase in RRV expression is a cause of APOL1-driven chronic kidney disease (Nichols et al., 2015; Olabisi et al., 2016).

A Flp-In TREX 293 (FT293) stable cell line was generated to inducibly express APOL1 variants from a single genetic locus, allowing us to test the effects of sustained APOL1 expression. These variants are based on the most prevalent haplotypes in the human population (Auton et al., 2015Figure 1a). Expression of the APOL1 variants leads to similar levels of protein expression (Figure 1b), and induction of the RRVs, but not G0, leads to cell swelling followed by cytotoxicity after 24 hr of expression (Figure 1c, Figure 1—figure supplement 1a).

Figure 1 with 1 supplement see all
Expression of APOL1-G1 and G2 cDNA leads to cytotoxicity in FT293 cells.

(a) Predicted linear structure of APOL1, using JPred, with major sites of amino acid variation highlighted in red (a deletion is represented as a dash). Haplotypes are organized by frequency in the human population, which is depicted in the left-hand column as Freq (%). The right-hand column represents the distribution of each allele within populations. AFR = African, LAT AMR = Latin America, ASN = Asian, EUR = European. Haplotypes in blue boxes were those used in this study. Data retrieved from 1000 Genomes Project. (b) Western blot of whole cell lysates displaying similar levels of protein production between FT293 cell lines. Cells were treated with doxycycline for 4 hr. 6x-His tagged APOL1 was expressed and purified from E. coli and used as a positive control. (c) Cell death assay displaying the cytotoxicity caused by doxycycline-induced expression of APOL1-G1 and G2, but not G0, in FT293 cells. Cells were induced with 50 ng/mL doxycycline for 24 hr, and cytotoxicity was measured via cellular release of lactate dehydrogenase. A two-way ANOVA with multiple comparisons was performed to compare induced and un-induced cells (n = 14).

It has recently been suggested that overexpression of APOL1 in cultured cells may not constitute a physiologically relevant model as lower expression levels are not cytotoxic (O'Toole et al., 2018). However, no reference for APOL1 expression has been established for comparison. To address this point, we titrated APOL1 protein expression in the FT293-G0 stable cell line to obtain similar APOL1 levels found in interferon-stimulated human podocytes (Saleem et al., 2002). The RRVs remained cytotoxic in our model under these conditions, though cell death was delayed due to lower expression (Figure 1—figure supplement 1b–c). These findings indicate that RRV-mediated cytotoxicity in this cell system occurs with levels of protein expression, as quantified by western blot, comparable to that found in interferon-stimulated podocytes, and represents a productive cell culture model to evaluate APOL1-mediated kidney disease.

APOL1 channels are permeable to Ca2+, and the RRVs lead to a cellular Ca2+ influx

We hypothesize that the cytotoxicity of APOL1 in mammalian cells parallels its trypanolytic activity, both resulting from its channel-forming properties. Indeed, APOL1 causes cell swelling and dissipation of Na+ and K+ gradients in trypanosomes (Molina-Portela et al., 2005; Rifkin, 1984) as well as mammalian cells (O'Toole et al., 2018; Olabisi et al., 2016). Furthermore, overexpression of APOL1 in Xenopus oocytes led to an intracellular accumulation of Ca2+ (Heneghan et al., 2015). As Ca2+ is a potent signaling molecule, aberrantly high cytoplasmic Ca2+ levels can activate many cell-signaling pathways; eventually its dysregulation leads to cell death.

The potential Ca2+-permeability of channels formed by recombinant APOL1 (rAPOL1) was examined using planar lipid bilayers (Figure 2a). CaCl2 was first added to both sides of the bilayer in equimolar amounts. Under conditions where CaCl2 was present on both sides of the bilayer, but not KCl or NaCl, the rAPOL1 channel retained its pH-dependent activity, requiring a pH ≤6.0 for irreversible membrane insertion followed by neutralization to open, enhancing conductivity several hundred-fold (Figure 2b; Thomson and Finkelstein, 2015). To examine the ion selectivity of this conductance, we ascertained the reversal potential (Erev, the voltage required to zero the current) before and after establishment of a 1.95-fold cis:trans CaCl2 gradient. Erev became more negative after CaCl2 addition, lowering from −1 mV to −6 mV, indicating selectivity for Ca2+ over Cl- and demonstrating that rAPOL1 conducts Ca2+ (Figure 2b). All rAPOL1 variants tested are equally permeable to Ca2+ (Figure 2c), as well as Na+ and K+(Thomson and Finkelstein, 2015), indicating that a difference in ion selectivity is not the cause of disease.

The APOL1 channel is permeable to Ca2+.

(a) Planar lipid bilayer setup. The starting buffer composition for (b–d) are shown. During each experiment the composition of the cis side is altered by the experimenter, whereas the trans side is left unaltered. After APOL1 channel formation (typically many thousands per bilayer) a current (pA, upper trace) can be measured in response to a voltage (V, lower trace). In each case the voltage is set by the experimenter. (b) Planar lipid bilayer demonstrating that the rAPOL1-G0 channel is selective for Ca2+ over Cl-. rAPOL1 was added to the cis side at pH 5.6 to drive insertion, which caused a minor increase in conductance that was amplified approximately 450-fold upon cis neutralization (pH 7.1). The voltage required to zero the current (reversal potential, Erev) with a 1.95-fold CaCl2 gradient was −6 mV, indicating Ca2+ selectivity. (c) Ca2+ versus Cl- permeability did not differ between APOL1 G0, G1 and G2. A conductance was obtained as in b, except that the chambers contained symmetrical 10 mM CaCl2. The Erev was determined as CaCl2 was titrated into the cis side. Plotted are cis/trans Ca2+ activity gradients (Robinson and Stokes, 2002) versus Erev. Also plotted is the Nernst equation for calcium, which represents ideal selectivity for Ca2+ over Cl- (d) Ca2+ permeability in the presence of excess KCl. Before recording, the cis side was adjusted to pH 6.9 and then 1 µg APOL1 G0 was added to the cis side. APOL1 was allowed to associate with the bilayer for 1 hr and then the cis side was perfused with chamber buffer (150 mM KCl, 1 mM CaCl2, pH 7.2). Once recording began, the cis side was adjusted to pH 6.6, allowing for APOL1 insertion and channel formation. A large increase in the conductance upon re-neutralization of the cis side (pH 7.2) indicates pH-dependent channel opening. Erev (+1.75 mV) was determined by adjusting the voltage until the current read zero. CaCl2 was then titrated into the cis compartment to the indicated concentrations. Upon each addition there was an upward shift in the current and the Erev became more negative, indicating Ca2+ permeability of the APOL1 channel. The pCa/pK permeability ratio at 2 mM calcium was calculated as 0.6 (See Materials and methods).

We then tested whether APOL1 was measurably permeable to Ca2+ at physiological salt concentrations (150 mM K+, 1 mM Ca2+). Adding an extra 1 mM CaCl2 to the cis compartment caused a positive shift in the current and negative shift in the reversal potential (Figure 2d). The pCa/pK permeability ratio at 2 mM Ca2+ was calculated as 0.6. This result confirms that APOL1 channels retain Ca2+ permeability even in the presence of physiologically relevant KCl concentrations and suggests that APOL1 may lead to a cellular influx of Ca2+.

To ascertain whether the RRVs lead to a cytoplasmic Ca2+ influx upon induction, we transfected the cytoplasmic calcium indicator GCaMP6f (Chen et al., 2013) into FT293 cells. Performing live-cell microscopy with GCaMP6f and cell death marker DRAQ7 allowed us to determine the timing of events between a potential Ca2+ influx and changes in cell morphology, plasma membrane integrity, and lysis. Upon induction, cells expressing the RRVs, but not G0, exhibited an increase in Ca2+ beginning approximately 12–18 hr after induction (Figure 3a, Video 1). The Ca2+ levels increased gradually and occurred several hours prior to cell swelling and membrane blebbing. Cells typically remained swollen for 12–18 hr before lysis (uptake of DRAQ7 was only detected in a few cells within 30 hr of induction, and only after lysis).

Expression of the RRVs leads to a Ca2+ influx that precedes cell swelling and death.

(a) Fluorescence traces of representative GCaMP6f-positive cells demonstrating that G1 and G2 cause a Ca2+ influx prior to cell swelling. GCaMP6f-transfected FT293 cells were incubated with DRAQ7 followed by 50 ng/mL doxycycline to induce APOL1 expression and then imaged via widefield every 10 min for 4.5–30 hr post induction. Traces represent levels of cytoplasmic Ca2+ over time as measured by GCaMP6f fluorescence (no DRAQ7 was observed in depicted cells). Cells are from Video 1. Scale bars = 20 μm. (b) High-throughput analysis revealed a significant increase of cytoplasmic Ca2+ levels driven by G1 and G2 compared to G0. Each point is the ∆F/F0 for an individually tracked cell and bars represent the cell population mean of GCaMP6f fluorescence. Cells were analyzed from 4 fields of view per condition, n = 1748. A one-way ANOVA multiple comparisons test was performed to compare the RRVs with G0 at the indicated timepoints.

Video 1
Expression of G1 and G2 leads to a Ca2+ influx prior to cell swelling.

FT293 cells were transfected with GCaMP6f 24 hr before imaging. Cells were then incubated with 3 µM DRAQ7 and with or without 50 ng/mL doxycycline to induce APOL1 expression. Cells were imaged via widefield from 4.5 to 30 hr post induction, and dual color images were taken every 10 min. Scale bars = 50 µm.

High-throughput microscopy was performed to analyze individual cells over time and compare the cell populations for changes in Ca2+-dependent GCaMP6f fluorescence. There was no difference in mean GCaMP6f fluorescence between the variants without induction. However, after 30 hr of induction we observed a 2 to 3-fold increase in mean GCaMP6f fluorescence with G1 and G2 relative to G0 (Figure 3b and Figure 3—Source data 1). These data confirm that RRV expression leads to an increase of cytoplasmic Ca2+ that precedes cell swelling and death, suggesting that Ca2+ influx is an early event contributing to cytotoxicity.

Ca2+ influx and cytotoxicity require trafficking of RRVs out of the ER, and the source of Ca2+ is extracellular

APOL1 contains a signal peptide (Monajemi et al., 2002) and localizes to the ER (Cheng et al., 2015) and PM (O'Toole et al., 2018; Olabisi et al., 2016), indicating passage through the secretory pathway. To investigate whether RRV-mediated cytotoxicity occurs when localized to the ER or by subsequent trafficking from it, we expressed the APOL1 variants using the bicistronic RUSH plasmid (Boncompain et al., 2012). RUSH encodes streptavidin targeted to the ER lumen and streptavidin-binding-peptide tagged APOL1 variants. The streptavidin binds to and retains tagged APOL1 in the ER. Upon treatment with biotin, APOL1 is released from the ER in a synchronous manner (Figure 4a).

Figure 4 with 2 supplements see all
Ca2+ influx and cytotoxicity of G1 and G2 requires trafficking from the ER.

(a) Schematic of the RUSH system. Streptavidin was expressed with a signal peptide and KDEL allowing for localization and retention in the ER lumen along with streptavidin-binding protein (SBP) tagged APOL1. SBP binds to streptavidin causing APOL1 to be retained in the ER until synchronous release is initiated by the addition of biotin. (b) Time course showing that RRV cytotoxicity requires trafficking from the ER. 24 hr after transfection, HEK293 cells were treated with or without (0 hr) 80 µM biotin at the indicated times. 48 hr post-transfection, cytotoxicity was measured via release of lactate dehydrogenase. To compare cytotoxicity between biotin treated and untreated (0 hr) for respective genotypes, a two-way ANOVA with multiple comparisons was performed (n = 6). (c) Fluorescence traces of GCaMP6f-positive HEK293 cells showing that the G1 and G2-mediated Ca2+ influx occurs after trafficking from the ER. GCaMP6f-transfected cells were incubated with DRAQ7 followed by 80 µM biotin to release APOL1 and were then imaged via widefield every 5 min for 1–18 hr post treatment. Cells are from Video 2. Scale bars = 20 μm. (d) High-throughput imaging and analysis was performed as in Figure 3b, demonstrating that the G1 and G2-mediated Ca2+ influx requires trafficking from the ER. Each point is the ∆F/F0 for an individually tracked cell and bars represent the cell population mean of GCaMP6f fluorescence. Cells were analyzed from 3 fields of view per condition, n = 1657. A one-way ANOVA multiple comparisons test was performed to compare the RRVs with G0 at the indicated timepoints.

RRV cytotoxicity required trafficking from the ER, leading to 20 % cell death 24 hr after biotin-mediated release in transfected HEK293 cells (Figure 4b). In contrast, G0 remained non-toxic after release. No cell death was detected when the APOL1 variants were retained in the ER. Cells producing RUSH-G0 and G1 variants exhibited similar levels of protein production after 24 hr of transfection, though RUSH-G2 expressed approximately 33% less protein (Figure 4—figure supplement 1a), possibly due to its higher cytotoxicity (Figure 4b at 12 hr, 4d at 2 hr with biotin).

We next utilized the RUSH system to determine if the previously observed RRV-mediated Ca2+ influx also required exit from the ER by co-transfection with GCaMP6f. Biotin-mediated release of RUSH-G1 and G2 from the ER led to a rapid increase in cytoplasmic Ca2+ within 2–4 hr of treatment. Approximately 2 hr after the initial Ca2+ influx, membrane blebbing and cell swelling were observed. Cells remained swollen for 4–6 hr until lysis, after which DRAQ7 was detected (Figure 4c, Video 2).

Video 2
Expression of RUSH-G1 and G2 leads to Ca2+ influx, swelling, and lysis only after release from the ER.

HEK293 cells were co-transfected with RUSH-APOL1 and GCaMP6f for 24 hr. Prior to imaging, 3 µM DRAQ7 was added and cells were treated with or without 80 µM biotin to release APOL1 from the ER. Cells were imaged via widefield from 1 to 18 hr post-biotin treatment, and dual color images were taken every 5 min. Scale bars = 20 µm.

High-throughput microscopy was performed revealing a significant increase in the cell population mean of GCaMP6f fluorescence between RUSH-G1 and G2 cells compared to G0. The analysis was limited to 4 hr post-biotin, as nearly all Ca2+ influx had begun within that time frame. Without biotin, no difference in GCaMP6f fluorescence was detected. With biotin, RUSH-G1 cells displayed a significant increase in GCaMP6f fluorescence compared to RUSH-G0 at 4 hr, while an increase in RUSH-G2 could be detected as early as 2 hr post-release (Figure 4d, and Figure 4—figure supplement 1b and e). This experiment was reproduced in CHO cells (Figure 4—figure supplement 1c–d, Video 3). These results robustly demonstrate the requirement for G1 and G2 to exit the ER in order to drive a Ca2+ influx and cytotoxicity.

Video 3
Expression and ER release of RUSH-G1 and G2 leads to Ca2+ influx and lysis in CHO cells.

CHO cells were co-transfected with RUSH-APOL1 and GCaMP6f for 24 hr. Prior to imaging, cells were treated with or without 80 µM biotin to release APOL1 from the ER. Cells were imaged via widefield from 1 to 12 hr post biotin treatment, and images were taken every 5 min. Scale bars = 20 µm.

The ER is the largest reservoir of intracellular Ca2+ (Burdakov et al., 2005), and sequestration and release of ER Ca2+ stores plays a pivotal role in many signaling and cell death pathways (Berridge, 2002; Zhivotovsky and Orrenius, 2011). To determine if ER Ca2+ release occurs with APOL1 cytotoxicity, cells were co-transfected with RUSH-APOL1, GCaMP6f, and the ER Ca2+ sensor ER-LAR-GECO (Wu et al., 2014). The combination of these sensors allows for visualization of ER Ca2+ release or lack of re-uptake, as evidenced by treatment with the sarcoendoplasmic reticulum calcium transport ATPase inhibitor thapsigargin (Figure 4—figure supplement 2a). Cells exhibiting the established phenotype of cytoplasmic Ca2+ influx followed by swelling were analyzed for fluorescence changes in both sensors. While cytoplasmic Ca2+ increases, there is no release of Ca2+ from the ER (Figure 4—figure supplement 2b–e, Video 4). The lack of ER Ca2+ release indicates that the source of Ca2+ in RRV-mediated cytotoxicity is extracellular, possibly conducted via G1 and G2 cation channels at the PM.

Video 4
Expression and release of RUSH-G1 and G2 does not induce ER Ca2+ release.

CHO cells were co-transfected with RUSH-APOL1, GCaMP6f, and ER-LAR-GECO for 24 hr prior to imaging. On the day of the experiment cells were treated with 80 µM biotin and imaged for 0.5–12 hr post treatment. Cells that displayed the established phenotype of Ca2+ influx followed by cell swelling were selected. Dual color images were taken every 5 min. Scale bars = 20 µm.

APOL1 localizes to the PM prior to Ca2+ influx

Overexpressed APOL1 has previously been reported to reach the PM (O'Toole et al., 2018; Olabisi et al., 2016; Heneghan et al., 2015). We hypothesize that G1 and G2 must first localize to the PM in order to form cation channels that lead to the observed ion flux and cell swelling. Using confocal immunofluorescence microscopy, we tested whether RUSH-APOL1 would traffic to the PM after biotin treatment, and if localization to the PM occurs within a timeframe before Ca2+ influx is first detected in CHO cells (1.75–2 hr post-release, Figure 4—figure supplement 1d, Video 3).

We found that RUSH-APOL1 traffics to the PM prior to detection of the Ca2+ influx, consistent with APOL1 forming cation channels in the plasma membrane. Intracellular antibody staining of ER-retained RUSH-APOL1 cells reveals extensive co-localization with the calnexin-stained ER, as expected (Figure 5a, no biotin). After 90 min of biotin treatment, all three APOL1 variants are detected at the PM (Figure 5a, with biotin, white arrows). Additionally, APOL1 localizes to the peri-nuclear region post ER release, which is suggestive of localization within the Golgi or recycling endosomes after it exits the ER and traffics to the PM (Figure 5—figure supplement 1). Some RUSH-G1 and G2 expressing cells also undergo swelling after 90 min of biotin treatment. In swollen cells, the PM is enriched in APOL1 and the ER is retracted, potentially due to hydrostatic pressure.

Figure 5 with 1 supplement see all
APOL1 traffics to the PM prior to Ca2+ influx.

(a) Confocal images of transfected and permeabilized CHO cells depict RUSH-APOL1 (red) localized to the ER (stained via calnexin, green) without biotin followed by partial PM localization after 90 min of biotin treatment. Representative cells from n = 3 independent experiments. (b) RUSH-APOL1 localizes to and forms punctae at the PM within 90 min of biotin treatment. CHO cells were treated and imaged as in (a) except without permeabilization. Here anti-calnexin (green) was used as a control for cell permeabilization (depicted in the merged images, no permeabilization was detected). Representative cells from n = 4 independent experiments. (c) High-throughput confocal microscopy reveals that RUSH-APOL1 begins localizing to the PM within 60–90 min. Cells were randomly imaged at 20x, capturing ≥10 fields of view per well from 3 replicate wells for each condition. Calnexin signal was used to filter out permeabilized cells. Each dot represents a single cell (n = 462,918 cells analyzed). (d–e) RUSH-APOL1 localization to the PM steadily increases until 90 min post release from the ER. (d) The mean intensity of all cells in (c) was normalized to the respective no biotin controls. (e) The percentage of cells expressing RUSH-APOL1 at the PM was determined using a threshold set by untransfected wells, and then normalized to the respective no biotin controls. For analysis of (d) and (e), a generalized linear model was used to make pairwise comparisons between all samples. Comparisons were performed between biotin treated and untreated cells within each respective genotype. All data are represented as mean ± s.d. (a–b) Scale bars = 10 µm.

Correspondingly, via cell surface immunostaining, all RUSH-APOL1 variants were detected at the PM within 90 min of release and displayed a punctate staining pattern (Figure 5b). Due to the leakiness of the RUSH system, APOL1 was also found at the PM of some untreated cells. However, high-throughput microscopy of the transfected cells treated with biotin for 0–120 min revealed a steady increase of APOL1 localization to the PM, peaking at 90 min post-release. After 90 min of biotin treatment, mean APOL1 signal intensity at the PM increased 25–30%, and the number of cells positive for APOL1 staining at the cell surface increased 3–4 fold compared to untreated cells (Figure 5c–e). Less G2 was detected at the surface compared to G0 and G1 (Figure 5b–c), potentially due to the combination of lower protein expression (Figure 4—figure supplement 1a) and higher cytotoxicity (Figure 4b at 12 hr and 4d at 2 hr with biotin). However, cell surface expression still increased in a similar manner compared to G0 and G1. These results demonstrate that RUSH-APOL1 traffics to the PM within the timeframe that a cytoplasmic increase in Ca2+ is first detected, and suggests that G1 and G2 form cation channels at the PM as an early event that leads to cytotoxicity.

RRV-mediated cytotoxicity is driven by the influx of both Na+ and Ca2+

As a non-selective cation channel, APOL1 may lead to cell death in a variety of ways. It has been postulated that the driver of cell death is APOL1-mediated K+ efflux (Olabisi et al., 2016). In that study, Olabisi et al. incubated APOL1-expressing 293 cells in ‘CKCM’ media for 24 hr, in which all Na+ was replaced by K+. The study reported that incubating cells in CKCM reduced RRV cytotoxicity by approximately 50%. Additionally, APOL1 led to K+ efflux in trypanosomes (along with a Ca2+ influx) (Rifkin, 1984). While APOL1 undoubtedly leads to a K+ efflux, the cell is already highly permeable to K+ due to the presence of leak channels in the plasma membrane, allowing the cell to rapidly respond to changes in membrane potential or cell volume. Conversely, the cell membrane is minimally permeable to Na+ and Ca2+, and this permeability could significantly increase in the presence of open G1 and G2 channels at the cell surface. Therefore, we hypothesized cytotoxicity is driven by the influx of Na+ and Ca2+, rather than solely by the efflux of K+.

We sought to replicate the conditions of the CKCM experiment performed by Olabisi et al. In addition to replacement of Na+ with K+, we also tested Na+ replacement with the larger choline+. rAPOL1 channels were tested for permeability of choline+ in the planar lipid bilayer system (Figure 6a). Under conditions of symmetrical 150 mM KCl, Erev was +1 mV (Figure 6b), and when the cis-side was perfused and replaced with buffer containing 150 mM NaCl (leaving trans 150 mM KCl unchanged), there was only a slight change in Erev to −2 mV. However, when cis NaCl was perfused and replaced with choline Cl (trans KCl unchanged), there was a significant increase in Erev to +60 mV, indicating conductance of K+ from the trans to the cis side, and minimal conductance of choline+ (Figure 6b). Substituting into the Goldman-Hodgkin-Katz equation (assuming zero permeability to chloride) gives K:Na and K:choline permeability ratios of 1.0:1.1 and 1.0:0.1 respectively. These results demonstrate that the APOL1 channel is at least 10 times more permeable to K+ and Na+ than choline+.

Figure 6 with 4 supplements see all
RRV cytotoxicity is driven by the influx of both Na+ and Ca2+.

(a) Schematic of the planar lipid bilayer setup showing the sequence of cis buffer perfusions. (b) The APOL1 channel is readily permeable to Na+, but not choline+. In symmetrical KCl solutions Erev was determined as + 1 mV. Then, after cis perfusion with equimolar NaCl buffer (pH 7.2, horizontal bar) there was only a slight change in Erev (Erev = −2 mV; 4 mV scale). In contrast, Erev increased to + 60 mV after exchanging the cis solution for chamber buffer containing equimolar choline chloride. Substituting into the Goldman-Hodgkin-Katz equation (assuming zero permeability to chloride) gives K:Na and K:choline permeability ratios of 1.0:1.1 and 1.0:0.1 respectively. There are two breaks in the record (indicated by //), during which the perfuser was recharged with the appropriate solution. (c) The cytotoxicity of the RRVs in RUSH transfected HEK293 cells is significantly reduced by lowering extracellular Na+ from 150 mM to 85 mM. The rescue from cytotoxicity was indistinguishable between replacement with either K+ or choline+ (n = 9). (d) RRV cytotoxicity was reduced by lowering extracellular Ca2+ from 1.8 mM to 0.45 or 0.1125 mM (n = 12). (e) Reduction of both extracellular Ca2+ and Na+ (replaced by choline+) has an additive effect in lowering RRV cytotoxicity, as seen by further rescue from cell death with 0.45 mM Ca2+ combined with 85 mM Na+ (n = 13). (c–e) Cell death was assayed 12 hr post-biotin treatment with the Promega MultiTox fluorescent assay. Two-way ANOVAs with multiple comparisons were performed. (f) RRV mediated cytotoxicity is driven by the concurrent influx of both Ca2+ and Na+. CHO cells were co-transfected with either RUSH-G0 or G2, GCaMP6f, and the membrane voltage sensor FliCR. G2 cells exhibiting the established phenotype of Ca2+ influx followed by cell swelling were analyzed for changes in membrane voltage (used as a surrogate for the influx of Na+) (n = 21). G0 cells treated with biotin were analyzed for comparison (n = 7). Blue boxes and arrows indicate when the sustained increase in Ca2+ initiates. The representative cells from this figure can be viewed in Figure 6—video 1.

In order to replace Na+ with K+ or choline+ in the cell culture media, we first tested the effect these conditions have on cell viability. HEK cells were transfected with RUSH-G0 plasmid and incubated for 12 hr in HBSS containing various amounts of NaCl replaced with equal amounts of choline Cl or KCl to make up 130 mM of salt (media contained 150 mM Na+). Reducing Na+ to 52.5 mM and replacing it with K+ led to a 40% reduction in cell viability, whereas replacement with choline+ only had a modest effect on cell viability (Figure 6—figure supplement 1a). Further reduction of Na+ to 20 mM led to a 75% decrease in viability when replaced by choline+ (Figure 6—figure supplement 1b). Due to these results, we decided to lower Na+ to 85 mM for further experimentation, where choline+ had no significant effect on viability. A loss of cell viability with K+ replacement of Na+, however, was unavoidable even at higher concentrations of Na+. Additionally, higher amounts of KCl were avoided due to its ability to depolarize the cell.

Reduction of Na+ to 85 mM inhibited RRV cytotoxicity by 40–60% (Figure 6c). This level of rescue was similar to the amount reported by Olabisi et al. There was no significant difference between rescue caused by replacement with choline+ or K+, suggesting that the influx of Na+ is a driver of APOL1-mediated cell death, and that it is upstream of the previously reported K+ efflux.

As G1 and G2 lead to a cellular influx of Ca2+, we tested whether Ca2+ itself may act as a driver of cell death. Extracellular Ca2+ was serially diluted from 1.8 mM to 0.1125 mM, and a significant reduction in cell death was recorded at Ca2+concentrations ≤ 0.45 mM, (Figure 6d and Figure 6—figure supplement 1c). Conversely, increasing extracellular Ca2+ exacerbated cell death (Figure 6—figure supplement 1d–e). Reduction of Ca2+ and Na+ simultaneously (0.45 mM Ca2+ and 85 mM Na+ supplemented with choline+) had an additive effect on inhibiting RRV cytotoxicity (Figure 6e). These results demonstrate that both Na+ and Ca2+ influx are the initial drivers of RRV-mediated cell death.

Having demonstrated a role for extracellular Na+ and Ca2+ in RRV-induced cell death, we next sought to measure Na+ influx and compare its timing with the influx of Ca2+. Due to a lack of any genetically encoded Na+ sensors for long-term imaging, we utilized the plasma membrane voltage sensor FliCR as a readout for Na+ influx. FliCR expressing cells exhibited an approximately 20–30% increase in ∆F/F0 upon depolarization with addition of 50 mM KCl to the extracellular milieu (Figure 6—figure supplement 2a).

CHO cells were co-transfected with RUSH G0 or G2, GCaMP6f, and FliCR and imaged every 5 min for 0.5–12 hr after biotin treatment. No sustained increases in cytoplasmic Ca2+ or membrane depolarization were detected in G0-expressing cells (Figure 6f and Figure 6—figure supplement 2b). The initial G2-mediated Ca2+ influx occurred concurrently with an increase in membrane depolarization (Figure 6f blue boxes, Figure 6—figure supplement 3, Figure 6—video 1). As Ca2+ continued to accumulate within the cytoplasm, cells either exhibited a parallel increase in membrane depolarization, or underwent erratic fluctuations followed by significant depolarization prior to cell death (Figure 6—figure supplement 3).

Na+ influx can drive accumulation of intracellular Ca2+, either by disrupting the Na+/Ca2+ exchanger at the PM (Barry et al., 1985) or by depolarizing the cell and causing voltage-gated Ca2+ channels to open. However, while these events may contribute to Ca2+ accumulation, APOL1 itself can conduct Ca2+ (Figure 2a–d) and leads to a large and sustained influx. Indeed, the G2-mediated Ca2+ influx was unaffected by Na+ replacement with choline+ or K+ (Video 5). Therefore, the RRVs drive cytotoxicity by directly increasing the membrane permeability of both Na+ and Ca2+.

Video 5
Replacement of NaCl with choline Cl or KCl does not affect the G2-mediated Ca2+ influx.

CHO cells were co-transfected with RUSH-G2 and GCaMP6f for 24 hr prior to imaging. On the day of the experiment cells were treated with 80 µM biotin and incubated in media containing 150 mM Na+ (130 mM NaCl), 85 mM Na+ and 65 mM choline+, or 85 mM Na+ and 65 mM K+. The G2-mediated Ca2+ influx was unaffected by reduced Na+. 3 different fields are shown for each condition. Cells were imaged every 5 min from 0.5 to 12 hr post-biotin. Scale bar = 100 µm.

The cytotoxicity of all APOL1 variants is dependent upon acid-driven activation

The APOL1 cation channel requires two steps to become functional: an acidic pH to drive irreversible membrane insertion, followed by a neutral pH to open the channel (Figure 2b; Thomson and Finkelstein, 2015). Acidification is also required for trypanolytic activity, as trypanosomes pre-treated with the weak base ammonium chloride are protected against APOL1 (Hager et al., 1994). Within a mammalian cell, APOL1 can encounter acidic and neutral environments by trafficking along the secretory pathway (Paroutis et al., 2004). However, while all three APOL1 variants traffic to the PM and form channels that are permissive to Na+, K(Thomson and Finkelstein, 2015), and Ca2+ (Figure 2c) in a planar lipid bilayer, only G1 and G2 lead to cytotoxicity in our models and cause disease. The existence of a chaperone in mammalian cells that mimics the serum resistance associated protein (SRA) (Limou et al., 2015) found in Trypanosoma brucei rhodesiense (Pérez-Morga et al., 2005) has been proposed. SRA directly binds to and inactivates G0, preventing its acid activation, but is evaded by G2 (Thomson and Finkelstein, 2015; Thomson et al., 2014). If G0 is sequestered by an unknown chaperone while trafficking along the secretory pathway, or alternatively if G0 is less sensitive to pH changes relative to the RRVs, this could prevent the insertion event necessary for channel formation.

To circumvent this potential regulatory mechanism along the secretory pathway, RUSH-APOL1 transfected cells were transiently acidified at pH 5.5 and then re-neutralized. This was performed 2 hr post biotin-mediated release, allowing for APOL1 localization to the PM. Under these conditions, RUSH-G0 led to 12.5 % cytotoxicity after release from the ER (Figure 7a). Additionally, the cytotoxicity of RUSH-G1 and G2 increased 1.5 to 2-fold if acidified. Conversely, reducing the acid-activation of APOL1 by pre-treatment with the weak base ammonium chloride significantly lowered the cytotoxicity of G1 and G2 (Figure 7b). The modulation of APOL1-mediated cell death by raising or lowering the pH indicates that not all G1 and G2 at the PM are in an active channel state. These results demonstrate that G0 contains the potential to be innately cytotoxic, however this cytotoxicity is prevented by an unknown mechanism. Conversely, G1 and G2 more readily convert into the active channel state during periods of sustained expression, leading to cell death and disease (Figure 8).

Acidic activation of APOL1 drives channel formation and cytotoxicity.

(a) Acidification and neutralization of RUSH-APOL1 transfected HEK293 cells causes G0 to become cytotoxic and exacerbates the cytotoxicity of G1 and G2. 24 hr after transfection cells were treated with or without 80 µM biotin. 2 hr post-biotin, cells were incubated with media +/- succinic acid at pH 5.5 for 1 hr followed by neutralization. Cytotoxicity was measured 24 hr post-biotin (n = 13). (b) Pre-treatment with ammonium chloride protects against the cytotoxicity of G1 and G2. RUSH-APOL1 transfected HEK293 cells were treated with the indicated amounts of ammonium chloride 30 min prior to biotin treatment. Cytotoxicity was then measured 8 hr after biotin-mediated release (n = 11). (a–b) Cytotoxicity was measured via release of lactate dehydrogenase. A two-way ANOVA comparing treated and untreated cells within each respective genotype was performed.

Model of RRV-mediated cytotoxicity: G1 and G2 form cation channels at the PM.

(a) Proposed model of APOL1 trafficking and cytotoxicity. All variants of APOL1 will traffic to the PM, en route they will encounter acidification and neutralization along the secretory pathway, steps required for channel formation. However, while G1 and G2 are able to form cation channels when overexpressed, G0 does not. We hypothesize that G1 and G2 are more sensitive to pH-activation than G0, leading to channel formation. Artificial acidification of cells after localization of APOL1 to the PM caused G0 to become toxic. The increase in G1 and G2 cytotoxicity post-artificial acidification demonstrates that not all APOL1 at the PM is in a channel conformation. Protection against cytotoxicity due to pre-treatment with the weak base ammonium chloride signifies the requirement for acid-activation. (b) At the PM, G1 and G2 channels will lead to an influx of extracellular Na+ and Ca2+, initiating a cascade of events that eventually lead to cell death. Cell death is represented by the assays utilized in this study (release of cytoplasmic lactate dehydrogenase or influx of the live/dead stain DRAQ7).

Discussion

The goal of this study was to investigate the underlying mechanisms driving APOL1-mediated kidney disease. A comprehensive analysis using genetic, biochemical, and microscopy-based approaches revealed that RRV-mediated cytotoxicity first requires trafficking out of the ER to the PM, where they cause a cytotoxic cation flux followed by cell swelling, culminating in lysis. As channel activity leading to a Ca2+ and Na+ influx is the earliest observed event leading to cell death, and because Ca2+ is a potent signaling molecule that can activate many signaling and cell death pathways (Berridge, 2002; Zhivotovsky and Orrenius, 2011), we propose this upstream event links the many APOL1-associated cell death pathways together.

We first replicated previously reported results that the RRVs lead to cytotoxicity (Figure 1c; Olabisi et al., 2016), which was marked by membrane blebbing and a swollen cell phenotype (Videos 13), the latter of which was also observed in human serum treated trypanosomes (Rifkin, 1984). Importantly, we used the naturally occurring alleles of APOL1 (Figure 1a). A study by O’Toole et al. reported that G0 and the RRVs were equally cytotoxic, however their approached utilized artificially synthesized RRVs where C-terminal mutations were introduced into the G4 allele (Figure 1a; O'Toole et al., 2018), which has been shown to have reduced cytotoxicity compared to the naturally occurring haplotype (Lannon et al., 2019). As the lytic activity of APOL1 is sensitive to even single amino acid changes (Cuypers et al., 2016), it is imperative to only use the naturally occurring alleles to draw relevant conclusions regarding kidney disease. While we have used the most prevalent haplotype of G0 with amino acid K150 as our control, it is important to consider the use of G0 E150 for future studies, as G1 and G2 arose in the E150 haplotype background (Figure 1a). It should be noted that there was no difference in cytotoxicity between G0 E150 and G0 K150 as reported by Lannon et al.

We are the first to report that the APOL1 channel is permeable to Ca2+, however the selectivity of APOL1 has been controversial. Cl- selectivity was first reported, however this study utilized a truncated rAPOL1 (Pérez-Morga et al., 2005) that was later shown to be non-functional (Molina-Portela et al., 2008). Cl- selectivity was also reported using KCl-loaded large unilamellar vesicles (Bruno et al., 2017), however, Cl- selectivity only occurred at pH 5.0, and they reported APOL1 was K+ selective at pH 7.1. While APOL1 may indeed be permeable to Cl-, this occurs at pH 5.0 where only a minor current is recorded in planar lipid bilayers. Once neutralized, the current increases several hundred-fold due to the opening of the APOL1 cation channels (Figure 2b; Thomson and Finkelstein, 2015). Opening of these cation channels (but not the minor conductance at acidic pH) was also inhibited by recombinant SRA protein, suggesting a relevance to trypanosome lysis (Thomson and Finkelstein, 2015). Additionally, APOL1 causes the dissipation of Na+ (Figure 6f) and K+ gradients in animal cells and trypanosomes (Rifkin, 1984; Olabisi et al., 2016; Heneghan et al., 2015), and its trypanolytic activity is inhibited when extracellular Na+ is replaced by larger cations that are APOL1-impermeant (Molina-Portela et al., 2005; Figure 6a–b). The results in this paper, together with the previous studies strongly implicate a role for the APOL1 cation channel in biological function, whereas any relevance of Cl- flux remains to be demonstrated.

Through the use of live-cell microscopy with Ca2+ sensors GCaMP6f and ER-LAR-GECO and the membrane voltage sensor FliCR, we were able to discern that the upstream event leading to cell death is a cytoplasmic influx of extracellular Na+ and Ca2+. This was robustly reproduced in multiple cell lines and with the RUSH system, revealing that trafficking of APOL1 out of the ER was required for cytotoxicity. While we described an APOL1-driven Ca2+ influx in this study, another group reported no changes in cytoplasmic Ca2+(O'Toole et al., 2018). However, their approach utilized the dye Fura-2 measured via fluorescent plate reader at a single timepoint. Using the genetically encoded GCaMP6f and the more sensitive technique of time-lapse, live-cell fluorescent microscopy allowed us to observe the robust Ca2+ influx caused by the RRVs.

K+ efflux has been proposed as the mechanism that drives APOL1-mediated cell death, however our data demonstrate that this event is likely a response to Na+ influx. Unlike K+, Na+ and Ca2+ have a very low permeability across the plasma membrane meaning that APOL1 channels reaching the cell surface will conduct a measurable influx of Na+ and Ca2+. Na+ influx will lead to the observed swelling and depolarization, both of which cause the classic cellular response of K+ efflux, which in turn can also affect cell viability via stress activated protein kinases as previously reported (Olabisi et al., 2016). Additionally, the observed protection offered by CKCM media (replacement of all Na+ with K+) is likely due to the fact that Na+ has been removed (Figure 6c). As APOL1 is also permeable to K+, it likely contributes directly to the efflux of K+, though not to the same degree as Na+ and Ca2+ influx due to of the presence of other K+ channels at the PM. Independent of Na+/K+ flux, a sustained influx of Ca2+ over several hours, which is usually tightly regulated by the cell, can activate a multitude of signaling pathways that may also contribute to cell death.

In order for G1 and G2 to drive a cytotoxic influx of extracellular Ca2+, we reasoned that they must reach the PM within the 120 min where an increase of cytoplasmic Ca2+ is first detected. Indeed, high-throughput confocal immunofluorescence revealed that all variants of RUSH-APOL1 trafficked with similar kinetics to the PM, which occurred within 60–90 min of biotin treatment (release of ER-retained APOL1). Upon reaching the PM, APOL1 formed a punctate staining pattern. Additionally, localization of APOL1 to the PM was corroborated by other studies (O'Toole et al., 2018; Olabisi et al., 2016; Heneghan et al., 2015). We also report that APOL1 localizes to the peri-nuclear region in some cells, indicating passage through the Golgi and/or endosomes. Interestingly, we observed that the ER had receded from its association with the PM in swollen cells, potentially due to an increase in hydrostatic pressure. A similar phenotype was observed in human submandibular gland cells treated with a hypotonic solution, which caused a loss of ER:PM contact sites (Liu et al., 2010). This may help explain the previously reported case of APOL1-mediated ER stress (Wen et al., 2018).

While all three variants are equally permissive for Ca2+ and traffic to the PM in a similar fashion, only the RRVs are cytotoxic. It has been postulated that an SRA-like chaperone may exist to prevent G0 cytotoxicity (Limou et al., 2015), however no such binding partner has been found. We discovered that by artificially acidifying and therefore activating the non-toxic G0 after PM-localization, followed by re-neutralization, G0 led to cell death. Under these conditions RRV-mediated cytotoxicity was also exacerbated. Conversely, pre-treatment with ammonium chloride protected cells from RRV cytotoxicity. This demonstrates the importance of acidic activation for APOL1 channel activity, and that unlike G0, the RRVs more readily arrive at the PM in a channel active state.

It is imperative to elucidate the mechanism that prevents G0 cytotoxicity in order to understand how APOL1-mediated kidney disease manifests. Additionally, future work should determine how an acid-neutral pH gradient across a membrane activates APOL1 to form a channel, which may alter conformation or drive oligomerization. As can be seen in Figure 7a, G0 becomes cytotoxic only after additional acidification and neutralization. It may be that the RRVs are slightly more sensitive to acidification and therefore become activated more readily compared to G0, leading to kidney disease.

In summary, our results demonstrate that the kidney disease associated variants of APOL1 form cytotoxic cation channels at the cell surface. Live-cell analyses demonstrate an initial event leading to cell death is cation flux across the PM, with major ion components being extracellular Na+ and Ca2+. This ion flux precedes cell swelling by several hours and is therefore the likely driver of cell death. Because many of the reported pathways associated with APOL1 cell death and disease can be activated by pore-forming toxins and/or Ca2+ signaling, we propose that the upstream event linking them is APOL1 channel activity at the PM. Taken together, our data strongly suggest that the primary focus for drug development should be prevention of G1 and G2 channel activity and targeting of activated APOL1 channels at the PM within the kidney.

Materials and methods

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Recombinant DNA reagent (Homo sapiens)APOL1-G0NCBIBC143038.1cDNA
Recombinant DNA reagent (Homo sapiens)APOL1-G1NCBIAF305428.1cDNA
Recombinant DNA reagent (Homo sapiens)APOL1-G21000 genomes project, this
paper
cDNA
*Constructed from mutagenesis from APOL1-G0. Protein coding sequence based off of 1000 genomes data
Recombinant DNA reagent
PRG977
PRG977Regeneron
Recombinant DNA reagent and transfected construct pcDNA5/FRT/TOpcDNA5Thermo
Fisher
V652020APOL1 variants cloned into this plasmid to generate stable cell line (FT293-APOL1_
Recombinant DNA reagent and transfected construct pOG44p0G44Thermo
Fisher
V600520
Recombinant DNA reagent and transfected pcDNA6/Tet-repressorpcDNA6/Tet-repressorThermo
Fisher
R25001
Recombinant DNA reagent and transfected Str-KDEL-SBP-EGFP-GPIRUSHAddgene65293Gift from Franck Perez.
APOL1 variants cloned into this plasmid for transfection into cells (RUSH-APOL1). GFP and GPI anchor removed
Recombinant DNA reagent and transfected pGP-CMVB-GCaMP6fGCaMP6fAddgene40755A gift from Douglas Kim and the GENIE project
Recombinant DNA reagent and transfected CMV-ER-LAR-GECO1ER-LAR-GECOAddgene61244A gift from Robert Campbell
Recombinant DNA reagent and transfected
CMV-FliCR
FliCRAddgene74142A gift from Robert Campbell
Sequence based reagentAPOL1_G0 K150E mutagenesis primersThis paperPCR primer pairF:5'TGAAAGAGTTTCCTCGGTTGAAAAGTGAGCTTGAGGATAAC
R:5'GTTATCCTCAAGCTCACTTTTCAACCGAGGAAACTCTTTCA
Sequence based reagentAPOL1-G0 E150 Conversion to G1 mutagenesis
Round 1 (S243G)
This paperPCR primer pairF:5'CGGATGTGGCCCCTGTAGGCTTCTTTCTTGTG
R:5'CACAAGAAAGAAGCCTACAGGGGCCACATCCG
Sequence based reagentAPOL1-G0 E150 Conversion to G1 mutagenesis
Round 2 (I384M) (Round 1 as template)
This paperPCR primer pairF:5'GGAGCTGGAGGAGAAGCTAAACATGCTCAACAATAATTATAAGA
R:5'TCTTATAATTATTGTTGAGCATGTTTAGCTTCTCCTCCAGCTCC
Sequence based reagentAPOL1-G0 E150 Conversion to G12 mutagenesisThis paperPCR primer pairF:
5'AGCTAAACATTCTCAACAATAAGATTCTGCAGGCGGAC
R:
5'GTCCGCCTGCAGAATCTTATTGTTGAGAATGTTTAGCT
Sequence based reagentInsertion of APOL1 cDNA into pcDNA 5 vectorThis paperPCR primer pairF:
5'ATGATATCGCCACCATGGAGGGAGCTG
R:
5'ATCTCGAGTCATCACAGTTCTTGGTCCGCCTG
Sequence based reagentInsertion of APOL1 cDNA into RUSH vectorThis paperPCR primer pairF:
5'ATGCCCTGCAGGAGAGGAAGCTGGAGCGAGG
R:
5'ATGCTCTAGACTATCACAGTTCTTGGTCCGCC
Cell line (Homo sapiens)HEK293ATCCCRL-1573
Cell line (Homo sapiens)FlpIn HEK 293Thermo FisherGift from Dr. Christian Brix Folsted Andersen. Converted into FlpIn TREX293
Cell line (Homo sapiens)Conditionally Immortalized Human podocytesSaleem et al., 2002Gift from Dr. Moin Saleem and Dr. Jeffrey Kopp
Cell line (Cricetulus griseus)CHOATCCCCL-61
AntibodyMouse anti-APOL1Proteintech66124–1-IgWB
1:2000
IF
1:800
AntibodyRabbit anti-APOL1Proteintech11486–2-APWB
1:5000
AntibodyRabbit anti-GAPDHProteintech10494–1-APWB
1:5000
AntibodyRabbit anti-CalnexinStressgenSPA-860IF
1:200
AntibodyGoat anti-mouse 680RDLICOR92568070WB
1:10,000
AntibodyDonkey anti-rabbit 800CWLICOR925–32213WB
1:10,000
Antibodyanti-rabbit Alexa 488 plusThermo
Fisher
A32731IF
1:1500
Antibodyanti-mouse Alexa 647Thermo
Fisher
A21236IF
1:1000
Chemical compound, drugHCS Nuclear MaskThermo
Fisher
H10325IF
1:400
Chemical compound, drugDRAQ7Abcamab109202Live cell microscopy
3 µM
Chemical compound, drugThapsigarginThermo
Fisher
T7458
Chemical compound, drugInterferon gammaR and D Systems285IF100
Chemical compound, drugLactate dehydrogenase assayPromegaG1781Cytotox 96 Non-Radioactive Cytotoxicity Assay
Commercial assay kitMultiTox-Fluor Multiplex Cytotoxicity AssayPromegaG9201
Commercial assay kitQuik Change II Mutagenesis KitAgilent200523
SoftwareTrackMateTinevez et al., 2017
SoftwarePrismGraphPad
SoftwareR-multicomp packageHothorn et al., 2008

Cloning and vector construction

Request a detailed protocol

APOL1-G0 (BC143038.1) (Variant containing K150, Figure 1a) linear protein structure was determined using JPred (Cole et al., 2008). APOL1-G0 cDNA in the PRG977 plasmid was subjected to multiple rounds of mutagenesis using the QuikChange II Mutagenesis Kit (Agilent, Santa Clara, CA. 200523), to generate G1 (K150E, S342G, I384M) and G2 (K150E, NY del 388:389). APOL1 cDNA was inserted into the pcDNA5/FRT/TO (Thermo, Waltham, MA. V652020) and the Str-KDEL_SBP-EGFP-GPI (RUSH) (A gift from Franck Perez, Addgene 65293) (Boncompain et al., 2012) mammalian expression vectors. The APOL1 cDNA inserted into the RUSH contained the sequence just downstream of the signal peptide cleavage site at A27.

Cell culture and transfections

Request a detailed protocol

FlpIn 293 cells from Thermo Scientific were first transfected with the pcDNA6/Tet-repressor plasmid and selected with Zeocin (Gibco, Waltham, MA. R25001) at 100 µg/mL and blasticidin (Gibco R21001) at 5 µg/mL. A single clone was expanded to generate all FT293-APOL1 cells. For single copy APOL1 cDNA cell lines, the Flp recombinase vector pOG44 (Thermo V600520) and APOL1 pcDNA5/FRT/TO were co-transfected at a 9:1 ratio. Selection was performed with blasticidin at 5 µg/mL and Hygromycin B (Thermo 10687010) at 150 µg/mL. Foci were pooled and polyclonal cell lines for APOL1 G0, G1, G2, and empty vector were expanded. Cells were then maintained in DMEM (Corning, Corning, NY. 10–017 CM) with 1 mM sodium pyruvate (Sigma, St. Louis, MO. P5280), 10% tet-free FBS, 100 µg/mL Hygromycin B, and 5 µg/mL blasticidin. All experiments were performed in the absence of antibiotics. APOL1 cDNA expression was induced in these cell lines with the addition of doxycycline (Sigma D9891) at 50 ng/mL unless otherwise stated.

HEK293 cells were cultured in DMEM + 10% FBS, CHO cells in F12K (ATCC 30–2004) + 10% FBS, and conditionally immortalized human podocytes (Saleem et al., 2002) in RPMI1640 (Corning 10–040-CV)+ 10% FBS and ITS (Gibco 41400045). Podocytes were maintained at 33C on Type-I collagen-coated plates. For experiments, podocytes were moved to 37C for 5–7 d to allow for differentiation, and then treated for 24 hr with the indicated amounts of Interferon-γ (R and D Systems, Minneapolis, MN. 285IF100). Cells were regularly tested for mycoplasma.

To perform Na+ replacement and Ca2+ reduction experiments, RUSH-APOL1 transfected HEK293 cells were cultured in Hank's Balanced Salt Solution supplemented with 10% fetal bovine serum, 4 mM L-glutamine, MEM amino acids (Thermo 11130051), MEM non-essential amino acids (Thermo 11140076), and 1 mM sodium pyruvate (approximately 20 mM Na+ in total). For Ca2+ reduction experiments, HBSS media was supplemented with 130 mM NaCl and CaCl2 was serially diluted from 1.8 mM to 0.1125 mM. All plates were coated with 2.5 µg/cm2 of fibronectin (Sigma F1141) to promote cell attachment in a low Ca2+ environment. For Na+ replacement, NaCl in media was reduced from 130 mM (150 mM total Na+) to 65 mM and replaced with equal amounts of choline Cl or KCl. Cell death was assayed using the MultiTox-Fluor Multiplex Cytotoxicity Assay (Promega G9201) 12 hr after addition of biotin.

Cells were transfected with Lipofectamine 3000 as per the manufacturer’s instructions. Cytotoxicity was measured via release of lactate dehydrogenase (LDH) using the Cytotox 96 Non-Radioactive Cytotoxicity Assay (Promega, Madison, WI. G1781). To simultaneously measure cytotoxicity and viability, the MultiTox-Fluor Multiplex Cytotoxicity Assay was used in combination with black-walled, optical bottom 96 well plates (Thermo 165305) and read on a Molecular Devices SpectraMax Gemini. Percent cell death was calculated first by determining the cytotoxicity/viability for each sample, followed by using minimum and maximum cell death controls.

Lysate collection and immunoblotting

Request a detailed protocol

Lysates were collected in NP-40 lysis buffer (150 mM NaCl, 1.0 % NP-40, 1 mM EDTA, 50 mM Tris, pH 8.0) with HALT protease inhibitor (Thermo 78430). Total protein content was quantified with the DC protein assay (Bio-Rad, Hercules, CA. 5000112) and samples were diluted into 4x SDS Laemmli buffer with 2.5% β-mercaptoethanol, and equal amounts of protein were loaded into 10% Tris-Glycine SDS PAGE gels (Thermo XP00100). Blocking and antibody incubations were performed in Odyssey PBS Blocking Buffer (LICOR, Lincoln, NE. 927–40000) following the manufacturer’s instructions. Primary antibodies used were mouse anti-APOL1 1:2000 (Proteintech, Rosemont, IL. 66124–1-Ig), rabbit anti-APOL1 1:5000 (Proteintech 11486–2-AP), and rabbit anti-GAPDH 1:5000 (Proteintech 10494–1-AP). Secondary antibodies used were goat anti-mouse 680RD 1:10,000 (LICOR 92568070), and donkey anti-rabbit 800CW 1:10,000 (LICOR 925–32213). Blots were scanned on a LICOR Odyssey Classic.

Electrophysiology rAPOL1 was purified from E. coli and analyzed in planar lipid bilayers as previously described (Thomson and Finkelstein, 2015). Briefly, planar lipid bilayers were formed from soybean asolectin, a rich phospholipid mixture from which non-polar lipids had been removed (Kagawa and Racker, 1971). In some experiments, cholesterol was added to increase bilayer stability. The lipid solution in pentane (1.0% asolectin w/v, or 1.5% asolectin, 0.5% cholesterol w/v) was layered on top of the aqueous solutions and the solvent allowed to evaporate. The lipid bilayer was formed by alternately raising the solution volumes above a ~ 100 micron hole in a Teflon septum separating symmetric 1 ml compartments as depicted in Figures 2a and 6a; Qiu et al., 1996. The cis solution was defined as the side to which protein was added. The voltage was reported as that of the cis with respect to the trans. The trans-bilayer current due to APOL1 was measured in response to a voltage which was set by the experimenter. Manipulation of the pH was achieved by adding pre-calibrated volumes of HCl or KOH to the cis buffer.

To test for Ca2+ permeability, bilayers were formed between identical solutions of 1) CaCl2-buffer: 10 or 100 mM CaCl2 (as detailed in Figure 2 legend) 0.5 mM EDTA, 5 mM K-succinate, 5 mM K-HEPES, pH 7.1; or 2) excess KCl buffer: 150 mM KCl, 1 mM CaCl2, 0.1 mM EDTA, 5 mM K-MES, 5 mM K-HEPES, pH 7.2. A pH-dependent conductance was obtained with the addition of APOL1 as detailed in Figure 2 and then 1 M CaCl2 was titrated into the to the cis compartment at pH 7.2. The reversal potential (Erev) was determined before and after CaCl2 addition by adjusting the voltage until the current read zero. To calculate permeability ratios of calcium versus potassium (pCa/pK) in the presence of excess KCl we used the following derivation of the Lewis equation as described by Jatzke et al., 2002:

ΔErev=RT2FIn(1+PCaPk4[Ca2+][K+])

where ∆Erev is the change in Erev due to a given change in CaCl2 concentration and R, T and F have their usual meanings.

To determine relative permeabilities of monovalent cations K+, Na+ and choline+, a pH-dependent conductance was achieved with APOL1 in excess KCl buffer and then the cis buffer was perfused sequentially with similar solutions in which the KCl was replaced with NaCl and then choline chloride. Erev (the bi-ionic potential) was determined with KCl still present on the trans side. Permeability ratios (pX/pK) were determined by substituting into the Goldman-Hodgkin-Katz equation.

Live-cell microscopy

Request a detailed protocol

All live cell experiments were performed using Fluorobrite DMEM (Gibco A18967-01). FT293 cells were seeded onto black-walled, optical bottom 96 well plates that were freshly coated with 2.5 µg/cm2 of fibronectin. Cells were transfected with pGP-CMVB-GCaMP6f (A gift from Douglas Kim and the GENIE project, Addgene 40755) (Chen et al., 2013), and the next day were treated with or without 50 ng/mL doxycycline to induce APOL1 expression along with the addition of 3 µM DRAQ7 (Abcam, Cambridge, United Kingdom. ab109202). Cells were imaged via widefield every 10 min at 20x.

For microscopy of RUSH-transfected cells, HEK293 and CHO-K1 cells were seeded onto fibronectin coated glass bottom 96-well (Grenier, Kremsmünster, Austria. 655892) or 24-well (Cellvis, Mountain View, CA. P24-1.5H-N) plates. Cells were co-transfected with APOL1 RUSH vectors and one or a combination of the following Ca2+ sensors: GCaMP6f, CMV-ER-LAR-GECO1 (A gift from Robert Campbell, Addgene 61244) (Wu et al., 2014), or plasma membrane voltage sensor CMV-FliCR (A gift from Robert Campbell, Addgene 74142) (Abdelfattah et al., 2016). The next day, 80 µM biotin (Sigma B4639) was added to respective wells and cells were then imaged every 5 min at 10 or 20x. Sensor validations for GCaMP6f and ER-LAR-GECO were performed in FT293 cells using the SERCA pump inhibitor thapsigargin (Thermo T7458).

Immunofluorescence

Request a detailed protocol

CHO cells were seeded onto glass bottom, 96 well plates and transfected with RUSH-APOL1 plasmids. 24 hr after transfection, cells were treated with or without 80 µM biotin every 30 min for 0–120 min. For cell surface immunostaining, cells were moved onto ice and blocked with HBSS + Ca2+ + Mg2+ + 0.5% BSA fraction V, stained with primary antibodies, fixed in 2% formaldehyde (Thermo 28906), quenched with 50 mM NH4Cl, and then stained with secondary antibodies. For intracellular staining, cells were permeabilized with 0.075% saponin. Staining was performed with the following antibodies and dyes: mouse anti-APOL1 1:800, rabbit anti-calnexin 1:200 (Stressgen, Farmingdale, NY. SPA-860), anti-rabbit Alexa 488 plus 1:1500 (Thermo A32731), anti-mouse Alexa 647 1:1000 (Thermo A21236), and HCS Nuclear Mask 1:400 (Thermo H10325). Cells were imaged via spinning disk confocal microscopy.

Microscopy analysis

Request a detailed protocol

To measure the Ca2+ kinetics in individual cells, fields of view (FOVs) were imaged at random and the corresponding video files were imported into Fiji and analyzed with TrackMate (Tinevez et al., 2017). After automated detection, files were manually curated to remove cells that were dead, overlapping, or those that had migrated out of the FOV. Cells were tracked based upon GCaMP6f signal, and the multi-channel tracking plug-in (https://imagej.net/TrackMate#Extensions) was used to collect data from all other channels within the spot (DRAQ7, ER-LAR-GECO, FliCR). The raw data was then exported and analyzed using R to determine the change in mean fluorescence intensity for each cell using the following equation:

(FluorescenceTime=XFluorescenceTime=0)/FluorescenceTime=0=F/F0

where F0 is the average mean fluorescence of the first 3 timepoints for each cell. For analysis with ER-LAR-GECO or FliCR, cells co-expressing GCaMP6f and exhibiting the established phenotype of Ca2+ influx and cell swelling were analyzed.

To determine APOL1 trafficking kinetics in non-permeabilized immunostained cells, multiple FOVs were imaged at random at 20x. Image files were exported as maximum intensity Z-projections and analyzed using the scikit-image library in Python (van der Walt et al., 2014). Briefly, NuclearMask stained cell nuclei were segmented and dilated to approximate cell boundaries. Cells were then filtered for cell death through co-localization with the segmented calnexin channel. Finally, APOL1 stain intensity was summed for all cells individually, and the criteria for positive staining of APOL1 was defined as a cell having greater summed APOL1 stained intensity than the maximum summed intensity of any cell within the untransfected image sets. Data from ≥10 FOVs per experimental group were averaged over three replicates and plotted to determine the intensity and percent of cells expressing APOL1 at the PM for each timepoint and genotype.

Preparation of representative images and movies was performed in Fiji. Representative immunofluorescence images are all maximum intensity Z-projections of approximately 10, 0.22 µm slices.

Microscopes

Request a detailed protocol

For live-cell microscopy, a widefield setup was used. Live imaging was performed with a Zeiss (Oberkochen, Germany) Axio Observer with 470, 555, or 625 nm LED excitation along with Zeiss filter cubes 38 (green), 20 (red), and 50 (far-red). Recording was performed using a sCMOS with 6.5 µm pixels (Hamamatsu, Hamamatsu City, Japan. Flash4.0 v2). Live experiments were performed within an incubation chamber at 37C with 5% CO2 and humidity. For immunofluorescence, a Zeiss Axio Observer was fitted with a Yokogawa (Musashino, Japan) CSU-X1 spinning disk head. Excitation was performed with a 405, 488, or 639 nm laser. Recording was performed using a back-thinned EMCCD camera with 16 µm pixels (Photometrics, Tucson, AZ. Evolve 512).

Statistics

All graphing and statistical analyses were performed with Graph Pad Prism or the multicomp package in R (Hothorn et al., 2008). Statistical significance was tested using one or two-way ANOVAs with multiple comparisons tests. All data are represented as mean with 95% confidence interval unless otherwise noted, and all relevant p-values are depicted directly on each graph.

Data derived from quantified immunofluorescence were fit to a general linear model, and a simultaneous multiple comparison procedure between genotypes and timepoints was conducted in R version 3.5.1. P-values were corrected for multiple comparisons via the Benjamini-Hochberg correction (Benjamini and Hochberg, 1995), and significance was set to a minimum of p<0.05.

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
    Partial resolution of the enzymes catalyzing oxidative phosphorylation XXV reconstitution of vesicles catalyzing 32Pi—adenosine triphosphate exchange
    1. Y Kagawa
    2. E Racker
    (1971)
    Journal of Biological Chemistry 246:5477–5487.
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
    Electrolyte Solutions
    1. RA Robinson
    2. RH Stokes
    (2002)
    Courier Corporation.
  57. 57
    A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression
    1. MA Saleem
    2. MJ O'Hare
    3. J Reiser
    4. RJ Coward
    5. CD Inward
    6. T Farren
    7. CY Xing
    8. L Ni
    9. PW Mathieson
    10. P Mundel
    (2002)
    Journal of the American Society of Nephrology : JASN 13:630–638.
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70

Decision letter

  1. Olga Boudker
    Senior Editor; Weill Cornell Medicine, United States
  2. Christine Clayton
    Reviewing Editor; DKFZ-ZMBH Alliance, Germany
  3. Suzie Scales
    Reviewer

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This article contributes important new information concerning the ion permeability of the Apolipoprotein L-1 channels and suggests that this is an important cause of the renal pathology that is associated with some Apolipoprotein L-1 variants.

Decision letter after peer review:

Thank you for submitting your article "Apolipoprotein L-1 renal risk variants form active channels at the plasma membrane driving cytotoxicity" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Olga Boudker as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Suzie Scales (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

The reviews of your manuscript were very mixed, which appears to reflect substantial controversy in the field. I have therefore decided that the manuscript should be reconsidered after results of further experiments are available. One reviewer felt that your demonstration that the APOL1 must reach the cell surface was sufficiently important on its own, but the others did not. None of the reviewers was convinced that calcium influx was the direct cause, rather than a consequence or symptom, of cell death. It was suggested that increased cellular calcium may result from increased potassium efflux instead. One reviewer indeed pointed out that LDH release and calcium influx appeared to be simultaneous. Clarification of this issue is critical.

Essential revisions:

Several experiments were suggested in order to determine the relationship between calcium influx and potassium efflux. These were thought to be feasible within the 2-month period that is usually allowed by eLife:

Cell experiments:

1) Place the cells in high potassium media ("CKCM" of Olabisi et al., 2016) during biotin addition to determine if this prevents calcium influx and help clarify which cation is primarily responsible.

2) Experiments with low to zero extracellular calcium and with intracellular calcium chelators (BAPTA-AM) should be performed: currently, the lowest calcium concentration used was, according to one reviewer, higher than that in the Bowmans capsule.

3) Bilayer experiments: Studies with lower calcium concentrations, and to measure the permeability ratio between Ca2+ and K+ (PCa/PK) are required.

4) If it turns out that potassium efflux is indeed the major primary effect, it is not clear that the results would be rated as sufficiently novel, at least by 2 of the three reviewers.

5) One reviewer had reservations concerning the combination of protein and cell haplotype used; obviously this cannot be changed but the concerns must be mentioned.

6) Showing "typical" results without any statistics is no longer acceptable; using standard deviation for three measurements is not really acceptable either, strictly speaking. Ideally, present all three measurements, either all on the figure or, if this is too confusing, place them in the supplement.

Reviewer #1:

The paper makes a really strong statement such as that the APOL1 mediated cytotoxicity is calcium mediated.

The key problem with the presented work that it does not show that the increased extracellular calcium is responsible for the cell death using a dox inducible system.

The presented data shows a dose and genotype dependent cell death, which has been shown before (Pollak and Susztak labs etc). It also shows a dose and genotype dependent increase in calcium. When cells die intracellular calcium will rise, so it is essential to show that the increase in intracellular calcium actually a cause of the cell death not the consequence of the cell death. This is a fundamental flaw in the presented work.

It is not clear whether APOL1 actually conducts calcium it would be essential to demonstrate this claim. Using bilayer studies removing calcium and substituting calcium etc. are key for such statement.

Figure 2E the control and the experiments are presented on 2 separate graphs. They should be measured and presented together and statistical analysis need to be performed at 30 hours before and after injection. Simply put cells die over 30 hours we need to see the difference between APOL1 and control cells.

Same issue for Figure 3E.

The biotin is a clever experiment.

Another fundamental issue with the model is that it depends on putative and mysterious chaperone that has been identified. Otherwise the model would not work. There is ample of APOL1 in the circulation and could randomly insert to ant plasma membrane inducing cytotoxicity, however the disease and toxicity is high specific for the podocytes.

Reviewer #2:

Giovinazzo et al. demonstrate that renal risk variants (RRVs, G1 and G2) of APOL1, but not wild type (G0) in HEK293 and CHO cells lead to cytotoxicity via cell swelling and lysis, an important confirmation of results from several other labs because they use naturally occurring variants of APOL1 for the RRVs, whereas the majority of labs merely mutate G1 and G2 into the RefSeq, yielding sequences that are not present in the 1000 Genomes Project. They further perform a series of elegant experiments using the RUSH (an ER retention and synchronized release) system to clearly demonstrate that APOL1 must reach the cell surface to mediate these cytotoxic effects. This clearly rules out ER stress as the mechanism of RRV-mediated toxicity, which is important because APOL1 is mainly localized to the ER, and the plasma membrane is more accessible to certain classes of potential therapeutics. They also provide evidence that recombinant APOL1 can conduct calcium ions across lipid bilayers, and that in APOL1 RRV-expressing cells calcium influx (monitored with GCaMP) precedes cytotoxicity. They suggest that this ubiquitous cation second messenger could explain why such a variety of seemingly disparate mechanisms of APOL1 action have been previously proposed. The data are well presented and represent an impressive advance in the field as they strongly suggest that targeting the ion channel activity of plasma membrane APOL1 should be a viable therapeutic avenue for APOL1 nephropathies, although it is not entirely clear which cation is the relevant one. This paper definitely merits publication, and I only have a few minor suggestions for strengthening their conclusions.

1) While calcium influx is clearly an upstream event in RRV-mediated cytotoxicity, it is not completely certain that calcium influx is the event that should be therapeutically targeted. As they mentioned in the Discussion, although the calcium influx is demonstrated to be relatively soon (≤30 mins) after the arrival of APOL1 at the plasma membrane, it cannot be excluded that calcium influx from an unrelated calcium channel is secondary to efflux of e.g. K+ ions (which they previously showed can also be conducted by recombinant APOL1 in bilayers), which has also been shown to be an upstream event in APOL1-expressing 293 cells by Olabisi et al., 2016. While measuring the relative timing of K+ efflux in the RUSH system is surely outside the scope of their time and resources, it should be relatively easy to place the cells in high potassium media ("CKCM" of Olabisi et al.) during biotin addition to determine if this prevents calcium influx and help clarify which cation is primarily responsible.

2) On a related note, the 100mM calcium concentration at which they showed recombinant APOL1 conducted calcium ions in the bilayer assay is an extreme condition, up to 50x higher than the range at which cytotoxicity was observed in cells. To properly claim that APOL1 is permeable to calcium ions, they need to calculate the permeability ratio between Ca2+ and K+ (pCa/pK).

3) Can the authors comment on the low level (~20%) of cytotoxicity obtained by the RRVs in the stable FT293 cell lines? Is this simply because the stable cells were polyclonal and not all expressing at sufficient levels to cause toxicity, given that O'Toole et al., 2018, have previously demonstrated that killing is dose-dependent? Is there any IF or FACS data demonstrating what percentage of stable cells actually express APOL1? It is particularly important to show that G0 is expressed in a similar % of cells to at least one of the RRVs since an equal signal by western blotting could come from e.g. twice the percentage of cells expressing half the amount of APOL1, which would impact the overall cytoxicity results, since it is likely threshold-dependent on a per-cell basis.

4) The authors propose in Figure 5C that a secretory chaperone that binds to APOL1-G0 better than the RRVs might explain why only the RRVs lead to calcium influx in cells when all three conduct equally in planar lipid bilayers. If this were the case, one might expect APOL1 G0 to arrive faster at the cell surface, which it does not. I wonder if an alternative explanation could be that the "chaperone" is actually more of a G0-channel closing protein acting at the cell surface (after the low pH Golgi membrane insertion step). Couldn't this be easily tested by adding NH4Cl to neutralize the channel after arrival of APOL1 at the plasma membrane (instead of before biotin addition) and see if it no longer inhibits the RRVs?

5) Since cytotoxicity correlates with extracellular calcium levels (at least from 2-8mM), it would be helpful to mention in the Discussion that Bowman's capsule has around 1.4mM calcium (according to Hautmann and Oswald (J. Urology 1983 129 p433)), as it means their results could be physiologically relevant.

6) It would be nice to show the no biotin controls at equivalent time points in the LDH assay in Figure 3B rather than just stating there was no effect. P-value asterisks in this figure need to be larger.

Reviewer #3:

In the current manuscript the authors examine the hypothesis that APOL1 mediated cell injury and thereby kidney disease is mediated by plasma membrane calcium channel activity. The authors demonstrate that APOL1 expression in lipid bilayers leads to a calcium current. Calcium conductance was similar in APOL1 kidney disease non-risk (G0), and risk (G1 and G2) genetic variants. The authors used a combination of confocal immunofluorescence microscopy and the RUSH system for controlled and synchronous gene product expression and controlled compartment-specific trafficking in these studies. They demonstrate that APOL1 expression in the ER is innocuous to cell viability. Rather, intracellular calcium and cell injury measures, such as increased LDH release was associated with APOL1 trafficking and localization to the plasma membrane. Increased intracellular calcium preceded cell death (measured by the cell death marker DRAQ7). In spite of similar calcium conductance and plasma membrane expression of the non-risk and renal risk genetic variants (RRVs) only the RRVs led to increased intracellular calcium and cell death. In addition, lowering the pH of the medium, enhanced cell injury in RRVs (and also infor WT APOL1), confirming the previously reported importance of an acidic milieu for APOL1 channel activity. While the increased cellular calcium can explain the different perturbations in several cellular pathways mediated by APOL1, there remain a number of questions: Is APOL1 a selective calcium channel? Does the measured increase in intracellular calcium reflect a cell-injury causal calcium channel opening or rather a downstream reflection of another primary pathway of cell injury, wherein the RRVs are more injurious compared to G0 and hence also results in greater calcium influx? What is the role of alkaline pH, that was demonstrated as an essential factor for APOL1 cation conductivity in previous publications?

Following are some specific comments that are suggested for consideration by the authors:

1) The authors are referred to Lannon et al., 2019. This report demonstrates that the appropriate background haplotype for APOL1 G0 for comparison with G1 and G2, is that which naturally occurs in the population in which G1 and G2 occur, and not a construct on a haplotype which does not occur in natural populations at all (namely G1 and G2 mutagenesis on the reference European haplotype APOL1-G0 (BC143038.1), as described in the current manuscript). Thus for example, G0 K150E is itself was more toxic than G0 E150K. In the current manuscript the G0 variant used had K (lysine) at residue 150 whereas RRV had 150E (the natural variant) (Figure 1). G0 was innocuous to cells as opposed to RRV. Even though the frequency of this variant is higher than G0 with E, the G0K150E should also be used in the comparative cellular studies to examine the significance of glutamic acid at this position as an explanation for the different cells toxicity and cellular calcium level in RRV vs. GO.

2) The authors titrated APOL1 protein expression in FT293-G0 cells to similar levels found in interferon-stimulated human podocytes (Figure 1—figure supplement 1A) in order to achieve physiologic expression. They conclude that 0.2 ng/mL doxycycline and 10 ng/mL interferon-γ lead to similar levels of APOL1. However, it appears that APOL1 expression after Dox induction (0.2 ng/mL doxycycline) is lower than its expression after interferon (most evident in lane 3-from the right). In addition, for Figure 1 and Video 1, a higher concentrations of Dox are reported – therefore the expression of APOL1 variants is expected to be higher than the claim of achieving physiologic levels similar to those which accompany interferon induction in the podocyte platform.

3) Increased extracellular CaCl2 in cell culture media (from basal 2mM up to 8 Mm) was used to demonstrate the role of calcium influx and calcium content in cell injury in cells expressing the RRV compared to G0. The clinical relevance of elevated non-physiological extracellular calcium concentrations used in these experiments is not clear. In addition, the increased calcium influx could represent the consequence and not cause of non-specific cell injury, similar to previous reports regarding potassium depletion. In order to prove a causal role of extracellular calcium and consequent increased cytoplasmic calcium, experiments with low to zero extracellular calcium and with intracellular calcium chelators (BAPTA-AM) should be performed. In other words to prove the authors' claim that ion flux precedes cell swelling by several hours and is therefore the likely driver of cell death, can the authors state whether intracellular calcium buffering was used and if so, did it attenuate APOL1 cell injury?

4) The APOL1 plasmid used in the RUSH platform did not contain its natural signal peptide (Figure 3A), but rather the IL-2 signal peptide was used. Why is that and were studies conducted with APOL1 harboring its own signal peptide?

5) It is clear that increased calcium in cytoplasm preceded cell death (measured by measured by cell death marker DRAQ7), however increased LDH may represent an even earlier marker for cell injury. Looking at Figure 3: the earliest data presented regarding LDH release after adding biotin was after 6 hours – at that time point RRV (especially G2) lead to cell injury measured by LDH release. GCaMP6f fluorescence (calcium indicator protein) started to increase 3 hours after adding biotin. As increased cellular calcium may represent a non-specific marker for cell injury – please provide parallel data for LDH release 3 hours after adding biotin, in order to understand if increased calcium in cytoplasm precedes LDH release. Moreover, looking at Figure 5, LDH release was increased 2 hours after adding biotin, simultaneously with the increased calcium in cytoplasm, suggesting that increased calcium influx represents a nonspecific marker for cell injury.

6) Figure 4B: the experiments were conducted in non-permeabilized CHO cells, however, the staining of APOL1 after adding biotin seems to be in the ER and not only in the plasma membrane. Where is the calnexin stain mentioned in the text (as a control for non-permeabilized cells)?

7) Lower levels of G2 were detected at the plasma membrane compared to G0 (Figure 4). The authors explain this by invoking increased G2 cyto-toxicity. However, it is stated that the calnexin signal was used to filter out permeabilized cells (Figure 4C), which should mitigate such an effect as the explanation. That decreased G2 plasma membrane expression on one hand, and increased toxicity on the other hand, does not reconcile with the hypothesis that APOL1 channel activity at the plasma membrane is the most proximate causal mediator for cell death.

8) Increased calcium in cytoplasm is expected to increase ER calcium (Figure 4, Wu et al., 2014). Calcium release from ER should not exceed uptake to the ER. However, the data presented in Figure 3—figure supplement 2, show stable concentration of calcium in the ER, without an expected increase.

9) The authors hypothesize that G0 is sequestered by an unknown chaperone while trafficking along the secretory pathway. In light of similar expression of all APOL1 variants in the plasma membrane, it seems that G0 sequestration does not occur prior to trafficking to the plasma membrane.

10) RUSH-APOL1 transfected cells were transiently acidified at pH 5.5 then returned to neutral pH. According to Figure 5A, acidification enhances cell injury for all APOL1 variants including G0. However, as reported previously and also in this current manuscript by electrophysiologic studies – APOL1 insertion into lipid bilayers requires an acidic melieu and has transient chloride permeability which turns into cationic conductance (potassium – as per Bruno et al., 2017) at neutral pH. Similarly, in the current manuscript (Figure 2A), there is a small transient current at pH 5.6, that is enhanced significantly at pH 7.1. In light of these findings one could expect that an acidic pH in essential for APOL1 toxicity. Moreover, changing into neutral pH (after priming with an acidic pH) is expected to increase APOL1 conductance and therefore cell injury mediated by this cationic channel conductance. The data presented in Figure 5, seem contradictory: return to neutral pH attenuates APOL1 cell injury. In addition, if indeed APOL1 RRVs form calcium channels at the plasma membrane which increase intracellular calcium concentrations in turn leading to cell death, then returning to neutral pH would be expected to lead to decreased calcium influx and correspondingly decreased intracellular calcium levels – the results of such experiment should be presented.

11) Since the authors did not demonstrate selectivity for calcium conductance caveats regarding author mechanisms need attention. For example, increased cellular calcium may result from increased potassium efflux and cellular potassium depletion that was reported in previous manuscripts (Olabisi et al., 2016), and as mentioned briefly by the authors in the Discussion. cell death and kidney disease should be further explored.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Apolipoprotein L-1 renal risk variants form active channels at the plasma membrane driving cytotoxicity" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Olga Boudker as the Senior Editor The following individuals involved in review of your submission have agreed to reveal their identity: Katalin Susztak (Reviewer #1); Suzie Scales (Reviewer #2).

I haven't asked the reviewers for more discussion since they are in broad agreement; but reviewer 2 (pasted below) has picked up some issues that should be fixed.

Giovinazzo et al. have addressed most of the major concerns, in particular showing that Na+ as well as Ca2+ influx is an upstream event leading to APOL1-RRV mediated toxicity, and that Ca2+ influx occurs at physiological concentrations. It is an important advance that influx of Na+/Ca2+, rather than efflux of K+ is the trigger for APOL1-mediated toxicity, as that will change the nature of potential screens for channel inhibitors. Furthermore, as previously mentioned, the knowledge that APOL1 has to arrive at the plasma membrane to mediate toxicity, and that cation channel activity is the function that needs inhibiting to limit progression of CKD is vital for future therapeutic efforts. I therefore recommend this manuscript for publication.

A couple of points that I think still need to be changed:

1) In the absence of immunofluorescence or FACS data for the polyclonal APOL1-293 cells, the statement that the cells are expressing at physiological levels (compared to endogenous APOL1 in podocytes +IFNγ) needs to be toned down. It is still possible that the 20% of cells that die are the 20% highest expressers, which are effectively diluted out by the remaining non-expressers and thus the actual cells with active channels are higher expressing than the podocytes, especially as cytotoxicity is dose-dependent.

2) I agree with reviewer #3 and Essential revisions point 5 that the wrong G0 control (K150 instead of E150) was used for these studies. It is irrelevant that non-Africans (with G0 K150) happen to outnumber Africans (with G0 E150) selected for sequencing in the 1000 genomes project. E150 G0 would thus have been the correct haplotype to use. However, it is also true that E150 would likely only marginally diminish the difference between G0 and G1/G2 and so is not worth redoing the whole dataset. Nonetheless, the authors need to acknowledge that E150 would have been a better control and refer to Lannon et al. for the fact that it would have only made a small difference to the results.

https://doi.org/10.7554/eLife.51185.sa1

Author response

Essential revisions:

Several experiments were suggested in order to determine the relationship between calcium influx and potassium efflux. These were thought to be feasible within the 2-month period that is usually allowed by eLife:

Cell experiments:

1) Place the cells in high potassium media ("CKCM" of Olabisi et al., 2016) during biotin addition to determine if this prevents calcium influx and help clarify which cation is primarily responsible.

To study the effects of high potassium media where we replace the Na+ with K+, as suggested, we first wanted to establish the effect of the new media on cell viability. Lowering Na+ from 150 mM to 52.5 mM, where the cation is replaced stoichiometrically with K+, led to a 40% decrease in cell viability after 12 hours (Olabisi et al. assessed cytotoxicity/viability in their experiments after 24 hours in media with complete Na+ replacement to K+). We also find an effect, though less dramatic, 20% deceased viability, with a similar ion replacement to choline+. Viability was further reduced when Na+ was lowered to 20 mM with the 130mM balance being replaced with choline+ (see Figure 6—figure supplement 1A and B). Based on these findings, we avoided full replication of the CKCM conditions, and settled on lowering Na+ to 85 mM for further experimentation (see Figure 6C and E). An additional point is high extracellular K+ depolarizes the cell; addition of 50 mM KCl to standard media causes depolarization which is the original reason we chose not to address the Olabisi et al. publication and K+ in our initial manuscript submission (see Figure 6—figure supplement 2A). Ionic perturbations are very complicated in vivo and numerous factors need to be considered during interpretation of the data.

APOL1-G2 mediated Ca2+ influx is largely unaffected by partial replacement of Na+ with choline+ or K+ (Video 6). GCaMP6f and RUSH-G2 transfected cells were placed in media containing 150 mM Na+ or 85 mM Na+ replaced by 65 mM choline+/K+. The APOL1-G2 mediated Ca2+ influx was observed under all media conditions and occurred with similar timing. We conclude that the large Ca2+ influx occurs independent of K+ efflux.

2) Experiments with low to zero extracellular calcium and with intracellular calcium chelators (BAPTA-AM) should be performed: currently, the lowest calcium concentration used was, according to one reviewer, higher than that in the Bowmans capsule.

Extracellular Ca2+ was serially diluted in media from 1.8 mM to 0.1125 mM, and the cytotoxicity of the APOL1 renal risk variants (RRVs) were significantly reduced with Ca2+ levels ≤ 0.45 mM (Figure 6—figure supplement 1C and also Figure 6D). This suggests that Ca2+ participates in RRV-mediated cytotoxicity.

All experiments were performed with 1.8 mM CaCl2 unless otherwise noted (standard concentration in all variations of Eagle's / Essential Media). It was mentioned in the review that the Bowman's capsule contains approximately 1.4 mM CaCl2. While we have shown that lower Ca2+ levels inhibit RRV cytotoxicity, no significant reduction in cytotoxicity was detected with 0.9 mM CaCl2 (Figure 6—figure supplement 1C). Thus, in our assay we will unlikely see any effect by lowering CaCl2 from 1.8 to 1.4 mM.

Further, our attempts to chelate incoming intracellular Ca2+ with BAPTA-AM while in very low or no Ca2+ media failed. The cells easily detached once the Ca2+ drops below 0.1mM, making the experiment difficult to be performed. With 0.1mM Ca2+ in the media the trivial moles of BAPTA in the cell, relative to the bath moles, are easily saturated. This hurdle was something which would take a good deal of time to overcome and we believe the data we present are convincing enough to make the BAPTA experiment unnecessary. We clearly demonstrate reducing the extracellular Ca2+ reduces toxicity.

3) Bilayer experiments: Studies with lower calcium concentrations, and to measure the permeability ratio between Ca2+ and K+ (pCa/pK) are required.

Planar lipid bilayer experiments were performed to address the conductance of Ca2+ with physiological levels of K+ and Ca2+. We demonstrate that in the presence of CaCl2 alone, APOL1 channels are selective for Ca2+ over Cl- (Figure 2B). For this experiment, symmetrical solutions of 150 mM KCl and 1 mM CaCl2 were used on both sides of the bilayer. Increasing cis CaCl2 to 2 mM led to a positive shift in the current and a negative shift in the reversal potential (Figure 2D). The pCa/pK permeability ratio was calculated as 0.6, demonstrating that the APOL1 channel conducts Ca2+ at physiological salt conditions. For comparison, the PNa/pK permeability ratio was calculated as 1.1 (Figure 6B). Additionally, the APOL1-G2 mediated cellular Ca2+ influx was unaffected by media containing high K+ (Video 6, see response to Essential revisions point .1).

4) If it turns out that potassium efflux is indeed the major primary effect, it is not clear that the results would be rated as sufficiently novel, at least by 2 of the three reviewers.

The high potassium media "CKCM" of Olabisi et al., kills the cells on its own as discussed in the response to Essential revisions point 1 (Figure 6—figure supplement 1A and B). We further show the partially rescue of cells from RRV cytotoxicity that can be attributed to high potassium media is not because of the high K+, but rather because of lower Na+ in the media (Figure 6C). This is clearly demonstrated, where Na+ replacement with the impermeant choline+ results in a similar level of rescue. Importantly, 65 mM choline+ did not have as strong of a negative effect on general cell viability as the 65 mM K+(Figure 6—figure supplement 1A).

As Na+ influx can cause a Ca2+ influx and cytoplasmic accumulation on its own, we attempted to discern when the RRV-mediated Ca2+ influx occurred relative to Na+. Due to a lack of suitable genetically encoded Na+ sensors, we opted to use the plasma membrane voltage sensor FliCR as a readout for Na+ influx in combination with the Ca2+ sensor GCaMP6f. Using live-cell microscopy, we found that the influx of Ca2+ occurred concurrently with the increase in membrane depolarization (Figure 6F, Figure 6—figure supplement 2 and 3, Video 5). This data, along with the conductance of Ca2+ in the presence of 150 mM K+ (see Figure 2D) suggest the APOL1-RRVs are directly conducting Ca2+ into the cell. The influx of Na+ likely also contributes as the Na+/Ca2+ exchanger will be disrupted. Additionally, as Na+ influx typically leads to cell swelling and depolarization, it will drive K+ efflux, which is a cellular response to both events.

The effect that lower Ca2+ and Na+ levels have in rescuing cells from RRV cytotoxicity, along with the additive rescue when combined (Figure 6D) and their simultaneous influx (Video 5 and related figures) suggest that intracellular accumulation of these two cations represent the primary and upstream effect of RRV mediated cell death and disease, rather than the specific efflux of K+.

5) One reviewer had reservations concerning the combination of protein and cell haplotype used; obviously this cannot be changed but the concerns must be mentioned.

We are of the belief that G0 K150 is the appropriate haplotype control for these experiments, as it is the most prevalent in the human population and is over an order of magnitude more prevalent than G0 E150. We are in agreement with reviewer 3 about the importance of using the correct haplotypes, which is why we constructed Figure 1A to give readers context of the common haplotype backgrounds and our rationale for using G0. We did, however, construct an FT293 stable cell line expressing G0 E150 and compared the cytotoxic effect with G1 (Author response image 1).

Author response image 1

There was no detectable loss in cell viability, similar to G0 K150 (Author response image 2).

Author response image 2

(The above two experiments were not performed together.)Due to these results, we did not see any benefit to using both G0 E150 or K150 for this study and decided to move forward with G0 K150 as our control.

6) Showing "typical" results without any statistics is no longer acceptable; using standard deviation for three measurements is not really acceptable either, strictly speaking. Ideally, present all three measurements, either all on the figure or, if this is too confusing, place them in the supplement.

Thank you for this comment. We apologize for our previous presentation of the data using representative figures. This has now been corrected, with p values shown directly on the graphs themselves and the N reported in the legends.

Reviewer #1:

The paper makes a really strong statement such as that the APOL1 mediated cytotoxicity is calcium mediated.

The key problem with the presented work that it does not show that the increased extracellular calcium is responsible for the cell death using a dox inducible system.

The presented data shows a dose and genotype dependent cell death, which has been shown before (Pollak and Susztak labs etc). It also shows a dose and genotype dependent increase in calcium. When cells die intracellular calcium will rise, so it is essential to show that the increase in intracellular calcium actually a cause of the cell death not the consequence of the cell death. This is a fundamental flaw in the presented work.

We have demonstrated that the influx of Ca2+ occurs several hours prior to cell swelling and cell death (Figure 2, Figure 3 and clearly observable in all videos). These finding place aberrant Ca2+ accumulation as an upstream event relative to cell swelling and cell death, and not a product of death itself. Additionally, as mentioned in Essential revisions points 1 and 2 and depicted throughout Figure 5 and its supplements, we show that Ca2+ is one of the drivers of cell death. This is most clearly shown when extracellular Ca2+ is reduced, lowering G1 and G2 cytotoxicity (Figure 6D and Figure 6—figure supplement 1C).

It is not clear whether APOL1 actually conducts calcium it would be essential to demonstrate this claim. Using bilayer studies removing calcium and substituting calcium etc. are key for such statement.

We have clearly shown that APOL1 conducts Ca2+ and show it is selective for Ca2+ over Cl- (Figures 2B-D). We have expanded this planar lipid bilayer experiment to be performed with more physiological conditions (150 mM K+, 1-2 mM Ca2+), as described in Essential revisions point 3 (Figures 2D). This data shows APOL1 retains its Ca2+ permeability in the presence of physiological salt conditions and that the APOL1 channel directly conducts Ca2+ at these physiological ion concentrations.

Figure 2E the control and the experiments are presented on 2 separate graphs. They should be measured and presented together and statistical analysis need to be performed at 30 hours before and after injection. Simply put cells die over 30 hours we need to see the difference between APOL1 and control cells.

Same issue for Figure 3E.

We have presented the data with consideration of clarity to the reader. The important controls in what are now Figure 3B and Figure 4D are the “induced” G0 as compared to the “induced” RRVs, G1 and G2. The upper panel in the two data sets are additional controls we have included to be perfectly transparent that the systems are a bit leaky, data which we originally considered to be placed in the supplementary data. Upon consideration of your comment we are now placing the ANOVA P-values between induced and un-induced into a table in Figure 3—source data 1 and Figure 4—source data 1, for additional consideration for the readers.

The biotin is a clever experiment.

Thank you!

Another fundamental issue with the model is that it depends on putative and mysterious chaperone that has been identified. Otherwise the model would not work. There is ample of APOL1 in the circulation and could randomly insert to ant plasma membrane inducing cytotoxicity, however the disease and toxicity is high specific for the podocytes.

We accept this criticism and have removed the "chaperone" from our model. There is no direct evidence of a chaperone that affects cytotoxicity between the variants (VAMP8 was discovered to bind G0 more strongly than G1 or G2 by John Sedor's group, however it did not affect cell death). We now only mention the chaperone hypothesis in the

Discussion.

Regarding the reviewer’s concluding sentence, please see Reeves-Daniel et al., 2011, Lee et al., 2012 and Kozlitina et al., 2016. We find the kidney transplant data the most compelling, where RRV kidneys transplanted into patients have a shortened allograft survival. Conversely, recipient genotype has no effect on allograft survival.

Additionally, in the study by Merck, there was no correlation between circulating levels of APOL1 and kidney disease. Further we would like to draw attention to the evidence in Figure 1—figure supplement 1B, which demonstrates podocytes treated with 10 ng/mL interferon-γ have an induction of APOL1, as has been shown by others. Here we further demonstrate that at a comparable APOL1 protein level RRVs and not G0 APOL1 are toxic to cells Figure 1—figure supplement 1C. This is well in line with the clinical observation that prolonged interferon treatment is detrimental to homozygous RRV APOL1 patients, see Nichols et al., 2015 and Markowitz et al., 2010.

Reviewer #2:

[…]

1) While calcium influx is clearly an upstream event in RRV-mediated cytotoxicity, it is not completely certain that calcium influx is the event that should be therapeutically targeted. As they mentioned in the Discussion, although the calcium influx is demonstrated to be relatively soon (≤30 mins) after the arrival of APOL1 at the plasma membrane, it cannot be excluded that calcium influx from an unrelated calcium channel is secondary to efflux of e.g. K+ ions (which they previously showed can also be conducted by recombinant APOL1 in bilayers), which has also been shown to be an upstream event in APOL1-expressing 293 cells by Olabisi et al., 2016. While measuring the relative timing of K+ efflux in the RUSH system is surely outside the scope of their time and resources, it should be relatively easy to place the cells in high potassium media ("CKCM" of Olabisi et al.) during biotin addition to determine if this prevents calcium influx and help clarify which cation is primarily responsible.

We thank the reviewer for the generous comments. To respond, please first see our response to Essential revisions point 1. In summary, we have performed the suggested experiment and found that CKCM like conditions did not affect Ca2+ influx (Video 6), Additionally, Ca2+ influx occurs concurrently with Na+ influx (Figure 6, Figure 6—figure supplements 2 and 3, and Video 5), indicating that it is the earliest detectable event of channel activity alongside Na+.

We do not believe in specifically targeting the flux of one ion over another as a relevant treatment possibility, rather we suggest targeting the active-state APOL1 channel at the plasma membrane is a viable strategy.

2) On a related note, the 100mM calcium concentration at which they showed recombinant APOL1 conducted calcium ions in the bilayer assay is an extreme condition, up to 50x higher than the range at which cytotoxicity was observed in cells. To properly claim that APOL1 is permeable to calcium ions, they need to calculate the permeability ratio between Ca2+ and K+ (pCa/pK).

The initial selectivity experiment was performed at the higher than physiological concentrations to get a strong signal to allow for the best analysis. However, we fully accept the need to perform experiments in more physiological conditions and have done the suggested experiment.

The results are explained in our response to Essential revisions point 3. In summary, APOL1 conducts Ca2+ (at 1-2 mM) in the presence of 150 mM K+(Figures 2B and D) The pCa/pK was calculated to be 0.6. In comparison, the pNa/pK is 1.1 (Figure 6B).

3) Can the authors comment on the low level (~20%) of cytotoxicity obtained by the RRVs in the stable FT293 cell lines? Is this simply because the stable cells were polyclonal and not all expressing at sufficient levels to cause toxicity, given that O'Toole et al., 2018, have previously demonstrated that killing is dose-dependent? Is there any IF or FACS data demonstrating what percentage of stable cells actually express APOL1? It is particularly important to show that G0 is expressed in a similar % of cells to at least one of the RRVs since an equal signal by western blotting could come from e.g. twice the percentage of cells expressing half the amount of APOL1, which would impact the overall cytoxicity results, since it is likely threshold-dependent on a per-cell basis.

All the APOL1 expressing FT293 cell lines are polyclonal. They are derived from a single clone expressing the tet repressor, and then clones after transfection with APOL1 plasmid were pooled together (correct integration of the new plasmid leads to the loss of zeocin resistance and the gain of hygromycin b resistance). Unfortunately, we do not have single cell data of the FT293 cell lines to see if there is a difference in the number of cells expressing APOL1, and to what level. We find the varied expression to be typical even for clonal cell line. As with nearly all transgenes, promoters become differentially methylated and have variable expression on a cell to cell basis, even in clonal cell populations. This can be partially corrected by using a CpG free promoter or by implementing a “universal chromatin opening element” (UCOE) upstream of the promoter. Additionally, targeting the transgene into a safe-harbor locus such as the ROSA26-like region would have helped to keep the expression variability at a lower level, however this would have to be done in follow-up work. We appreciate this comment and will keep this in mind for future work.

As for the low level of cytotoxicity, if the experiment is extended higher levels of cell death will be observed. This could in part be due to expression of APOL1 from a single copy.

While we cannot provide more a satisfactory answer for the FT293 cells, the RUSH experiments are transient transfections and lead to similar protein levels between the variants. We can state that for the RUSH system, which gives similar results to the FT293 cells, that we expect a similar number of cells expressing G0. This is corroborated by the cell surface staining data in Figure 5D and E.

4) The authors propose in Figure 5C that a secretory chaperone that binds to APOL1-G0 better than the RRVs might explain why only the RRVs lead to calcium influx in cells when all three conduct equally in planar lipid bilayers. If this were the case, one might expect APOL1 G0 to arrive faster at the cell surface, which it does not. I wonder if an alternative explanation could be that the "chaperone" is actually more of a G0-channel closing protein acting at the cell surface (after the low pH Golgi membrane insertion step). Couldn't this be easily tested by adding NH4Cl to neutralize the channel after arrival of APOL1 at the plasma membrane (instead of before biotin addition) and see if it no longer inhibits the RRVs?

We appreciate the comment and have responded to the merit of the chaperone in our model in our last response to Reviewer #1. We have removed the chaperone from our model and now only mention the hypothesis briefly in the Discussion. As for potential function of a putative chaperone, we are mostly in agreement as to how it functions i.e. somewhere along the secretory pathway and somehow regulating or modulating channel activity. With the lack of any chaperone discovered to date, however, it certainly could be another mechanism to explain the discrepancy in cytotoxicity. We present experiments and observations that G1 and G2 more readily form channels at the acidic pH encountered along the secretory pathway.

As for the acid/neutral experiments, we apologize for not being clearer. Adding ammonium chloride prior to biotin addition allows us to increase the pH within the cell, limiting APOL1 activation in the biosynthetic pathway. Moving the pH towards neutral in the normally acidic Golgi apparatus, trans-Golgi network and endosomal compartments of the biosynthetic pathway is well-documented. In the experiment the APOL1 experiences less acidic pH as it transits the biosynthetic compartments. Our experiment with APOL1 in planar lipid bilayers suggests that APOL1 "activation" into a channel state is irreversible upon acidification. Then the only way to modulate its activity afterwards is to change the pH (neutral = open, acidic = closed). APOL1 arrives to the neutral environment of the plasma membrane after encountering an acidic environment along the way in the control setting.

5) Since cytotoxicity correlates with extracellular calcium levels (at least from 2-8mM), it would be helpful to mention in the Discussion that Bowman's capsule has around 1.4mM calcium (according to Hautmann and Oswald (J. Urology 1983 129 p433)), as it means their results could be physiologically relevant.

This comment was addressed in the Essential revisions point 2 response. We performed the recommended experiment of lowering extracellular Ca2+ rather than raising it to non-physiological levels. CaCl2 was serially diluted from 1.8 mM to 0.1125 mM, and a significant reduction in cell death was only observed at levels ≤ 0.45 mM. Therefore, we do not believe there would be a significant difference in cytotoxicity between 1.4 and 1.8 mM CaCl2.

6) It would be nice to show the no biotin controls at equivalent time points in the LDH assay in Figure 3B rather than just stating there was no effect. P-value asterisks in this figure need to be larger.

We apologize for the lack of clarity in our presentation of the data. The graph does contain the no biotin control, but it was not properly presented. The new Figure 4B is now more clearly labeled. As for the p-value asterisks, we have moved to reporting the p-values themselves on each graph.

Reviewer #3:

[…] While the increased cellular calcium can explain the different perturbations in several cellular pathways mediated by APOL1, there remain a number of questions:

Is APOL1 a selective calcium channel? Does the measured increase in intracellular calcium reflect a cell-injury causal calcium channel opening or rather a downstream reflection of another primary pathway of cell injury, wherein the RRVs are more injurious compared to G0 and hence also results in greater calcium influx?

We have demonstrated APOL1 to be a calcium channel, more specifically APOL1 is a cation channel. Selectivity of APOL1 for Ca2+ is further answered in detail in our responses to Essential revisions points 1 and 2. APOL1 is permeable to Ca2+ and can conduct Ca2+ in the presence of physiological K+ levels. As for a cell injury causing Ca2+ influx, we clearly show in all six videos that the Ca2+ influx occurs upstream of any cell swelling and the subsequent lysis. Our method for detecting lysis is an approximately 600 – 700 dalton cell impermeable dye, DRAQ7 which is fluorogenic when bound to DNA. If APOL1 formed large pores in the plasma membrane similar to streptolysin O, DRAQ7 would be immediately detectable. Additionally, we show in the new Figure 6 and related video and supplementary figures that Ca2+ influx occurs alongside a Na+ influx/mild depolarization and that they are the first measurable events of APOL1 channel activity.

What is the role of alkaline pH, that was demonstrated as an essential factor for APOL1 cation conductivity in previous publications?

Treatment of cells with ammonium chloride has been known to inhibit the lytic activity of human serum for decades (Raper et al., 1996). It is also well described that APOL1 requires two steps to function as a cation channel: an acidic pH activation step, driving an irreversible membrane association, and a neutral pH step to open the channel (Thomson and Finkelstein, 2015).

Bringing the pH to a less acidic value in the intracellular compartments of the cell can be accomplished with ammonium chloride. Ammonium chloride pre-treatment of trypanosomes and, we now show mammalian cells, before exposure to APOL1 inhibits APOL1 activation when the cell is exposed to APOL1. Our data shows APOL1 in the neutral ER is not cytotoxic. The transit of APOL1 through the biosynthetic pathway as it is delivered to the plasma membrane is where the APOL1 can be activated by acidity. This activation becomes fully mature only once the APOL1 is neutralized, which is the state of the plasma membrane. Our use of ammonium chloride is to bring up the pH of the normally acidic biosynthetic compartments. By reducing the acidity of the biosynthetic pathway before addition of biotin, we reduce the cytotoxicity of the RRVs of APOL1 in our RUSH based model of APOL1.

Following are some specific comments that are suggested for consideration by the authors:

1) The authors are referred to Lannon et al., 2019. This report demonstrates that the appropriate background haplotype for APOL1 G0 for comparison with G1 and G2, is that which naturally occurs in the population in which G1 and G2 occur, and not a construct on a haplotype which does not occur in natural populations at all (namely G1 and G2 mutagenesis on the reference European haplotype APOL1-G0 (BC143038.1), as described in the current manuscript). Thus for example, G0 K150E is itself was more toxic than G0 E150K. In the current manuscript the G0 variant used had K (lysine) at residue 150 whereas RRV had 150E (the natural variant) (Figure 1). G0 was innocuous to cells as opposed to RRV. Even though the frequency of this variant is higher than G0 with E, the G0K150E should also be used in the comparative cellular studies to examine the significance of glutamic acid at this position as an explanation for the different cells toxicity and cellular calcium level in RRV vs. GO.

This comment is answered in detail in our response to Essential revisions point 5. We have made stable cells, which express G0 E150 and detected no cell death (see Author response images 1 and 2). Additionally, we are of the belief that the appropriate control is G0 K150, as it the most prevalent in the human population. It is not the scope of this study to compare variants of "wild-type" APOL1, but to understand why the variants are cytotoxic.

2) The authors titrated APOL1 protein expression in FT293-G0 cells to similar levels found in interferon-stimulated human podocytes (Figure 1—figure supplement 1A) in order to achieve physiologic expression. They conclude that 0.2 ng/mL doxycycline and 10 ng/mL interferon-γ lead to similar levels of APOL1. However, it appears that APOL1 expression after Dox induction (0.2 ng/mL doxycycline) is lower than its expression after interferon (most evident in lane 3-from the right). In addition, for Figure 1 and Video 1, a higher concentrations of Dox are reported – therefore the expression of APOL1 variants is expected to be higher than the claim of achieving physiologic levels similar to those which accompany interferon induction in the podocyte platform.

We only demonstrate the use physiological levels in Figure 1—figure supplement 1. This effort taken was to address comments made by O'Toole that physiological levels of RRV expression are not cytotoxic. However, in their studies they did not use any method to determine what was "physiological". We show that expressing similar amounts of APOL1 as a podocyte in culture does in fact lead to cell death. FT293-APOL1 expression being lower than the podocytes on the western blot further bolsters the argument that physiologically inducible APOL1 levels as occurs in patients being treated with interferons can be cytotoxic in podocytes.

The lower the levels of APOL1, the slower the time to death. In the 0.2 ng/mL dox induction experiments we report the level of cytotoxicity after 48 hours. We see a more rapid progression of cell death with higher levels of APOL1 induction, the condition we then use in the rest of the manuscript. It is worth noting that we and others have seen that extremely high level of APOL1 expression has a toxicity even with the G0 variants. We carefully engineered two model systems to hold the APOL1 expression levels to best represent the physiologically relevant biology.

We did not use 0.2 ng/mL dox for future experiments because it would be extremely difficult to perform long-term live cell imaging. At this low dose, RRV cytotoxicity is severely delayed, and imaging for 3-4 days would be near impossible due to cell motility, cell division, and phototoxicity.

3) Increased extracellular CaCl2 in cell culture media (from basal 2mM up to 8 Mm) was used to demonstrate the role of calcium influx and calcium content in cell injury in cells expressing the RRV compared to G0. The clinical relevance of elevated non-physiological extracellular calcium concentrations used in these experiments is not clear. In addition, the increased calcium influx could represent the consequence and not cause of non-specific cell injury, similar to previous reports regarding potassium depletion. In order to prove a causal role of extracellular calcium and consequent increased cytoplasmic calcium, experiments with low to zero extracellular calcium and with intracellular calcium chelators (BAPTA-AM) should be performed. In other words to prove the authors' claim that ion flux precedes cell swelling by several hours and is therefore the likely driver of cell death, can the authors state whether intracellular calcium buffering was used and if so, did it attenuate APOL1 cell injury?

Thank you for this comment, we have performed the suggested experiment and answered in detail in the manuscript and also in response to Essential revisions point 2. Lower extracellular Ca2+ leads to significantly lower RRV cytotoxicity at levels ≤ 0.45 mM Ca2+.

Further, the total Ca2+ molar chelation capacity of intracellular BAPTA is easily overwhelmed by a continuous flux of Ca2+ and cannot have a sustained protective effect for the cell. Continuous Ca2+ increases over several hours (see all videos) and perhaps some temporal toxicity effect could be parsed out of very carefully planned experiments, however we believe more simple demonstrations are presented and answer the concerns of the reviewers.

4) The APOL1 plasmid used in the RUSH platform did not contain its natural signal peptide (Figure 3A), but rather the IL-2 signal peptide was used. Why is that and were studies conducted with APOL1 harboring its own signal peptide?

All FT293 cells contained the native APOL1 signal peptide. The RUSH system contains the IL-2 signal peptide and has been used in over a hundred publications with various other proteins with no negative effect. The signal peptide is simply to get the protein translated in the ER. N-terminal signal sequences are well known to be cleaved subsequent to the docking of the ribosome to the ER and we can find no reason for concern as to which signal sequence is utilized.

5) It is clear that increased calcium in cytoplasm preceded cell death (measured by measured by cell death marker DRAQ7), however increased LDH may represent an even earlier marker for cell injury. Looking at Figure 3: the earliest data presented regarding LDH release after adding biotin was after 6 hours – at that time point RRV (especially G2) lead to cell injury measured by LDH release. GCaMP6f fluorescence (calcium indicator protein) started to increase 3 hours after adding biotin. As increased cellular calcium may represent a non-specific marker for cell injury – please provide parallel data for LDH release 3 hours after adding biotin, in order to understand if increased calcium in cytoplasm precedes LDH release. Moreover, looking at Figure 5, LDH release was increased 2 hours after adding biotin, simultaneously with the increased calcium in cytoplasm, suggesting that increased calcium influx represents a nonspecific marker for cell injury.

LDH is a cytoplasmic protein encompassing 4 subunits. The full-size protein is approximately 144 kDa. In Video 1 and Video 2, all cells are treated with a cell impermeable dye, DRAQ7, which is approximately 600 – 700 Da. LDH would only be released, at its earliest, when DRAQ7 is first detected. DRAQ7 is not detected until after cell lysis (see Video 2). Therefore, the Ca2+ influx occurs several hours prior to LDH release.

Regarding Figure 5 (now Figure 6) we apologize for the confusion and have corrected this. LDH was measured 12 – 24 h AFTER biotin release. The 2h signified that cells were acidified 2 h after biotin.

We find that Ca2+ influx is not a non-specific, downstream event that occurs after cell injury. Ca2+ influx is concurrent with a Na+ influx, which we find as the first measurable effects of RRV channel activity (see Figure 6 and response to Essential revisions points 2, 3 and 4).

6) Figure 4B: the experiments were conducted in non-permeabilized CHO cells, however, the staining of APOL1 after adding biotin seems to be in the ER and not only in the plasma membrane. Where is the calnexin stain mentioned in the text (as a control for non-permeabilized cells)?

The merged images contain all three channels: Calnexin, APOL1, and nuclear stain. Author response image 3 shows the images of the calnexin channel alone, which shows no signal over background:

Author response image 3

7) Lower levels of G2 were detected at the plasma membrane compared to G0 (Figure 4). The authors explain this by invoking increased G2 cyto-toxicity. However, it is stated that the calnexin signal was used to filter out permeabilized cells (Figure 4C), which should mitigate such an effect as the explanation. That decreased G2 plasma membrane expression on one hand, and increased toxicity on the other hand, does not reconcile with the hypothesis that APOL1 channel activity at the plasma membrane is the most proximate causal mediator for cell death.Lower RUSH-G2 levels were also detected via western blot (Figure 4—figure supplement 1A). While Figure 5 shows lower amounts of total G2 at the cell surface, the fold change, depicted in Figure 5D and E, shows that the increase in cell surface localization after biotin addition is similar to G0 and G1. Basically, G2 can do "more with less." That explanation is corroborated by the higher cytotoxicity of G2 compared to G1 seen in multiple experiments.

In the stable cells, however, similar levels of protein expression were found between all three variants, and the same results for cytotoxicity and Ca2+ influx are observed.

The timing of events should make it clear, that APOL1 gets to the cell surface only after biotin addition, and within a short amount of time only then is Ca2+ influx detected.

8) Increased calcium in cytoplasm is expected to increase ER calcium (Figure 4, Wu et al., 2014). Calcium release from ER should not exceed uptake to the ER. However, the data presented in Figure 3—figure supplement 2, show stable concentration of calcium in the ER, without an expected increase.

In Figure 4 of Wu et al., 2014, extracellular Ca2+ begins at 0 mM, and then a 20% increase in fluorescence (with the ER sensor) is detected when extracellular Ca2+ is increased to 2 mM. It is true that the ER acts as a Ca2+ sink and buffer for the rest of the cell, however this experiment where a massive change in extracellular Ca2+ occurs cannot be compared to a cation channel acting at the plasma membrane.

It is also important to note that in our Figure 3—figure supplement 2, the sensors have vastly different Kd for Ca2+ as they are working in the range of 100s of nM (cytoplasm) to 100s of µM (ER). The APOL1 mediated Ca2+ influx may lead to the ER taking up some of the Ca2+, however if that amount is only in the 10s or 100s of nM, then it may not be detected by the sensor. The ER-LAR-GECO sensor was primarily designed to measure release of Ca2+ from the ER.

9) The authors hypothesize that G0 is sequestered by an unknown chaperone while trafficking along the secretory pathway. In light of similar expression of all APOL1 variants in the plasma membrane, it seems that G0 sequestration does not occur prior to trafficking to the plasma membrane.

Thank you for this comment. As mentioned in response to reviewer 1 point 5 and reviewer 2 point 4, we have decided to omit the chaperone from our working model as there is no evidence in the literature. It is only a hypothesis, which we now solely mention in the Discussion.

10) RUSH-APOL1 transfected cells were transiently acidified at pH 5.5 then returned to neutral pH. According to Figure 5A, acidification enhances cell injury for all APOL1 variants including G0. However, as reported previously and also in this current manuscript by electrophysiologic studies – APOL1 insertion into lipid bilayers requires an acidic melieu and has transient chloride permeability which turns into cationic conductance (potassium – as per Bruno et al., 2017) at neutral pH. Similarly, in the current manuscript (Figure 2A), there is a small transient current at pH 5.6, that is enhanced significantly at pH 7.1. In light of these findings one could expect that an acidic pH in essential for APOL1 toxicity. Moreover, changing into neutral pH (after priming with an acidic pH) is expected to increase APOL1 conductance and therefore cell injury mediated by this cationic channel conductance. The data presented in Figure 5, seem contradictory: return to neutral pH attenuates APOL1 cell injury. In addition, if indeed APOL1 RRVs form calcium channels at the plasma membrane which increase intracellular calcium concentrations in turn leading to cell death, then returning to neutral pH would be expected to lead to decreased calcium influx and correspondingly decreased intracellular calcium levels – the results of such experiment should be presented.

Sorry for the misunderstanding. The ammonium chloride experiment only works if it is done before APOL1 is exposed to acidified environments. It is used to neutralize the acidic compartments in the cell/trypanosome before exposure to APOL1. Once APOL1 has become activated via acidification, ammonium chloride will have no effect. The APOL1 channel requires two steps to function: Acidification to form a channel active followed by a neutral pH for the channel open.

11) Since the authors did not demonstrate selectivity for calcium conductance caveats regarding author mechanisms need attention. For example, increased cellular calcium may result from increased potassium efflux and cellular potassium depletion that was reported in previous manuscripts (Olabisi et al., 2016), and as mentioned briefly by the authors in the Discussion. cell death and kidney disease should be further explored.

The selectivity of APOL1 for Ca2+ over Cl- was clearly demonstrated. This has been answered in more detail in the response to Essential revisions points 1 and 3.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

[…] A couple of points that I think still need to be changed:

1) In the absence of immunofluorescence or FACS data for the polyclonal APOL1-293 cells, the statement that the cells are expressing at physiological levels (compared to endogenous APOL1 in podocytes +IFNγ) needs to be toned down. It is still possible that the 20% of cells that die are the 20% highest expressers, which are effectively diluted out by the remaining non-expressers and thus the actual cells with active channels are higher expressing than the podocytes, especially as cytotoxicity is dose-dependent.

We have toned-down the degree of confidence in achieving physiological podocyte expression levels of APOL1. While we did make single-integrated stable cell lines using the Flp-In technology under a tet-promoter, we agree softening our statements to be more accurate is well advised.

2) I agree with reviewer #3 and Essential revisions point 5 that the wrong G0 control (K150 instead of E150) was used for these studies. It is irrelevant that non-Africans (with G0 K150) happen to outnumber Africans (with G0 E150) selected for sequencing in the 1000 genomes project. E150 G0 would thus have been the correct haplotype to use. However, it is also true that E150 would likely only marginally diminish the difference between G0 and G1/G2 and so is not worth redoing the whole dataset. Nonetheless, the authors need to acknowledge that E150 would have been a better control and refer to Lannon et al. for the fact that it would have only made a small difference to the results.

We address our use of the G0 K150 control as being suboptimal relative to the G0 E150 control in the Discussion.

https://doi.org/10.7554/eLife.51185.sa2

Article and author information

Author details

  1. Joseph A Giovinazzo

    Department of Biological Sciences, Hunter College at City University of New York, New York, United States
    Contribution
    Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing
    For correspondence
    joseph.giovinazzo@cuanschutz.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-2608-7143
  2. Russell P Thomson

    Department of Biological Sciences, Hunter College at City University of New York, New York, United States
    Contribution
    Conceptualization, Formal analysis, Supervision, Investigation, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared
  3. Nailya Khalizova

    Department of Biological Sciences, Hunter College at City University of New York, New York, United States
    Contribution
    Validation, Investigation
    Competing interests
    No competing interests declared
  4. Patrick J Zager

    Department of Ophthalmology, Margaret Dyson Vision Research Institute, Weill Cornell Medicine, New York, United States
    Contribution
    Software, Formal analysis, Visualization
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3993-9686
  5. Nirav Malani

    Genosity, Iselin, United States
    Contribution
    Software, Formal analysis
    Competing interests
    No competing interests declared
  6. Enrique Rodriguez-Boulan

    Department of Ophthalmology, Margaret Dyson Vision Research Institute, Weill Cornell Medicine, New York, United States
    Contribution
    Conceptualization, Resources, Funding acquisition
    Competing interests
    No competing interests declared
  7. Jayne Raper

    Department of Biological Sciences, Hunter College at City University of New York, New York, United States
    Contribution
    Conceptualization, Resources, Supervision, Funding acquisition, Project administration, Writing - review and editing
    For correspondence
    raper@genectr.hunter.cuny.edu
    Competing interests
    No competing interests declared
  8. Ryan Schreiner

    Department of Ophthalmology, Margaret Dyson Vision Research Institute, Weill Cornell Medicine, New York, United States
    Contribution
    Conceptualization, Resources, Data curation, Supervision, Validation, Investigation, Visualization, Methodology, Project administration, Writing - review and editing
    For correspondence
    ryanschreiner@gmail.com
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7457-6606

Funding

National Institute of General Medical Sciences (R01GM34107)

  • Enrique Javier Rodriguez-Boulan

National Science Foundation (IOS-1249166)

  • Jayne Raper

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We would like to thank Dr. Christian Brix Folsted Andersen and Gitte Ratz from Aarhus University for providing the stable cell line system. We would also like to thank Anibelky Almanzar and Ji-Won Kang for helping to establish our stable cell lines. We would like to show our gratitude to Dr. Livia Bayer, Dr. Irina Catrina, and Dr. Diana Bratu of Hunter College for providing insight and expertise that greatly assisted our fluorescent microscopy approach. Additionally, we are grateful to Dr. Olaf Anderson of Weill Cornell Medicine and Dr. Mitchell Goldfarb of Hunter College for their expert advice and suggestions on electrophysiology, as well as Dr. Alan Finkelstein of Albert Einstein College of Medicine for both his guidance and loaning of equipment. We also thank the Weill Cornell Medicine’s Visual Function Core Facility for its expert live imaging resources. Finally, we gratefully acknowledge our sources of funding the NIH and NSF, R01GM34107 and IOS-1249166 respectively.

Senior Editor

  1. Olga Boudker, Weill Cornell Medicine, United States

Reviewing Editor

  1. Christine Clayton, DKFZ-ZMBH Alliance, Germany

Reviewer

  1. Suzie Scales

Publication history

  1. Received: August 19, 2019
  2. Accepted: May 14, 2020
  3. Accepted Manuscript published: May 19, 2020 (version 1)
  4. Version of Record published: June 12, 2020 (version 2)

Copyright

© 2020, Giovinazzo et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,139
    Page views
  • 230
    Downloads
  • 2
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Biochemistry and Chemical Biology
    2. Cell Biology
    Niladri K Sinha et al.
    Research Article

    Translation of aberrant mRNAs induces ribosomal collisions, thereby triggering pathways for mRNA and nascent peptide degradation and ribosomal rescue. Here we use sucrose gradient fractionation combined with quantitative proteomics to systematically identify proteins associated with collided ribosomes. This approach identified Endothelial differentiation-related factor 1 (EDF1) as a novel protein recruited to collided ribosomes during translational distress. Cryo-electron microscopic analyses of EDF1 and its yeast homolog Mbf1 revealed a conserved 40S ribosomal subunit binding site at the mRNA entry channel near the collision interface. EDF1 recruits the translational repressors GIGYF2 and EIF4E2 to collided ribosomes to initiate a negative-feedback loop that prevents new ribosomes from translating defective mRNAs. Further, EDF1 regulates an immediate-early transcriptional response to ribosomal collisions. Our results uncover mechanisms through which EDF1 coordinates multiple responses of the ribosome-mediated quality control pathway and provide novel insights into the intersection of ribosome-mediated quality control with global transcriptional regulation.

    1. Cell Biology
    2. Microbiology and Infectious Disease
    Mark S Ladinsky et al.
    Research Article Updated

    Fusion of HIV-1 with the membrane of its target cell, an obligate first step in virus infectivity, is mediated by binding of the viral envelope (Env) spike protein to its receptors, CD4 and CCR5/CXCR4, on the cell surface. The process of viral fusion appears to be fast compared with viral egress and has not been visualized by EM. To capture fusion events, the process must be curtailed by trapping Env-receptor binding at an intermediate stage. We have used fusion inhibitors to trap HIV-1 virions attached to target cells by Envs in an extended pre-hairpin intermediate state. Electron tomography revealed HIV-1 virions bound to TZM-bl cells by 2–4 narrow spokes, with slightly more spokes present when evaluated with mutant virions that lacked the Env cytoplasmic tail. These results represent the first direct visualization of the hypothesized pre-hairpin intermediate of HIV-1 Env and improve our understanding of Env-mediated HIV-1 fusion and infection of host cells.