(A) Schematic diagram of in vitro cleavage assay (B) Results are shown for three sgRNAs targeting UL30 (UL30-3, -4, and -5). T7 in vitro transcribed sgRNA was combined with SpCas9 protein and a PCR …
(A) Experimental scheme of SaCas9/sgRNA-mediated inhibition of HSV lytic infection. (B and C) HFFs transduced with lentivirus expressing SaCas9 and sgRNAs were infected with HSV-1 at an MOI of 0.1 (C…
(A) Experimental scheme of SaCas9/sgRNA-mediated inhibition of reactivation of quiescent d109 genomes in HFFs. HFFs were infected with HSV-1 d109 virus to establish quiescent infection for 7–10 d …
(A) Indel mutation frequencies of quiescent d109 genomes are shown at the indicated sgRNA target sites. (B) Histogram representing the frequency (count) of indel lengths induced by SaCas9/UL30-5 in …
(A) Kinetics of indel mutations in the HSV-1 genome during lytic infection. HFFs transduced with lentivirus expressing SaCas9 and sgRNA were infected with HSV-1 at an MOI of 3 in the presence or …
The lengths of SaCas9/UL30-5 sgRNA induced indel mutations in HSV-1 genome during lytic replication are analyzed using the Inference of CRISPR Editing (ICE) tool (https://ice.synthego.com) at …
(A) HFFs transduced with lentivirus expressing Cas9 and sgRNA were infected with HSV-1 at an MOI of 1 in the presence or absence of PAA and harvested at 10 hpi. Proteins were detected by …
Per-base plot of WGS coverage over each specific base in HSV during lytic replication in HFFs for UL30-5 against untreated controls (no sgRNA, no SaCas9/sgRNA). (A) Per-base WGS coverage across the …
List of 437 possible UL30-5 off-target sites within the human genome (GRCh38/hg38).
The 437 possible UL30-5 off-target sites are shown together with the off-target sequence and the number of mismatches at each position. Off-target sites were identified through sequence analysis using Cas-OFFinder to identify all predicted off-target sites for SaCas9/UL30-5 with ≤6 mismatches within GRCh38/hg38.
(A and B) HFFs transduced with lentivirus expressing SaCas9 and sgRNAs were infected with HSV-1 at an MOI of 0.1 (A) or 5 (B), harvested at 48 hpi or 24 hpi respectively. Viral yields were …
(A) Quiescently infected HFF cells were transduced with lentivirus expressing SaCas9/UL26-27 or SaCas9/UL37-38 sgRNA as described in Figure 2A and analyzed at the indicated sgRNA target sites by …
HFFs transduced with lentivirus expressing SaCas9 and sgRNA were infected with ICP0-null mutant HSV-1 at an MOI of 3 in the presence of PAA and harvested at the indicated time post infection. The …
Lytic infection: Cas9/sgRNA cleaves input viral DNA. In the absence of viral DNA replication, either prior to the onset of viral replication or in the presence of PAA, the expression of Cas9/sgRNA …
Name | Efficiency of cleavage | SaCas9 sgRNA + PAM (g was added as needed) | Target sequences (GenBank: KT899744) |
---|---|---|---|
UL30 | |||
UL30-1 | + | GCGTCCCGACTGGGGCGAGGT AGGGGT | 62811–62831 |
UL30-2 | ++ | gAAGTTTTGCCTCAAACAAGGC GGGGGT | 62779–62799 |
UL30-3 | - | GCGGCGTGGACCACGCCCCGG CGGGGT | 63060–63080 |
UL30-4 | ++ | gTGCCCCCCCGGAGAAGCGCG CCGGGGT | 62923–62942 |
UL30-5 | ++ | gACACGTGAAAGACGGTGACG GTGGGGT | 63097–63116 |
UL30-6 | + | gACCAGCCGAAGGTGACGAAC CCGGGGT | 63595–63614 |
UL30-7 | ++ | GGCCATCAAGAAGTACGAGGG TGGGGT | 63532–63552 |
UL30-24* | ++ | gAAACCCCAAAAGCCGCTTGGG TGGGAT | 62589–62609 |
UL30-25* | + | gCCACCCGAACCCCTAAAGAGG GGGGAT | 62637–62657 |
UL30-26* | - | gCATGCCGGCCCGGGCGAGCCT GGGGGT | 62542–62562 |
UL30-27* | ++ | gCCATCCCACCCAAGCGGCTTT TGGGGT | 62581–62601 |
UL29 | |||
UL29-1 | ++ | gTCAAGGTCCCCCCCGGGCCCC TGGGAT | 61861–61881 |
UL29-2 | + | GTGTTTGAGGTCGCCGGGCCG GGGGGT | 61502–61522 |
UL29-3 | ++ | GCCAGCCAGGGTAAGACCCCG CGGGGT | 61028–61048 |
UL29-4 | ++ | GCCGCCGTCGCGCCCACCCCG CGGGGT | 61007–61027 |
UL29-14* | ++ | GAGGGTGGGAGACCGGGGTTG GGGAAT | 62029–62049 |
UL29-15* | ++ | GTCGGGCGTCCGTCGTCGTGC CGGGAT | 61952–61972 |
UL29-16* | ++ | gCGGGGGTTGTCTGTGAAGGGT AGGGAT | 62064–62084 |
UL29-17* | ++ | gATCGGCACCCCGTGGTTACCC GGGGGT | 62084–62104 |
UL29-18* | ++ | gCAGACAACCCCCGGGTAACCA CGGGGT | 62072–62092 |
UL29-19* | ++ | GGACCCCGCGTTGCCAGCCGC CGGGGT | 62113–62133 |
UL29-20* | ++ | GAACCCCGGCGGCTGGCAACG CGGGGT | 62105–62125 |
UL29- 21 | ++ | GGTTCTCGCACGACGGGGCTC GGGGGT | 61685–61705 |
UL54 | |||
UL54-1* | ++ | GCTGTCGGCTGCCGTCGGGGC TGGGGT | 113541–113561 |
UL54-2 | ++ | gACCTGGAATCGGACAGCAAC GGGGAGT | 113667–113687 |
UL54-3 | ++ | GCTCCGGTCCGTCCTCTCCGT GGGGGT | 113728–113748 |
UL54-4 | ++ | GCGTCTGGGTGCTGGGTACGC CGGGGT | 113803–113823 |
UL54-5 | ++ | GGCGGACGCCGTGGGCGTCGC AGGGGT | 113982–114002 |
UL54-6 | ++ | gTGGTTCTGGGGGCACGCCGGC GGGGGT | 114055–114075 |
UL54-7 | ++ | GCAGGCTGGGCTTTGGTCGGT GGGGGT | 113957–113977 |
UL54-8 | ++ | gCGCCGTGGGCGTCGCAGGGGT CGGGGT | 113988–114008 |
UL54-9 | + | GTCCGTCCACCCCGCCCCGGGG CGGGGT | 114098–114119 |
UL54-14* | ++ | gCGCTTCCGCGGGGACCCGGGC GGGGGT | 113234–113254 |
UL54-15* | ++ | gCGCCCGGGGGGCGGAACTAGG AGGGGT | 113347–113367 |
UL54-16 | ++ | GGCGGCTCTCCGCCGGCTCGG GGGGGT | 113641–113661 |
Rs1 | |||
Rs1-1 | ++ | GCCGGGCGTCGTCGAGGTCGT GGGGGT | 130775–130795, 146992–147012 |
Rs1-2 | - | gCCGCTCGTCGCGGTCTGGGCT CGGGGT | 130866–130886, 146901–146921 |
Rs1-3 | - | GGGGGTGGTCGGGGTCGTGGT CGGGGT | 130796–130816, 146971–146991 |
Rs1-4 | ++ | gATCGTCGTCGGCTAGAAAGGC GGGGGT | 130599–130619, 147168–147188 |
Rs1-5 | ++ | GGCGCGGCGACAGGCGGTCCG TGGGGT | 130475–130495, 147292–147312 |
Rs1-6 | ++ | GCGAGGCCGCGGGGTCGGGCGT CGGGAT | 130634–130655, 147132–147153 |
Rs1-7 | + | GGGTCCGGGGCGGCGAGGCCG CGGGGT | 130622–130642, 147145–147165 |
Rs1-8 | ++ | gCGCGAGGCGCGGGCCGTCGGG CGGGGT | 130290–130310, 147477–147497 |
Rs1-9 | ++ | GCGGACGACGAGGACGAGGACC CGGAGT | 130378–130399, 147388–147409 |
Rs1-15* | ++ | GCCGATGCGGGGCGATCCTCC GGGGAT | 130954–130974, 146813–146833 |
Rs1-16* | - | gTACGCGGACGAAGCGCGGGAG GGGGAT | 131142–131162, 146625–146645 |
Rs1-17* | + | gCGCGTCGACGGCGGGGGTCGT CGGGGT | 131061–131081, 146706–146726 |
Rs1-18* | ++ | GCGCTAGTTCCGCGTCGACGGC GGGGGT | 131070–131091, 146696–146717 |
UL26-27 | ++ | GAGGAAATCGGCACTGACCAA GGGGGT | 52742–52762 |
UL37-38 | ++ | GTATAACACCCCGCGAAGACG CGGGGT | 84066–84086 |
++:full cleavage (no residual substrate DNA on agarose gel), +: partial cleavage (some residual substrate DNA on agarose gel), -: no cleavage, *: non-coding region
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (Staphylococcus aureus) | SaCas9 | Addgene | pX601, Cat. #: #61591 | |
Peptide, recombinant protein | SpCas9 | NEB | Cat. #: M0386 | |
Cell line (Homo-sapiens) | HFF (Hs27) | ATCC | Cat# CRL-1634, RRID:CVCL_0335) | |
Cell line (Homo-sapiens) | U2OS | ATCC | Cat# HTB-96, RRID:CVCL_0042 | |
Cell line (Chlorocebus sabaeus) | Vero | ATCC | Cat# CCL-81, RRID:CVCL_0059 | |
Antibody | Anti-ICP8 (Rabbit serum) | Knipe et al., 1987 | 1:5000 | |
Antibody | Anti-ICP4 (Mouse monoclonal, purified from hybridoma cell line 58S (ATCC HB8183)) | Showalter et al., 1981 | 1:2000 | |
Antibody | Anti-ICP27 (Mouse monoclonal) | Eastcoast Bio | Cat. #: P1119 | 1:5000 |
Antibody | Anti-GAPDH ([6C5], Mouse monoclonal) | Abcam | Cat. #: ab8245 | 1:10000 |
Recombinant DNA reagent | Addgene | lentiCRISPRv2, Cat #: 52961 | Cloning vector | |
Recombinant DNA reagent | pX601-AAV-CMV-SaCas9-T2A-mCherry | This paper | Template of SaCas9-T2A-mCherry for lentiSaCas9-mCherry-Puro | |
Recombinant DNA reagent | lentiSaCas9-mCherry-Puro | This paper | Cloned SaCas9 gene into lentiCRISPRv2 | |
Software, algorithm | ICE analysis toolbox | https://ice.synthego.com | ||
Software, algorithm | bcbio-nextgen | https://github.com/bcbio/bcbio-nextgen | v1.15 | |
Software, algorithm | MuTect2 | https://www.ncbi.nlm.nih.gov/pubmed?term=20644199 | v2 | |
Software, algorithm | bwa-mem | https://arxiv.org/abs/1303.3997 | v0.7.17 | |
Software, algorithm | Cas-OFFinder | https://www.ncbi.nlm.nih.gov/pubmed/24463181 | v2.4 |