ERK3/MAPK6 controls IL-8 production and chemotaxis
- Cell Biology Unit, University Medical Center of the Johannes Gutenberg University Mainz, Germany
- Institute of Medical Biostatistics, Epidemiology and Informatics, University Medical Center of the Johannes Gutenberg University Mainz, Germany
- Center for Thrombosis and Hemostasis (CTH), University Medical Center of the Johannes Gutenberg University Mainz, Germany
- Institute of Medical Biometry and Statistics, Faculty of Medicine and Medical Center – University of Freiburg, Germany
- Departments of Biology and Physics, Wilkes University, United States
- Gene Editing Group, Institute of Biochemistry II, Goethe University, Germany
- Frankfurt Cancer Institute, Germany
- Institute of Immunology, University Medical Center of the Johannes Gutenberg University Mainz, Germany
- Department of Hematology, Medical Oncology, & Pneumology, University Medical Center of the Johannes Gutenberg University Mainz, Germany
- Department of General, Visceral- and Transplant Surgery, University Medical Center, Germany
- University Cancer Center Mainz, University Medical Center Mainz, Germany
Figures
Figure 1 with 1 supplement
Role of ERK3 in gastrointestinal organoids morphogenesis and differentiation.
(A) Schematic outline of individual steps for organoid establishment and differentiation. Undifferentiated, healthy mouse colon organoids (MCO) or human gastric organoids (HGO) were differentiated …
-
Figure 1—source data 1
Full membrane scans for western blot images for Figure 1C, F and G.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig1-data1-v2.pdf
Figure 1—figure supplement 1
Differentiation of mouse and human gastrointestinal organoids.
(A–B) Quantitative RT-PCR analysis of Krt20/Alpi differentiation markers. Log2 fold change in gene expression is presented as mean ± SEM of five independent experiments (n = 5); *p<0.05, **p<0.01, …
Figure 2 with 3 supplements
Effect of LPS on ERK3 expression and protein stability.
HT-29 cells and HCPECs were stimulated with LPS (200 ng/ml) at various time points as indicated. (A) Representative western blot analysis of HT-29 cells. Phosphorylation and/or total protein levels …
-
Figure 2—source data 1
Full membrane scans for western blot images for Figure 2A, E, G, M and N.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig2-data1-v2.pdf
Figure 2—figure supplement 1
ERK3 kinetics in CaCo2 cells.
(A–B) Western blot analysis of CaCo2 cells stimulated with LPS. CaCo2 cells were stimulated at indicated time points with LPS and activation status of ERK3 as well as the phosphorylation of p38 were …
-
Figure 2—figure supplement 1—source data 1
Full membrane scans for western blot images for Figure 2—figure supplement 1A.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig2-figsupp1-data1-v2.pdf
Figure 2—figure supplement 2
Graph representing relative mRNA expression levels of TLR4 in HCPECs when compared with HT-29 cells.
Log2 fold change in gene expression is presented as mean ± SEM from three biological replicates (n = 3); *p<0.05, **p<0.01, ***p<0.001, paired t-test.
-
Figure 2—figure supplement 2—source data 1
Full membrane scans for western blot images for Figure 2—figure supplement 2A–F.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig2-figsupp2-data1-v2.pdf
Figure 2—figure supplement 3
ERK3 kinetics in HCPECs and HT-29 in response to IL-1β, TLR1/2 ligand Pam3CSK4 and TLR7/8 ligand R848.
(A-F) HCPECs and HT-29 cells were stimulated for 0, 0.5, 1 and 2 hr with IL-1β, Pam3CSK4 and R848, cells were lysed for western blot analysis. Representative immunoblots depicting phosphorylation …
Figure 3 with 1 supplement
RNA sequencing analysis of control and ERK3 knockdown HCPECs.
HCPECs were transiently transfected with either control siRNA (siCo) or siRNA targeting ERK3 (siERK3). 24 hr post-transfection medium was exchanged and cells were stimulated with LPS. 24 hr later …
-
Figure 3—source data 1
RNA sequencing analysis of control and ERK3 knockdown HCPECs.
Table presents DE genes in resting (t0) and LPS stimulated (t24) siERK3 cells in comparison with the siControl cells, which are represented as a Venn diagram in Figure 3D.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Secretome analysis of control and ERK3-depleted HCPECs.
Two slides were employed for the analysis as described in the Materials and methods section (L507 and L493). The ratio between siControl and siERK3 was calculated for all the factors and presented in the table.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig3-data2-v2.xlsx
-
Figure 3—source data 3
Combined transcriptome and secretome analysis of control and ERK3-depleted HCPECs.
Table presents RNAseq derived genes (txm) and secretome derived factors (secretome) and the merged (txm:secretome) factors. Shown in the excel table is a Venn diagram combining the factors identified by transcriptome and secretome.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig3-data3-v2.xlsx
-
Figure 3—source data 4
Full membrane scans for western blot images for Figure 3A.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig3-data4-v2.pdf
Figure 3—figure supplement 1
RNAseq analysis: TopGO functional interpretation of the DE genes in siERK3 HCPECs.
Presented here 10 pathways were ranked based on the p value eliminated. Expression heatmap for the genes associated with GO term display the standardized values of the regularized-log transformed …
Figure 4 with 5 supplements
ERK3 regulates levels of IL-8 and other chemokines.
(A) Graphs represent RNAseq-derived normalized counts between siControl and siERK3 samples from three biological replicates of unstimulated HCPECs. (B-C) ELISA was performed to determine CXCL8/IL-8 …
-
Figure 4—source data 1
Full membrane scans for western blot images for Figure 4D, G and J.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig4-data1-v2.pdf
Figure 4—figure supplement 1
Validation of select chemokines and cytokines by RT-PCR.
(A–C) RT-PCR validation of (A) CXCL8, (B) IL16 and (C) CXCL6 mRNA expression levels in control (siCo) and ERK3-depleted (siERK3) HCPECs.Shown here are mean ± SEM log2 fold changes in untreated and …
Figure 4—figure supplement 2
Validation of ERK3-IL-8 connection by different shRNAs and siRNAs.
(A) Targeting ERK3 with different shERK3 constructs leads to the decrease in IL-8 levels. HT-29 cells were stably transduced with three different shRNAs targeting ERK3 (shERK3 #1, shERK3 #2, shERK3 …
-
Figure 4—figure supplement 2—source data 1
Full membrane scans for western blot images for Figure 4—figure supplement 2A and B.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig4-figsupp2-data1-v2.pdf
Figure 4—figure supplement 3
Role of ERK3 in the production of IL-8 stimulated by IL-1β and Pam3CSK4.
(A–D) HCPECs were transfected with siRNA targeting ERK3 (siERK3) or control (siCo), 24 hr post-transfection, medium was exchanged for MEM without supplements and cells were stimulated with IL-1β or …
-
Figure 4—figure supplement 3—source data 1
Full membrane scans for western blot images for Figure 4—figure supplement 3A, C, E and G.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig4-figsupp3-data1-v2.pdf
Figure 4—figure supplement 4
Trametinib treatment leads to a decrease in IL-8 secretion and ERK3 protein expression.
(A) Western blot analysis of ERK3, ERK1/2 and IκBα proteins. GAPDH and Ponceau S staining were used as loading controls. (B) IL-8 levels measured in control (DMSO) and trametinib treated HT-29 …
-
Figure 4—figure supplement 4—source data 1
Full membrane scans for western blot images for Figure 4—figure supplement 4A, B and D.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig4-figsupp4-data1-v2.pdf
Figure 4—figure supplement 5
Role of MK5 and ERK4 in the regulation of ERK3 and IL-8.
(A) MK5 depletion leads to a downregulation of ERK3 expression, resulting in LPS independent decrease of IL-8 levels. Representative western blot analysis of control (shCo) and MK5 knockdown (shMK5) …
-
Figure 4—figure supplement 5—source data 1
Full membrane scans for western blot images for Figure 4—figure supplement 5A and C.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig4-figsupp5-data1-v2.pdf
Figure 5 with 1 supplement
ERK3 regulates levels of IL-8 in a kinase-independent manner and promotes lung metastasis of MDA-MB231 breast cancer cells.
(A–B) ERK3 regulates IL-8 production in a kinase-independent manner. (A) MDA-MB231 ERK3 knockdown (shERK3) cells were reconstituted with wild type (ERK3 WT), ERK3 kinase dead mutant (ERK3 K49A K50A) …
-
Figure 5—source data 1
Full membrane scans for western blot images for Figure 5A–C.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig5-data1-v2.pdf
Figure 5—figure supplement 1
ImageJ quantification of tumor lesions using color deconvolution.
(A) Mean ± SEM number of lung tumors is presented per analyzed mouse. (B) Pulmonary metastatic burden expressed as percentage of the tumor (total tumor area/total tissue area). Mean ± SEM values are …
Figure 6 with 3 supplements
ERK3 positively regulates activity of IL-8 promoter and DNA binding activity of AP-1.
(A–C) IL-8 promoter activity is decreased in ERK3-depleted cells. MDA-MB231 cells were stably transfected with CXCL8 Gaussia Luciferase construct (Gluc-On Promoter Reporter Clones). Cells were …
-
Figure 6—source data 1
Full membrane scans for western blot images for Figure 6A.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig6-data1-v2.xlsx
-
Figure 6—source data 2
Transcription factors (TFs) activity profiling array.
Table represents activity of TF analyzed in control and ERK3-depleted HCPECs.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig6-data2-v2.pdf
Figure 6—figure supplement 1
TFs activity profiling array.
(A) Activity of 48 TFs was measured in control (siCo) and ERK3-depleted (siERK3) HCPECs as mentioned in the Materials and methods section and in the legend for Figure 6D, assessing Relative …
Figure 6—figure supplement 2
Graphical representation of (A) C/EBP and (B) CREB activity measured in control (siCo) and ERK3-depleted (siERK3) HCPECs with filter plate assay according to the manufacturer’s instructions.
Results are represented as mean fold change in activity measured in RLU ± SEM from three/four independent experiments (n = 3/n = 4); *p<0.05, **p<0.01, ***p<0.001, paired t-test.
Figure 6—figure supplement 3
Activation of NFkB in control and ERK3 knock down cells upon LPS stimulation.
(A) Graph representing transcriptional activity of NF-κB measured by TFs activity profiling array, depicted are RLU from one replicate. (B) Immunoblot analysis of control (siCo) and ERK3-depleted …
-
Figure 6—figure supplement 3—source data 1
Full membrane scans for western blot images for Figure 6—figure supplement 3B.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig6-figsupp3-data1-v2.pdf
Figure 7 with 1 supplement
ERK3 interacts with c-Jun and regulates its nuclear abundance.
(A) Co-immunoprecipitation (IP) of ERK3 and c-Jun in unstimulated and LPS stimulated HT-29 cells using a c-Jun or ERK3 antibody. Levels of c-Jun and ERK3 were monitored. IgG isotype control for IP …
-
Figure 7—source data 1
Full membrane scans for western blot images for Figure 7A and C.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig7-data1-v2.pdf
Figure 7—figure supplement 1
Cell fractionation experiment performed in HT-29 cells in the presence and absence of LPS (1.5 hr).
Fractionation was performed using Minute Plasma Membrane Protein Isolation and Cell Fractionation Kit (Cat# SM-005, Invent Biotechnologies) according to the manufacturer’s instructions. Expression …
-
Figure 7—figure supplement 1—source data 1
Full membrane scans for western blot images for Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/52511/elife-52511-fig7-figsupp1-data1-v2.pdf
Figure 8 with 1 supplement
ERK3 regulates epithelial secretome and IL-8-mediated chemotaxis of human neutrophils and monocytes in vitro and in vivo.
(A–B) In vitro migration of (A) neutrophils and (B) THP1 cells toward epithelium. CellTracker Green-stained cells were placed in the upper chamber of the transwell plate and supernatants obtained …
Figure 8—figure supplement 1
ERK3 regulates ICAM-1 expression.
RNA-seq analysis of three biological replicates (n = 3) representing differential expression in normalized counts of ICAM-1 levels in control and ERK3-depleted HCPECs.
Figure 9
Schematic representation depicting the role of ERK3 in chemotaxis.
ERK3 interacts with c-Jun and by regulating its nuclear abundance controls DNA-binding activity of AP-1 TF, which is critically required for the activation of several cytokines, including IL-8 that …
Author response image 1
Western Blot analyses of colon epithelial-like cells isolated using EpCAM microbeads from tumor and adjacent normal tissue of two CRC patients.
Cells were analysed by Western blot according to the Materials and methods section, expression levels of ERK3 were monitored.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HT-29 | ATCC | ATCC HTB-38 | |
| Cell line (Homo sapiens) | Human Colonic Primary Epithelial Cells (HCPECs) | ATCC | CCD 841 CoN, ATCC–CRL-1790 | |
| Cell line (Homo sapiens) | CaCo2 | kind gift from Prof. Monilola Olayioye (University of Stuttgart) | ||
| Cell line (Homo sapiens) | MDA-MB231 | DSMZ | ACC 732 | |
| Cell line (Homo sapiens) | THP1 | DSMZ | ACC 16 | |
| Cell line (Homo sapiens) | 293 T cells | kind gift from Dr. Andreas Ernst (Goethe-University Frankfurt am Main, IBC2) | ||
| Chemical compound, drug | LPS | Sigma | Cat# L6143 | Working concentration: 200 ng/ml |
| Chemical compound, drug | Human recombinant IL-1β | ImmunoTools | Cat# 11340013 | Working concentration: 10 ng/ml |
| Chemical compound, drug | Pam3CSK4 TLR1/2 ligand | InvivoGen | Cat# tlrl-pms | Working concentration: 20 µg/ml |
| Chemical compound, drug | R848 TLR7/8 ligand | InvivoGen | Cat# tlrl-r848 | Working concentration: 2.5 µg/ml |
| Chemical compound, drug | Cycloheximide (CHX) | Sigma | Cat# C-7698 | Working concentration: 100 µg/ml |
| Chemical compound, drug | MG-132 inhibitor | Calbiochem, Merck Millipore | Cat# 474790 | Working concentration: 10 µM |
| Chemical compound, drug | Selective MEK1/2 inhibitor trametinib GSK1120212 | Selleckchem | Cat# S2673 | Working concentration: 1 µM |
| Sequence-based reagent-shRNA | shMAPK6#1 (shERK3#1) NM_002748.x-3734s1c1 | MISSION shRNA Human Library (Sigma) | TRCN0000001568 | Sequence: CCGGGCTGTCCACGTACTTAATTTACTCGAGTAAATTAAGTACGTGGACAGCTTTTT |
| Sequence-based reagent-shRNA | shMAPK6#2 (shERK3#2) NM_002748.x-1564s1c1 | MISSION shRNA Human Library (Sigma) | TRCN0000001569 | Sequence: CCGGGACATGACTGAGCCACACAAACTCGAGTTTGTGTGGCTCAGTCATGTCTTTTT |
| Sequence-based reagent-shRNA | shMAPK6#3 (shERK3#3) NM_002748.x-798s1c1 | MISSION shRNA Human Library (Sigma) | TRCN0000001570 | Sequence: CCGGTGATCTGGGTTCTAGGTATATCTCGAGATATACCTAGAACCCAGATCATTTTT |
| Sequence-based reagent-shRNA | shMAPKAPK5#1 (shMK5#1) NM_003668.2–475 s1c1 | MISSION shRNA Human Library (Sigma) | TRCN0000194823 | Sequence: CCGGCCCAAACATAGTTCAGATTATCTCGAGATAATCTGAACTATGTTTGGGTTTTTTG |
| Sequence-based reagent-shRNA | shMAPKAPK5#5 (shMK5#5) NM_003668.x-1622s1c1 | MISSION shRNA Human Library (Sigma) | TRCN0000000682 | Sequence: CCGGGAAATTGTGAAGCAGGTGATACTCGAGTATCACCTGCTTCACAATTTCTTTTT |
| Sequence-based reagent-shRNA | shMAPK4#1 (shERK4#1) NM_002747.x-3808s1c1 | MISSION shRNA Human Library (Sigma) | TRCN0000001374 | Sequence: CCGGCTCACACCACACGCCTTAAATCTCGAGATTTAAGGCGTGTGGTGTGAGTTTTT |
| Sequence-based reagent-shRNA | shMAPK4#2 (shERK4#1) NM_002747.x-1105s1c1 | MISSION shRNA Human Library (Sigma) | TRCN0000001375 | Sequence: CCGGACTACACCAAAGCCATCGACACTCGAGTGTCGATGGCTTTGGTGTAGTTTTTT |
| Sequence-based reagent-shRNA | shMAPK4#5 (shERK4#5) NM_002747.x-1017s1c1 | MISSION shRNA Human Library (Sigma) | TRCN0000001378 | Sequence: CCGGGATCAGCATTACTCCCACAAGCTCGAGCTTGTGGGAGTAATGCTGATCTTTTT |
| Sequence-based reagent-siRNA | siMAPK6#1 (siERK3#1) | FlexiTube siRNA, Hs_MAPK6_5 Qiagen | Cat# SI00606025 | Sequence: AGUUCAAUUUGAAAGGAAATT |
| Sequence-based reagent-CRISPR/Cas9 | CRISPR ERK3 | designed by Rule Set 2 of Azimuth 2.0 as described previously (Doench et al., 2016) | Selected gRNAs sequence: #1 5’-CACCGAGCCAATTAACAGACGATGT-3’ #2 5’-CACCGATACTTGTAACTACAAAACG-3’ #3 5’-CACCGCTGCTGTTAACCGATCCATG-3’ | |
| Recombinant DNA reagent-cDNA | ERK3 K49A K50A kinase dead mutant | Site-directed mutagenesis | Primers sequence: frw_5’ GCAATTGTCCTTACTGATCCCCAGAGTGTC, rev_5’ CGCGATGGCTACTCTTTTGTCACAGTC | |
| Commercial assay, kit | Human IL-8 ELISA Ready-SET-Go! Kit | eBioscience | Cat# 88–8086 | |
| Commercial assay, kit | Cell Fractionation Kit | Invent Biotechnologies | Cat# SM-005 | |
| Commercial assay, kit | RayBiotech L-Series Human Antibody Array 1000 | Tebu-Bio | Cat# AAH-BLG-1000 | |
| Commercial assay, kit | Nuclear Extraction Kit | Signosis | Cat# SK-0001 | |
| Commercial assay, kit | TF Activation Profiling Plate Array I | Signosis | Cat# FA-1001 | |
| Commercial assay, kit | Transcription factor Filter Plate Assay AP-1 probe | Signosis | Cat# FA-0004 | |
| Commercial assay, kit | Transcription factor Filter Plate Assay C/EBP probe | Signosis | Cat# PP-0011 | |
| Commercial assay, kit | Transcription factor Filter Plate Assay CREB probe | Signosis | Cat# PP-0015 | |
| Commercial assay, kit | CXCL8-Gaussia Luciferase GLuc-ON promoter reporter clone | Genecopoeia | Cat# HPRM15772 | |
| Antibody | Human CXCL8/IL-8 neutralizing antibody | R and D | Cat# MAB208 | In vitro/in vivo chemotaxis experiments 2.8 ng/µl used for neutralization |
| Antibody | Rabbit anti-phospho-ERK3 (pSer189) | Sigma | Cat# SAB4504175 | WB 1:500 |
| Antibody | Rabbit anti-ERK3 | Cell Signaling Technology | Cat# 4067 | WB 1:500 |
| Antibody | Rabbit anti- MK5/MAPKAPK5 (D70A10) | Cell Signaling Technology | Cat# 7419 | WB 1:500 |
| Antibody | Rabbit anti-V5-tag | Cell Signaling Technology | Cat# 13202 | WB 1:500 |
| Antibody | Rabbit anti-p44/42 MAPK (ERK1/2) | Cell Signaling Technology | Cat# 9102 | WB 1:1000 |
| Antibody | Rabbit anti-phospho-p44/42 MAPK (ERK1/2) (Thr202/Tyr204) | Cell Signaling Technology | Cat# 9101L | WB 1:1000 |
| Antibody | Rabbit anti-phospho-p38 MAPK (Thr180/Tyr182) | Cell Signaling Technology | Cat# 9215 | WB 1:500 |
| Antibody | Rabbit anti-p38 MAPK antibody | Cell Signaling Technology | Cat# 9212 | WB 1:500 |
| Antibody | Rabbit anti-IκBα (44D4) | Cell Signaling Technology | Cat# 4812 | WB 1:500 |
| Antibody | Rabbit anti-phospho-SAPK/JNK (183/Y185) | Cell Signaling Technology | Cat# 9251 | WB 1:500 |
| Antibody | Normal Rabbit IgG | Cell Signaling Technology | Cat# 2729 | Used as a control for IP |
| Antibody | Rabbit anti-c-Jun (60A8) | Cell Signaling Technology | Cat# 9165 | WB 1:500 IF 1:400 |
| Antibody | Rabbit anti-Histone H3 (D1H2) | Cell Signaling Technology | Cat# 4499 | WB 1:500 |
| Antibody | Mouse anti-M2-PK antibody | Schebo Biotech AG | Cat# S-1 | WB 1:500 |
| Antibody | Rabbit anti-MAPK4 (ERK4) | Abcam | Cat# ab211501 | WB 1:500 |
| Antibody | Rabbit anti-PRAK/MK5 (phospho T182) antibody | Abcam | Cat# ab138668 | WB 1:500 |
| Antibody | Anti-β-actin HRP conjugated | Abcam | Cat# ab49900 | WB 1:40 000 |
| Antibody | Mouse, anti-Keratin 20 (Krt20) | Agilent Dako | Cat# M701929 | WB 1:1000 |
| Antibody | Mouse anti-GAPDH antibody | GeneTex | Cat# GTX627408 | WB 1:1000 |
| Antibody | Mouse anti-α-tubulin antibody | GeneTex | Cat# GTX628802 | WB 1:1000 |
| Antibody | Mono- and polyubiquitin conjugates monoclonal HRP-coupled antibody (FK2) | Enzo | Cat# BML-PW8810 | WB 1:250 |
| Antibody | HRP-conjugated secondary antibody for rabbit IgG | Invitrogen | Cat# A16096 | WB 1:40 000 |
| Antibody | HRP-conjugated secondary antibody for rabbit IgG | Invitrogen | Cat# 32460 | WB 1:2000 |
| Antibody | HRP-conjugated secondary antibody for mouse IgG | GE Healthcare Life Sciences | Cat# NA9310 | WB 1:20 000 |
| Antibody | Anti-ERK3 | R and D | Cat# MAB3196 | IF 1:400 |
| Antibody | Goat anti-rabbit IgG-Alexa 488 | Thermo Fisher Scientific | Cat# A11008 | IF, working concentration: 5 µg/ml |
| Antibody | Goat anti-mouse IgG-Cyanine3 | Thermo Fisher Scientific | Cat# A10521 | IF, working concentration: 2D cultures: 5 µg/ml 3D cultures: 8 µg/ml |
| Chemical compound, drug | DNA dye Hoechst 33342 | Thermo Fisher Scientific | Cat# H3570 | IF, working concentration: 10 µg/ml |
| Sequence-based reagent | qRT-PCR primers human ERK3 | Sigma | Frw_5’ ATGGATGAGCCAATTTCAAG Rv_5’ CTGACAATCATGATACCTTTCC | |
| Sequence-based reagent | qRT-PCR primers human CXCL8#1 | Sigma | Frw_5’ GAGCACTCCATAAGGCACAAA Rv_5’ ATGGTTCCTTCCGGTGGT | |
| Sequence-based reagent | qRT-PCR primers human CXCL8#3 | Sigma | Frw_5’ TGTAAACATGACTTCCAAGC Rv_5’ AAAACTGCACCTTCACAC | |
| Sequence-based reagent | qRT-PCR primers human IL16 | Sigma | Frw_5’ CAGTGTTAATCCCTATTGCAC Rv_5’ ATTGTTGAGAGAGGGACTTC | |
| Sequence-based reagent | qRT-PCR primers human CXCL6 | Sigma | Frw_5’ CCTCTCTTGACCACTATGAG Rv_5’ GTTTTGGGGTTTACTCTCAG | |
| Sequence-based reagent | qRT-PCR primers human TLR4 | Sigma | Frw_5’ TGGAGGTGTGAAATCCAG Rv_5’ CTTGATAGTCCAGAAAAGGC | |
| Sequence-based reagent | qRT-PCR primers housekeeping human 18 s | Sigma | Frw_5’ AGAAACGGCTACCACATCCA Rv_5’ CACCAGACTTGCCCTCCA | |
| Sequence-based reagent | qRT-PCR primers housekeeping human GAPDH | Sigma | Frw_5’ CGACAGTCAGCCGCATCTT Rv_5’ CCCCATGGTGTCTGAGCG | |
| Sequence-based reagent | qRT-PCR primers human GKN1 | Sigma | Frw_ 5’ agctcctgccctagctaactataa Rv_ 5’ ttgtgttcattgttgacactcact | Used for HGOs qRT-PCR experiments |
| Sequence-based reagent | qRT-PCR primers human ERK3 | Sigma | Frw_ 5’ tcgatgagtcggagaagtcc Rv_ 5’ gaagatgtcttttgttagtgatcaggt | Used for HGOs qRT-PCR experiments |
| Sequence-based reagent | qRT-PCR primers mouse Alpi | Sigma | Frw_ 5’ AGGATCCATCTGTCCTTTGGT Rv_ 5’ TTCAGCTGCCTTCTTGTTCC | Used for MCOs qRT-PCR experiments |
| Sequence-based reagent | qRT-PCR primers mouse Krt20 | Sigma | Frw_ 5’ agtcccacctcagcatgaa Rv_ 5’ gagctcagcatctcctggat | Used for MCOs qRT-PCR experiments |
| Sequence-based reagent | qRT-PCR primers mouse Erk3 | Sigma | Frw_ 5’ acgacatgactgagccacac Rv_ 5’ TCTGCTCCAGGAAATCCAGT | Used for MCOs qRT-PCR experiments |
| Sequence-based reagent | qRT-PCR primers housekeeping mouse Gapdh | Sigma | Frw_ 5’ GTGCCAGCCTCGTCC Rv_ 5’ ACCCCATTTGATGTTAGTGG | Used for MCOs qRT-PCR experiments |
| Software, algorithm | ImageJ | RRID:SCR_003070 | RRID:SCR_003070 https://imagej.net/ | Used for WB quantification and IF staining analyses |
| Software, algorithm | ImageJ Coloc2 Plugin | Self-modified version as described by French et al. (2008). | Self-modified version of ImageJ RRID:SCR_003070 | Used to quantify Fluorescence co-localizations c-Jun and ERK3 |
| Software, algorithm | Fiji | RRID:SCR_003070 | Fiji (RRID:SCR_002285)http://fiji.sc | Used for IF images visualization |
