Research Article

Cell Biology

ERK3/MAPK6 controls IL-8 production and chemotaxis

Cell Biology Unit, University Medical Center of the Johannes Gutenberg University Mainz, Germany
Institute of Medical Biostatistics, Epidemiology and Informatics, University Medical Center of the Johannes Gutenberg University Mainz, Germany
Center for Thrombosis and Hemostasis (CTH), University Medical Center of the Johannes Gutenberg University Mainz, Germany
Institute of Medical Biometry and Statistics, Faculty of Medicine and Medical Center – University of Freiburg, Germany
Departments of Biology and Physics, Wilkes University, United States
Gene Editing Group, Institute of Biochemistry II, Goethe University, Germany
Frankfurt Cancer Institute, Germany
Institute of Immunology, University Medical Center of the Johannes Gutenberg University Mainz, Germany
Department of Hematology, Medical Oncology, & Pneumology, University Medical Center of the Johannes Gutenberg University Mainz, Germany
Department of General, Visceral- and Transplant Surgery, University Medical Center, Germany
University Cancer Center Mainz, University Medical Center Mainz, Germany

Apr 21, 2020

https://doi.org/10.7554/eLife.52511

Open access
Copyright information

Version of Record

Accepted for publication after peer review and revision.

Download
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

Version of Record published: April 30, 2020 (This version)
Accepted Manuscript published: April 21, 2020 (Go to version)
Accepted: April 17, 2020
Received: October 7, 2019

1. Built upon by
ERK3/MAPK6 dictates CDC42/RAC1 activity and ARP2/3-dependent actin polymerization

Katarzyna Bogucka-Janczi, Gregory Harms ... Krishnaraj Rajalingam

Research Advance May 17, 2023
Further reading

Abstract
Introduction
Results
Discussion
Materials and methods
Data availability
References
Article and author information
Metrics

Abstract

ERK3 is a ubiquitously expressed member of the atypical mitogen activated protein kinases (MAPKs) and the physiological significance of its short half-life remains unclear. By employing gastrointestinal 3D organoids, we detect that ERK3 protein levels steadily decrease during epithelial differentiation. ERK3 is not required for 3D growth of human gastric epithelium. However, ERK3 is stabilized and activated in tumorigenic cells, but deteriorates over time in primary cells in response to lipopolysaccharide (LPS). ERK3 is necessary for production of several cellular factors including interleukin-8 (IL-8), in both, normal and tumorigenic cells. Particularly, ERK3 is critical for AP-1 signaling through its interaction and regulation of c-Jun protein. The secretome of ERK3-deficient cells is defective in chemotaxis of neutrophils and monocytes both in vitro and in vivo. Further, knockdown of ERK3 reduces metastatic potential of invasive breast cancer cells. We unveil an ERK3-mediated regulation of IL-8 and epithelial secretome for chemotaxis.

Introduction

Kinases constitute the major component of the druggable genome and deregulation in kinase signaling is associated with nearly 400 diseases (Hopkins and Groom, 2002; Melnikova and Golden, 2004). The FDA has thus far approved 28 kinase inhibitors for targeted therapeutics (Wu et al., 2016). Their clinical success in treating a subset of cancers led to enormous interest in understanding the ‘underexplored kinome’. Mitogen activated protein kinases (MAPKs) are a class of serine threonine protein kinases that control fundamental processes like proliferation, migration, differentiation and cell survival (Raman et al., 2007). MAPKs are usually activated in a three-tier signaling cascade and the RAS-RAF-MEK1/2-ERK1/2 is the first characterized MAPK cascade that is activated in response to growth factors (Wellbrock et al., 2004). As a paradigm, this cascade is triggered by the activation of the RhoGTPase RAS, which in turn activates the proximal MAPKKK (RAF kinase) of the cascade. MAPKKK kinases then phosphorylate and activate a MAPKK (like MEKs), which ultimately transfer phosphate groups to the threonine or tyrosine residues in the activation segment of the kinase domain of the MAPKs. Classical MAPKs are primarily recognized by the presence of the classical (Thr-X-Tyr) motif, which is phosphorylated by dual specific MAPKKs like MEK1 and MEK2. The activated MAPKs phosphorylate serine and threonine residues in hundreds of substrates, including transcription factors that define a specific response. Among the 14 MAPKs, ERK1, ERK2, p38 α/β/γ/δ and JNK1/2/3 are well characterized.

MAPK6/ERK3 belongs to the unconventional MAPKs that lack the typical Thr-X-Tyr motif in the activation loop of the kinase domain of classical MAPKs (Cargnello and Roux, 2011). Despite being ubiquitously expressed, physiological stimuli that trigger ERK3 phosphorylation and activation, as well as its authentic substrates are not well characterized. ERK3 mRNA is ubiquitously expressed in all tissues with highest expression levels detected in brain, muscles and gastrointestinal tract (Coulombe and Meloche, 2007). It was reported that genetic deletion of ERK3 led to a respiratory failure, disturbed growth and neonatal lethality in mice within the first days of life; however, these observations were recently challenged by two publications that confirmed that the observed phenotype was probably attributed to off target effects (Klinger et al., 2009; Ronkina et al., 2019; Soulez et al., 2019). Unlike conventional MAPKs, ERK3 possesses a single phospho-acceptor site at serine 189 within its N-terminus domain, which is constitutively phosphorylated in resting cells. ERK3 is a highly unstable protein with a half-life of 30 to 45 min that undergoes N-terminal ubiquitination. The E3 ubiquitin ligases responsible for this process are currently unknown (Coulombe and Meloche, 2007; Coulombe et al., 2004; Coulombe et al., 2003). However, Usp20 was recently identified as the first deubiquitinating enzyme (DUB) for ERK3 (Mathien et al., 2017). The physiological stimuli that activate ERK3 remain unclear and the role of this atypical MAPK in the regulation of physiological processes such as innate immunity has not been studied.

Establishment of stratified epithelium is a fundamental process during development contributing to tissue architecture and it further serves as a first line of defense against pathogen entry in the gastrointestinal tract (Dotti and Salas, 2018; Niessen et al., 2012; Otte et al., 2004). As a constantly differentiating system, gut epithelium is an ideal model to identify genes involved in the process (Aliaga et al., 1999). ERK3 has been shown to be required for the maintenance of epithelial architecture; however, genetic deletion studies in mice unveiled a non-essential role for this protein (Ronkina et al., 2019; Takahashi et al., 2018). To gain further insights into the potential role of ERK3 in epithelial morphogenesis and differentiation, we studied ERK3 expression levels by employing three-dimensional (3D) gastrointestinal organoids that reflect either murine intestinal or human gastric architecture and cell composition (Almeqdadi et al., 2019; Dotti and Salas, 2018). Epithelial cells respond to innate immune stimuli by secreting key inflammatory molecules to promote chemotaxis of immune cells to the micromilieu (Li et al., 1998; Okumura and Takeda, 2017; Onyiah and Colgan, 2016). IL-8 is one of the first chemokines released by injured or inflamed epithelium, and it is constitutively expressed by intestinal epithelial cells (Eckmann et al., 1993). Being a prime modulator of the epithelial immune responses, IL-8 expression is coordinated by multiple signaling pathways (Jundi and Greene, 2015; Wen and Wu, 2001). Transcriptional activation of the IL-8 promoter strictly relies on the binding of inducible transcription factors (TFs) such as NF-κB and activating protein 1 (AP-1) (Hoffmann et al., 2002; Jundi and Greene, 2015). The AP-1 transcription factor is a homodimeric/heterodimeric protein complex formed between Jun and Fos proteins (Jundi and Greene, 2015; Leppä and Bohmann, 1999). Its transcriptional potential is regulated by protein phosphorylation, its abundance and interaction with protein kinases like MAPKs in the nuclei (Hoffmann et al., 2002). The AP-1 transcription factor c-Jun can translocate and be retained in the nucleus as a monomer, without binding to its target sequence (Karin, 1996; Schreck et al., 2011). Although c-Jun is predominantly regulated by JNK it was demonstrated that its nuclear translocation is independent of its phosphorylation by and interaction with JNK (Schreck et al., 2011). Here, we unveil a kinase-independent role of ERK3 in the regulation of the epithelial secretome including maintenance and induction of IL-8, in both, normal and tumorigenic cells. ERK3-mediated IL-8 secretion is critical for the chemotaxis of leukocytes to the epithelium. We further unveil a synergistic role of ERK3 and classical MAPKs in the regulation of epithelial secretome and identify ERK3 as a novel interacting partner of c-Jun and regulator of AP-1 activity.

Results

ERK3 protein dynamics during morphogenesis and differentiation of gastrointestinal organoids

To elucidate the physiological role of ERK3 in the establishment of stratified epithelium, we generated murine and human gastrointestinal organoid cultures as described in the Materials and methods. Undifferentiated mouse colon organoids (MCOs) and patient-derived human gastric organoids (HGOs) were expanded and epithelial differentiation was induced by withdrawal of Wnt3A and R-spondin 1 (RSP1) from the media. We evaluated the expression of ERK3 mRNA and protein levels in the differentiating organoids (Figure 1A). The differentiation of these organoids was confirmed by the expression of epithelial differentiation markers including Keratin 20 (Krt20). As expected, induction of differentiation led to a high expression of Krt20 in differentiated organoids (Figure 1B, Figure 1—figure supplement 1A). Expression levels of ERK3 protein and mRNA were analyzed by western blotting and real-time PCR (RT-PCR). These data revealed that ERK3 protein levels are significantly lower in the differentiated MCOs as compared to the undifferentiated ones (Figure 1C–D). The mRNA levels of Erk3 were slightly higher under differentiated conditions (Figure 1E). Taken together, these data suggest that the decrease in ERK3 expression observed in the differentiated MCOs is regulated at the protein levels.

Figure 1 with 1 supplement see all

Download asset Open asset

Role of ERK3 in gastrointestinal organoids morphogenesis and differentiation.

(A) Schematic outline of individual steps for organoid establishment and differentiation. Undifferentiated, healthy mouse colon organoids (MCO) or human gastric organoids (HGO) were differentiated by withdrawal of Wnt3A and RSP1 and subjected to western blot (WB), RT-PCR and/or immunofluorescence staining (IF) analyses. (B) Representative micrographs of undifferentiated and differentiated MCO. Shown are stainings with differentiation marker Keratin (20) (Krt20) (red) and DAPI (blue). Scale bar 50 µm. (C) Representative immunoblot analysis of undifferentiated (Undiff) and differentiated (Diff) MCO. MCO were seeded in matrigel, 3 days post-seeding differentiation process was induced. Organoids were lysed on day 7 for WB analyses using antibodies against total ERK3 and Krt20 differentiation marker. Actin and Ponceau S staining were used as loading controls. (D) Fold change in ERK3 protein expression presented as a ratio Diff/Undiff after normalization with the internal loading control (Actin/Ponceau S). Data derived from five independent experiments (n = 5) are represented as mean ± SEM fold change; *p<0.05, **p<0.01, ***p<0.001, paired t-test. (E) Quantitative RT-PCR analysis of *Erk3* expression in differentiated organoids when compared to undifferentiated organoids. Each biological replicate was measured in triplicates. Log2 fold change in gene expression is presented as mean ± SEM of five independent experiments (n = 5); *p<0.05, **p<0.01, ***p<0.001, paired t-test. Expression of differentiation markers: *Krt20* and intestinal alkaline phosphatase (*Alpi*) (enterocyte marker) was determined by RT-PCR and is presented in Figure 1—figure supplement 1A-B. (F) WB analysis of HGOs under undifferentiated and differentiated conditions. HGOs were seeded in matrigel and after 4 days differentiation was started by withdrawal of Wnt3A and RSP1. Organoids were lysed on day 10 and levels of ERK3 and Krt20 were assessed by WB analysis. Actin and Ponceau S staining were used as loading controls. (G) Representative western blot analysis of ERK3 kinetics in HGOs upon differentiation. HGOs were seeded in matrigel and differentiation was induced 4 days post-seeding. Organoids were lysed on days 2, 4, 6, 8 and 10, levels of ERK3 were monitored. Krt20 expression was used as a differentiation marker and actin/Ponceau S staining as loading controls. (H) ERK3 expression in differentiating HGO was calculated in respect to the undifferentiated organoids after normalization with loading control and is presented as mean fold change ± SEM from three biological replicates of HGOs (n = 3) from two different patients. (I) Relative expression of *ERK3* was assessed by RT-PCR in differentiated HGOs (from two different patients) on days 2, 4, 6, 8 and 10 in respect to the undifferentiated organoids and is presented as mean log2 fold change ± SEM from three independent experiments (n = 3) except of day 10 (Diff day 10) where two biological replicates are depicted (n = 2). Expression of the Gastrokine 1 (*GKN1*) differentiation marker was monitored and is presented in Figure 1—figure supplement 1C.

Figure 1—source data 1 Full membrane scans for western blot images for Figure 1C, F and G.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig1-data1-v2.pdf
Download elife-52511-fig1-data1-v2.pdf

We then performed similar experiments in HGOs which recapitulated the ERK3 expression pattern observed in the MCOs. ERK3 protein levels steadily decrease during the differentiation of HGOs without much change in the mRNA levels (Figure 1F–I, Figure 1—figure supplement 1C). In conclusion, these data indicate that ERK3 proteostasis might play a role in epithelial differentiation and function.

LPS exerts opposing effects on ERK3 proteostasis in primary epithelial cells and colon carcinoma cell lines

Epithelial monolayer serves as the first line of defense against pathogens in the gastrointestinal tract; however, despite being constantly exposed to significant levels of luminal LPS, the primary epithelium does not display inflammation under physiological conditions (Otte et al., 2004).

To investigate the activation dynamics of ERK3 in response to LPS in human epithelial cells, we challenged colorectal adenocarcinoma HT-29 cells with LPS for various time points as described in the Materials and methods. Interestingly, LPS stimulation led to a time-dependent increase in the protein levels of ERK3 with concomitant increase in the phosphorylation status of S189 during the time frame of the experiment (Figure 2A and B). We did not detect any changes in the protein levels of the closely related MAPK ERK4 (MAPK4) (Figure 2A). MK5 (MAPKAPK5), one of the proposed downstream substrates of ERK3 and ERK4 was also activated in response to LPS, as revealed by the increased T182 phosphorylation of MK5 in LPS-treated HT-29 cells (Figure 2A and C). Similarly, we also detected an increase in pERK3 levels in colorectal adenocarcinoma CaCo2 cells in response to LPS (Figure 2—figure supplement 1). Further, expression levels of ERK3 mRNA were determined with quantitative RT-PCR with no significant increase detected upon LPS treatment (Figure 2D). RT-PCR analyses coupled with cycloheximide (CHX) chase experiments revealed that LPS upregulates ERK3 protein levels (Figure 2E), while not exerting any significant increase in ERK3 protein half-life (Figure 2F). These data suggested that ERK3 might possibly play a role in LPS-mediated responses in the epithelium.

Figure 2 with 3 supplements see all

Download asset Open asset

Effect of LPS on ERK3 expression and protein stability.

HT-29 cells and HCPECs were stimulated with LPS (200 ng/ml) at various time points as indicated. (A) Representative western blot analysis of HT-29 cells. Phosphorylation and/or total protein levels of ERK3, ERK4, MK5 and JNK were monitored. Tubulin immunoblots and Ponceau S staining were employed to monitor equal loading. (B) Changes in the expression and phosphorylation of ERK3 protein are shown as a fold change after normalization with internal loading control. Each time point was normalized to unstimulated cells (0). Fold change values from three independent experiments (n = 3) are represented as mean ± SEM. (C) Activation kinetics of MK5 in HT-29 cells stimulated with LPS. Fold change in MK5 phosphorylation levels upon LPS stimulation normalized to total protein levels and expression levels of MK5 normalized to internal loading control are shown. Fold change values from three independent experiments (n = 3) are represented as mean ± SEM. (D) Quantitative RT-PCR analysis of *ERK3* expression. Each biological replicate was measured in triplicates. Log2 fold change in gene expression is presented as mean ± SEM of three independent experiments (n = 3); *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. (E) ERK3 protein stability was assessed by CHX chase at 0 hr, 0.5 hr, 1 hr, 2 hr, 3/4 hr and 6 hr in the presence and absence of LPS (30 min pre-treatment). Western blot analyses were performed and representative results are presented. ERK3 protein levels in respect to the untreated cells (-LPS, 0 hr) were calculated using ImageJ and data are presented as mean fold change ± SEM from three independent experiments (n = 3). (F) Graph presents ERK3 protein levels quantified in respect to the untreated cells (0) of unstimulated (-LPS) and LPS stimulated (+LPS) cells, respectively and data are presented as mean fold change ± SEM from three independent experiments (n = 3). (G) HCPECs were stimulated with LPS and immunoblot analyses of the phosphorylation and/or total protein levels of ERK3, MK5 and p38 were performed. Actin and Ponceau S staining were used as loading controls. (H) Plotted here are fold changes in expression of ERK3 protein. Results are shown as mean ± SEM fold change after normalization with the levels of internal loading control. Each time point was normalized in respect to unstimulated HCPECs (0). Data are a representative of three independent experiments (n = 3); *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. (**I-K**) Plotted here are fold changes in the phosphorylation of (I) MK5 at T182, (J) ERK1/2 and (K) p38 in response to LPS stimulation normalized to the respective total protein levels as well as the expression levels of total proteins normalized in respect to the internal loading control. Each time point was normalized in respect to the unstimulated cells (0). Fold change values are presented as mean ± SEM from three independent experiments (n = 3). (L) Quantitative RT-PCR analysis of *ERK3* mRNA expression levels. Log2 fold change in gene expression is presented as mean ± SEM of three independent experiments (n = 3); *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. (**M-N**) LPS-mediated ubiquitination of endogenous ERK3 in (M) HT-29 cells and (N) HCPECs. HT-29 cells and HCPECs were seeded and treated as mentioned in the Materials and methods. Total cell lysates (TCL) and endogenous ERK3 immunoprecipitates (IP) were analyzed by immunoblotting. Levels of ERK3 and polyubiqutination were monitored. Actin and Ponceau S staining were used as loading controls for TCL western blot analysis. Results are representatives of at least two experiments showing the same tendency. ERK3 kinetics in response to other immune stimuli are presented in Figure 2—figure supplement 3).

Figure 2—source data 1 Full membrane scans for western blot images for Figure 2A, E, G, M and N.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig2-data1-v2.pdf
Download elife-52511-fig2-data1-v2.pdf

We then tested if the observed effects are confined to tumorigenic cells by performing similar experiments in human colonic primary epithelial cells (HCPECs). Interestingly, in these cells, LPS stimulation led to a decrease in the protein levels of ERK3, while activating MK5 and the classical MAPKs: ERK1/2 and p38 (Figure 2G–K). These results also indicate that MK5 might be phosphorylated and activated by p38 MAPK or the closely related ERK4 as these two MAPKs have also been shown to phosphorylate MK5 at T182 (Aberg et al., 2009; New et al., 1998). Interestingly, LPS stimulation also affects the total protein levels of MK5 in a kinetic manner (Figure 2G and I). It has been reported that unlike the tumorigenic cells, primary epithelial cells express low levels of Toll-like receptor 4 (TLR4) (Cario and Podolsky, 2000; Pott and Hornef, 2012). This observation was confirmed in our cell culture models for HCPECs and HT-29 cells (Figure 2—figure supplement 2). Despite the observed discrepancy in primary and oncogenic cells in response to LPS, the effects observed are attributed to the altered proteostasis of ERK3, as ERK3 mRNA levels are not significantly altered in response to LPS in both cell types (Figure 2D and L). Consistently, the polyubiquitination of endogenous ERK3 is modulated in response to LPS in both HT-29 cells and HCPEC: LPS treatment repressed and induced ERK3 ubiquitination in oncogenic and primary epithelial cells, respectively (Figure 2M and N, respectively). These results confirmed that LPS-mediated turnover of ERK3 protein is partially mediated via the ubiquitin proteasome machinery.

We then tested whether ERK3 is activated in response to other innate immune stimuli like TLR1/2 ligand Pam3CSK4, TLR7/8 ligand R848 and IL-1β. We detected an increase in the phosphorylation of ERK3 (S189) in response to IL-1β and Pam3CSK4, in both, HCPECs (Figure 2—figure supplement 3A–3B) and HT-29 cells (Figure 2—figure supplement 3D–3E). In contrast to the other stimuli, we detected a decrease in S189 phosphorylation with TLR7/8 ligand R848 in both cell types (Figure 2—figure supplement 3C and F). These data suggest that ERK3 is preferentially activated in a cell type- and stimulus-dependent manner.

ERK3 regulates transcription of CXCL8 and other key chemotactic factors

To understand the physiological relevance of ERK3 in modulating LPS-mediated innate immune responses in the epithelium, we performed RNA sequencing analysis in the presence and absence of ERK3. HCPECs wild type (WT) (siCo) or ERK3-depleted (siERK3) were challenged with LPS for 24 hr and differentially expressed (DE) factors were analyzed (Figure 3 and Figure 3—source data 1). Several key cytokines and chemokines contributing to epithelial function were found to be downregulated in ERK3-depleted cells, suggesting that ERK3 is probably required for the positive regulation of the epithelial secretome (Figure 3D and Figure 3—source data 1). To further evaluate these observations, we performed a direct secretome analysis of control vs ERK3-depleted HCPECs as described in the Materials and methods (Figure 3- Figure 3—source data 2). Interestingly, we saw that many of the differentially regulated factors identified in the transcriptome analysis were also altered at the protein levels (Figure 3- Figure 3—source data 3). In particular, we discovered that ERK3 is required for the transcriptional regulation of CXCL8, CXCL10, CCL2 and CXCL6 in HCPECs (Figure 4A). Indeed, we validated that ERK3 regulates the mRNA levels of CXCL8, IL16 and CXCL6 in HCPECs (Figure 4—figure supplement 1A–C). Further, gene ontology (GO) enrichment analysis was performed on the DE genes associated with the regulation of chemotaxis and immune responses to determine biological processes that might be regulated by ERK3 in HCPECs. Selected pathways ranked in accordance to p-value eliminated are presented as a table in Figure 3—figure supplement 1. A heatmap for the genes associated with positive regulation of leukocyte chemotaxis was generated and differential expression of the relevant genes is presented for control and ERK3-depleted HCPECs (Figure 3—figure supplement 1). These analyses confirmed that ERK3 plays an important role in the regulation of genes involved in, among others, immune responses and leukocyte chemotaxis.

Figure 3 with 1 supplement see all

Download asset Open asset

RNA sequencing analysis of control and ERK3 knockdown HCPECs.

HCPECs were transiently transfected with either control siRNA (siCo) or siRNA targeting ERK3 (siERK3). 24 hr post-transfection medium was exchanged and cells were stimulated with LPS. 24 hr later supernatants were harvested for each variant for further secretome analysis and the isolated RNA was directed for RNAseq analysis. (A) Representative western blot analysis of control (siCo) and ERK3-depleted (siERK3) HCPECs under -/+ LPS conditions subjected for RNAseq and secretome analyses. Levels of ERK3 were determined to estimate knockdown efficiency, actin and Ponceau S are provided as loading controls. (B) Heatmap representing differentially expressed (DE) genes. (C) DE genes in resting and LPS stimulated siERK3 cells as compared to siCo cells. (D) Visual representation of DE genes in siERK3 cells when compared with siCo cells. Table represents DE genes downregulated upon ERK3 depletion in unstimulated (-LPS) HCPECs.

Figure 3—source data 1 RNA sequencing analysis of control and ERK3 knockdown HCPECs. Table presents DE genes in resting (t0) and LPS stimulated (t24) siERK3 cells in comparison with the siControl cells, which are represented as a Venn diagram in Figure 3D.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig3-data1-v2.xlsx
Download elife-52511-fig3-data1-v2.xlsx
Figure 3—source data 2 Secretome analysis of control and ERK3-depleted HCPECs. Two slides were employed for the analysis as described in the Materials and methods section (L507 and L493). The ratio between siControl and siERK3 was calculated for all the factors and presented in the table.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig3-data2-v2.xlsx
Download elife-52511-fig3-data2-v2.xlsx
Figure 3—source data 3 Combined transcriptome and secretome analysis of control and ERK3-depleted HCPECs. Table presents RNAseq derived genes (txm) and secretome derived factors (secretome) and the merged (txm:secretome) factors. Shown in the excel table is a Venn diagram combining the factors identified by transcriptome and secretome.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig3-data3-v2.xlsx
Download elife-52511-fig3-data3-v2.xlsx
Figure 3—source data 4 Full membrane scans for western blot images for Figure 3A.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig3-data4-v2.pdf
Download elife-52511-fig3-data4-v2.pdf

Figure 4 with 5 supplements see all

Download asset Open asset

ERK3 regulates levels of IL-8 and other chemokines.

(A) Graphs represent RNAseq-derived normalized counts between siControl and siERK3 samples from three biological replicates of unstimulated HCPECs. (**B-C**) ELISA was performed to determine CXCL8/IL-8 levels in (B) HT-29 and (C) HCPECs in response to LPS. IL-8 concentrations presented as mean ± SEM were obtained from three independent experiments (n = 3); *p<0.05, **p<0.01, ***p<0.001, one way ANOVA, Turkey’s post-test. (**D-F**) Secretion of CXCL8/IL-8 was measured in supernatants obtained from different cell lines. Each cancer cell line was stably transduced with lentiviral particles carrying either shRNA empty vector control or with shRNA targeting ERK3. HCPECs were transiently transfected with either control siRNA or siRNA targeting ERK3. After 24 hr, medium was exchanged for each cell line for serum and supplements free medium and cells were cultured for 48 hr prior supernatant collection. (D) All cell lines were subjected to western blot analysis and ERK3 knockdown efficiency was estimated. Ponceau S staining and actin/GAPDH loading controls are provided. Depicted western blots are representative for at least three independent experiments (n = 3). (E) IL-8 levels were measured by ELISA. Shown are data representing mean ± SEM concentration in pg/ml from three biological replicates (n = 3); *p<0.05, **p<0.01, ***p<0.001, t-test. (F) Control (shCo) or ERK3 knockdown HT-29 cells (shERK3) presented in D were stimulated with LPS at indicated time points. Supernatants were harvested for each time point and IL-8 levels were measured by ELISA. Data are representing mean concentration in pg/ml ± SEM from three biological replicates per condition (n = 3); *p<0.05, **p<0.01, ***p<0.001, two-way ANOVA, Bonferroni post-tests. (**G-H**) Control (CRISPR Co) and ERK3 knockout (CRISPR ERK3) HT-29 cells were stimulated with LPS for 0 hr, 3 hr, 6 hr or 24 hr, supernatants were harvested and IL-8 levels were monitored. (G) Cells were analyzed by immunoblotting, levels of ERK3 expression were monitored. Ponceau S staining and actin are included as loading controls. Data are a representative of three biological experiments (n = 3). (H) IL-8 concentrations in pg/ml are presented as mean ± SEM obtained from three independent experiments (n = 3); *p<0.05, **p<0.01, ***p<0.001, two-way ANOVA, Bonferroni post-tests. Additionally, IL-1β- and Pam3CSK4-dependent regulation of IL-8 was tested in control and ERK3-depleted HCPECs and HT-29 cells and data are presented in Figure 4—figure supplement 3. Cross-talk between ERK1/2 and ERK3 is presented in Figure 4—figure supplement 4. (I) Phase-contrast microscopy control (CRISPR Co) and CRISPR ERK3 HGOs from two patients. Organoids were dissociated into single cells and transduced with either CRISPR control (CRISPR Co) or CRISPR ERK3 lentiviral particle-containing supernatants. 4 hr post-infection, cells were seeded in matrigel and 48 hr later 3D cultures were selected with 5 µg/ml of puromycin. Organoids were split and cells were collected for immunoblot analyses. Bright field images of both cultures were taken on day seven after splitting. Scale bar represents 200 µm. (J) Western blot analysis of control (CRISPR Co) and ERK3 knockout (CRISPR ERK3) HGOs. ERK3 expression was monitored to verify knockdown efficiency, actin and Ponceau S staining are provided as loading controls. (K) IL-8 protein secretion was measured in supernatants obtained from control (CRISPR Co) and ERK3 knockout (CRISPR ERK3) HGOs from two patients. Supernatants were harvested from two different 3D organoid cultures after two rounds of puromycin-based selection and after splitting of the organoids. Mean fold change in IL-8 concentrations (pg/ml)± SEM is presented for CRISPR ERK3 supernatants in respect to the control samples (CRISPR Co) obtained from four biological replicates (n = 4); *p<0.05, **p<0.01, ***p<0.001, paired t-test. (L) Relative expression of *CXCL8* mRNA was measured at different days of HGOs differentiation. Presented are mean fold changes ± SEM in *CXCL8* expression in differentiated organoids normalized in respect to the undifferentiated HGOs from three different cultures of gastric organoids for two patients. Data represent three biological replicates (n = 3), except of day 10 (Diff day 10) where two biological replicates are depicted (n = 2). *p<0.05, **p<0.01, ***p<0.001, one way ANOVA, Turkey’s post-test.

Figure 4—source data 1 Full membrane scans for western blot images for Figure 4D, G and J.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig4-data1-v2.pdf
Download elife-52511-fig4-data1-v2.pdf

IL-8 protein levels reflect ERK3 expression status in LPS stimulated HCPECs and HT-29 cells

Considering that ERK3 regulates IL-8 production and the fact that LPS treatment exerts an opposing effect on ERK3 protein levels in HCPECs and oncogenic HT-29 cells (Figure 2A–G, respectively), levels of CXCL8/IL-8 were determined in both cell lines in response to LPS. Interestingly, while IL-8 levels increased over time in HT-29 cells, drastic reduction in chemokine levels was observed in HCPECs upon LPS stimulation (Figure 4B and C, respectively). More interestingly, IL-8 levels measured in HT-29 and HCPECs in response to LPS reflected ERK3 expression status in both cell types (Figure 4B–C, Figure 2A–B, and Figure 2G–H). In contrast to cancer cells, HCPECs display a high basal level of IL-8 (Figure 4B and C). Depletion of ERK3 with multiple siRNAs and shRNAs led to a significant reduction in both, basal as well as LPS-induced IL-8 levels, suggesting an obligatory role for ERK3 in the maintenance of IL-8 not only in HCPECs and HT-29 cells, but also in MDA-MB231 and HeLa cells (Figure 4D–F and Figure 4—figure supplement 2). To further corroborate these observations, we established ERK3 knockout cells by employing a CRISPR/Cas9 approach. Consistent with the observations made with si- and shRNAs, we affirmed that CRISPR/Cas9 knockout of ERK3 reduces LPS-induced IL-8 levels in CRISPR ERK3 HT-29 cells (Figure 4G–H). Furthermore, we performed loss-of-function studies in HGOs by employing lentivirus-based CRISPR/Cas9 system. The infected cells were then selected for antibiotic resistance and the efficiency of the knockout was verified by western blots. Data obtained from HGOs of two different patients revealed that ERK3 is not required for the 3D growth of human gastric epithelium as we failed to detect any significant change in the number or the size between the control (CRISPR Co) and ERK3-depleted (CRISPR ERK3) HGOs (Figure 4I–J). However, consequently with the observations made for HCPECs, knockout of ERK3 impaired IL-8 secretion in human gastric organoids from two different patients (Figure 4K). We also verified mRNA expression of CXCL8 in HGOs upon differentiation (Figure 4L), which correlates with the expression pattern of ERK3 protein levels (Figure 1G–H).

Next, we investigated the role of ERK3 in the production of IL-8 stimulated by IL-1β and TLR1/2 ligand Pam3CSK4, the other two ERK3 activating stimuli (Figure 2—figure supplement 3) apart from LPS. 24 hr stimulation with IL-1β induced ERK3 protein expression in control (siCo) HCPECs with concomitant upregulation of IL-8 (Figure 4—figure supplement 3A–3B). However, knockdown of ERK3 (siERK3) did not reduce IL-8 levels induced by IL-1β (Figure 4—figure supplement 3A–3B) suggesting that activation of p38 MAPK, but not ERK3 is probably contributing to IL-8 production in primary intestinal epithelial cells as shown before (Parhar et al., 2003). On the contrary, depletion of ERK3 inhibited the induction of IL-8 upon stimulation of these cells with Pam3CSK4 despite the activation of p38 MAPK (Figure 4—figure supplement 3C–3D).

Unlike in primary cells, stimulation of HT-29 cells with IL-1β induced IL-8 in an ERK3-dependent manner (Figure 4—figure supplement 3E–3F). However, stimulation of HT-29 with Pam3CSK4 failed to induce IL-8 production, irrespective of the presence or absence of ERK3 protein and activation of p38 MAPK (Figure 4—figure supplement 3G–3H).

Cross-talk between canonical MAPKs and ERK3 in the regulation of IL-8

Activity of ERK1/2 has been implicated to be crucial for epithelial cell differentiation (Aliaga et al., 1999). Moreover, in several experiments, we found that despite the activation of ERK1/2, direct (ERK3 depletion) and indirect (LPS stimulation in HCPECs) downregulation of ERK3 negatively affected IL-8 production. To further explore the role of canonical MAPKs in the regulation of epithelial cell function, we checked for a potential cross-talk between ERK1/2 and ERK3 in controlling IL-8 levels, as several studies unveiled a critical role for classical MAPKs in the production and secretion of CXCL8/IL-8 (Hartman et al., 2017; Lee et al., 2006; Marie et al., 1999). Most of the studies investigating the role of ERK1/2 were employing the MEK1 inhibitor trametinib to evaluate the role of this pathway in mediating several cellular processes. Blocking of the MEK1/2-ERK1/2 pathway by trametinib led to a significant reduction of LPS-induced IL-8 levels in HT-29 cells (Figure 4—figure supplement 4A–B). Interestingly, we observed that treatment with trametinib severely compromised protein levels of ERK3 in HT-29 cells (Figure 4—figure supplement 4A–B) with no significant effect on the ERK3 mRNA levels (Figure 4—figure supplement 4C). Since ERK3 protein abundance played a critical role in IL-8 regulation and trametinib induced the downregulation of ERK3 protein levels, we tested whether the IL-8 decrease observed upon ERK1/2 inhibition was induced by blocked activity of the MEK1/2-ERK1/2 module or by an indirect attenuation of ERK3 protein abundance. To address this issue, HT-29 cells were pre-treated with the proteasome inhibitor MG-132 to prevent proteasomal degradation, prior to trametinib treatment which was followed by LPS stimulation to induce IL-8 production. Systemic block in proteasomal activity with MG-132 led to the accumulation of ERK3 protein and rescued IL-8 levels decreased by MEK inhibitor treatment in both, resting and LPS stimulated HT-29 cells despite inactive ERK1/2 (Figure 4—figure supplement 4D and E). Interestingly, MG-132 treatment itself caused an increase in IL-8 levels comparable with the upregulation obtained by LPS stimulation, while no significant effect was detected in ERK1/2 phosphorylation (Figure 4—figure supplement 4D and E). These data suggest that proteasomal activity is required for the regulation of IL-8 levels and that ERK3 turnover via the proteasomes potentially contributes toward this phenotype in cancer cells.

Functional interplay between ERK4 and MK5 in the regulation of ERK3 and IL-8

We also evaluated the role of ERK4 and MK5, the other related components of the ERK3 signaling module. Our observations indicate while endogenous MK5 positively regulates ERK3 expression, ERK4 exerts opposing effects on ERK3 protein levels (Figure 4—figure supplement 5). As MK5 and ERK4 exert differential effects on ERK3 protein levels, we checked for IL-8 levels in these cells. We observed that IL-8 levels correlated with ERK3 protein levels in MK5- and ERK4-depleted cells (Figure 4—figure supplement 5A–E).

ERK3-mediated regulation of IL-8 is kinase independent

We then investigated if the kinase activity of ERK3 is required for the production and secretion of IL-8. To address this issue, we performed complementation experiments by expressing exogenous ERK3 (WT) and kinase-dead ERK3 (K49A/K50A) in shERK3 cells where the endogenous ERK3 expression is suppressed by an shRNA targeted to the 3’UTR region of the mRNA. Interestingly, expression of WT as well as the kinase-dead version rescued the secretion of IL-8 in at least two different cell lines (Figure 5A–B). Taken together, these results suggested a kinase-independent role for ERK3 in the regulation of IL-8 levels.

Figure 5 with 1 supplement see all

Download asset Open asset

ERK3 regulates levels of IL-8 in a kinase-independent manner and promotes lung metastasis of MDA-MB231 breast cancer cells.

(**A–B**) ERK3 regulates IL-8 production in a kinase-independent manner. (A) MDA-MB231 ERK3 knockdown (shERK3) cells were reconstituted with wild type (ERK3 WT), ERK3 kinase dead mutant (ERK3 K49A K50A) or with an empty vector control (EV). IL-8 levels were determined in obtained supernatants by ELISA. IL-8 concentrations are presented as mean ± SEM in pg/ml from three biological replicates (n = 3); *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. Immunoblot analysis was performed and levels of ERK3 protein were monitored to determine ERK3 knockdown efficiency and the expression of exogenously expressed constructs (V5-Tag expression). Actin and Ponceau S staining were used as loading controls. (B) HeLa control and ERK3-depleted cells were transiently transfected with wild type ERK3, kinase dead mutant K49A K50A and empty vector control. IL-8 levels were measured as described previously and are represented as mean ± SEM concentrations from three biological replicates (n = 3); *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. Knockdown and overexpression efficiency were verified by immunoblot analysis. Actin and Ponceau S staining were used as loading controls. (**C-D**) ERK3 knockdown leads to a decrease in lung metastasis of MDA-MB231 breast cancer cells. Tail-vein injection of control (shCo) or ERK3-depleted (shERK3) MDA-MB231 cells was performed (n = 5). (C) Western blot analysis of MDA-MB231 cells stably transfected with either shRNA targeting ERK3 (shERK3) or control shRNA (shCo). Levels of ERK3 were determined to estimate knockdown efficiency, actin and Ponceau S are provided as loading controls. (D) Representative images of H and E stained lungs sections photographed with Nikon D90 digital camera (H and E stained lung section), marking of the tumor areas performed in ImageJ (marking of the tumor area), boxed areas were magnified and are shown on the right (magnified). (**E-F**) ImageJ quantification was performed using color deconvolution of five sections per lung, representing: (E) the exact numbers of lung tumors per each analyzed section. (F) Pulmonary metastatic burden expressed as percentage of the tumor in evaluated lung tissue (total tumor area/total tissue area); *p<0.05, **p<0.01, ***p<0.001, t-test. Please find Figure 5—figure supplement 1 for graphs representing mean ± SEM per each mouse (n = 5), for both, tumor lesions number and tumor burden.

Figure 5—source data 1 Full membrane scans for western blot images for Figure 5A–C.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig5-data1-v2.pdf
Download elife-52511-fig5-data1-v2.pdf

Depletion of ERK3 reduces metastatic potential of breast cancer cell line MDA-MB231

Next, we evaluated the role of the ERK3-IL-8 axis under pathological conditions like cancer metastasis. Role of IL-8 in tumor progression has been well established (Chan et al., 2017; Long et al., 2016), and high levels of this chemokine are a poor prognostic factor in melanoma, breast, liver, lung and colon cancer (David et al., 2016; Ueda et al., 1994). Previous studies on ERK3 indicated its role in tumorigenesis, including regulation of migratory properties of MDA-MB231 breast cancer cells (Al-Mahdi et al., 2015; Elkhadragy et al., 2018). Similarly, IL-8 has been reported to enhance migration and thus metastasis of breast carcinoma cells MDA-MB231, which also carry a KRAS G13D mutation (Jayatilaka et al., 2017). Considering that ERK3 regulates IL-8 production in many tested cell lines, including MDA-MB231, we investigated the metastatic potential of control (shCo) and ERK3-depleted (shERK3) MDA-MB231 cells (Figure 5C–F). Intravenous (i.v) injection of ERK3-depleted (shERK3) MDA-MB231 cells into the tail vein of immunocompromised mice resulted in less tumor lesions in the lungs and decreased pulmonary metastatic burden (Figure 5E and F, respectively and Figure 5—figure supplement 1). These results demonstrate a critical role of ERK3 in mediating breast cancer cell seeding and lung metastasis.

ERK3 positively regulates activity of IL-8 promoter and DNA binding activity of AP-1

Since ERK3 depletion led to a significant decrease in CXCL8 mRNA expression, we tested whether ERK3 controls promoter activity of IL-8. Gaussia Luciferase (GLuc) promoter reporter assay revealed that the depletion of ERK3 with siRNAs reduced IL-8 promoter activity and consistently IL-8 production in the same cells (Figure 6A–C). To determine which transcription factors are regulated by ERK3 and therefore are responsible for the observed decrease in IL-8 promoter activity in ERK3-depleted cells, we performed a transcription factors (TFs) activity profiling array. As presented in Figure 6—figure supplement 1, ERK3 is required for the activation of the majority of the tested TFs in HCPECs, including AP-1 (Figure 6D) which has been reported to control both, basal and inducible expression of chemokines like IL-8 (Khanjani et al., 2012; O'Hara et al., 2009). These results were further independently validated by employing specific TF activity assays measuring DNA binding activity of three most-potent regulators of IL-8, which apart from AP-1/c-Jun, also involves C/EBP and CREB (Hoffmann et al., 2002; Jundi and Greene, 2015). Our results highlighted AP-1 as one of the TFs positively regulated by ERK3 in HCPECs (Figure 6E and Figure 6—figure supplement 2). Interestingly, in contrast to AP-1, NF-κB activity was increased in the ERK3-depleted HCPECs (Figure 6—figure supplement 3), further implicating AP-1 as the transcription factor primarily contributing to IL-8 in response to ERK3 depletion under these settings (Figure 6E–F).

Figure 6 with 3 supplements see all

Download asset Open asset

ERK3 positively regulates activity of IL-8 promoter and DNA binding activity of AP-1.

(**A–C**) IL-8 promoter activity is decreased in ERK3-depleted cells. MDA-MB231 cells were stably transfected with CXCL8 Gaussia Luciferase construct (Gluc-On Promoter Reporter Clones). Cells were further transfected with siRNA targeting ERK3 (siERK3) or control siRNA (siCo). 24 hr post-transfection, medium was exchanged for DMEM-FBS, cells were cultured for additional 24 hr and supernatants were harvested. (A) Cells were subjected to SDS-PAGE analysis. Knockdown efficiency of ERK3 was monitored. Actin and Ponceau S staining were performed as loading controls. (B) Luciferase activity was monitored and shown here is mean ± SEM fold change in RLU of siERK3 samples normalized to the siCo (n = 3); *p<0.05, **p<0.01, ***p<0.001, paired t-test. (C) IL-8 levels were measured by ELISA and mean ± SEM concentrations in pg/ml are presented from three biological replicates (n = 3); *p<0.05, **p<0.01, ***p<0.001, t-test. (D) TFs activity profiling assay. HCPECs were transfected with either a negative control siRNA (siCo) or siRNA targeting ERK3. 24 hr post-transfection medium was changed for MEM minus FBS and other supplements and cells were stimulated with LPS for 24 hr. After stimulation, cell culture supernatants were harvested from each dish and part of the cells was lysed in RIPA buffer for further western blot analysis and knockdown verification presented in Figure 6—figure supplement 3B. The remaining cells were subjected to nuclear extraction and further TFs activation plate profiling (Figure 6—figure supplement 1 and Figure 6—source data 1). Graph presented in (D) depicts transcriptional activity of AP-1 as fold change in RLU measured by TFs activity profiling array as mentioned in the Materials and methods section. (E) Graphical representation of AP-1 activity measured with filter plate assay according to the manufacturer’s instructions. 24 hr post-transfection, control (siCo) and ERK3 knockdown (siERK3) HCPECs were stimulated with LPS for 24 hr in medium without any supplements. Afterwards, cells were subjected to either western blot analysis or nuclear extraction and filter plate assay analysis. Results are represented as mean fold change in activity measured in RLU ± SEM from four independent experiments (n = 4); *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. (F) ELISA of IL-8 levels measured in control and LPS stimulated siCo/siERK3 HCPECs. Results are depicted as mean concentration (pg/ml)± SEM from three biological replicates (n = 3) per condition; *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. Activity of two other TFs involved in the regulation of IL-8 was assessed in control and ERK3-depleted HCPECs and graphs are presented in Figure 6—figure supplement 2. (**G-H**) LPS-induced AP-1 activity in HT-29 cells is impaired by ERK3 knockout (CRISPR ERK3) which leads to a decrease in IL-8 levels (G) Graph represents AP-1 binding activity analysis by filter plate assay in control (CRISPR Co) and ERK3 knockout (CRISPR ERK3) cells in the presence and absence of LPS. Data are presented as mean fold change in RLU ± SEM from three independent experiments (n = 3); *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. (H) IL-8 concentration in pg/ml is presented as mean ± SEM obtained from three independent experiments (n = 3); *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test.

Figure 6—source data 1 Full membrane scans for western blot images for Figure 6A.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig6-data1-v2.xlsx
Download elife-52511-fig6-data1-v2.xlsx
Figure 6—source data 2 Transcription factors (TFs) activity profiling array. Table represents activity of TF analyzed in control and ERK3-depleted HCPECs.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig6-data2-v2.pdf
Download elife-52511-fig6-data2-v2.pdf

Considering that ERK3 regulates basal activity of AP-1 and thus expression levels of IL-8 in HCPECs, we further tested whether ERK3 is also required for LPS-induced AP-1 activity in HT-29 cells. AP-1 TF filter plate assay revealed that LPS-induced AP-1 DNA binding activity and IL-8 production are dependent on ERK3 protein levels (Figure 6G–H).

ERK3-dependent regulation of AP-1 signaling: LPS-induced nuclear co-localization of ERK3 and c-Jun

In order to uncover the mechanisms underlying the function of AP-1 within the ERK3-IL-8 axis, we tested whether ERK3 forms a complex with c-Jun in HT-29 cells. We detected a complex formation between these two proteins upon LPS stimulation in cells by performing two-way immunoprecipitation (IP) assays with validated antibodies directed against both c-Jun and ERK3 antigens (Figure 7A).

Figure 7 with 1 supplement see all

Download asset Open asset

ERK3 interacts with c-Jun and regulates its nuclear abundance.

(A) Co-immunoprecipitation (IP) of ERK3 and c-Jun in unstimulated and LPS stimulated HT-29 cells using a c-Jun or ERK3 antibody. Levels of c-Jun and ERK3 were monitored. IgG isotype control for IP and co-IP was included. Actin and Ponceau S staining were used as loading controls for total cell lysate western blot analysis. (B) Confocal analysis of IF staining of control (shCo) and ERK3 knockdown (shERK3) HT-29 cells cultured in the presence and absence of LPS. Cells were stained with c-Jun primary antibody followed by rabbit Alexa488 (green), with ERK3 antibody followed by Cy3 mouse secondary (red) and Hoechst for the nuclei. Scale bars 18 µm. Boxed areas in merged images were magnified and are presented on the right. (C) Western blot analysis of control (shCo) and ERK3-depleted (shERK3) HT-29 cells subjected to IF staining presented in C. Levels of ERK3 and c-Jun are depicted in the control and LPS stimulated cells as well as actin loading control and Ponceau S staining. (D) ImageJ quantification of the fluorescence intensities was performed as described in the Materials and methods section. Graph represents mean red (ERK3) fluorescence intensities in control (shCo) and LPS stimulated (shCo+LPS) HT-29 cells; *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. (E) Pearson’s correlation coefficient values obtained from co-localization analyses as described in the Materials and methods section are presented in control (shCo) and ERK3 knockdown cells (shERK3) under -/+ LPS conditions. Scores above 0 indicate a tendency towards co-localization with a perfect co-localization with a score of 1; *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. (F) Mean green fluorescence intensity (c-Jun) was determined in control (shCo) and ERK3-depleted (shERK3) HT-29 cells in the presence and absence of LPS; *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test.

Figure 7—source data 1 Full membrane scans for western blot images for Figure 7A and C.: https://cdn.elifesciences.org/articles/52511/elife-52511-fig7-data1-v2.pdf
Download elife-52511-fig7-data1-v2.pdf

Cell fractionation and immunofluorescence (IF) studies confirmed that while total ERK3 and c-Jun protein levels increase upon LPS stimulation, a significant fraction of ERK3 can be detected in the nuclear compartments, ultimately leading to an enhanced nuclear abundance of c-Jun protein upon stimulation (Figure 7B–D and Figure 7—figure supplement 1). Further, single-cell level analyses revealed a significant nuclear co-localization between ERK3 and c-Jun proteins in both control and LPS stimulated HT-29 cells with Pearson’s correlation coefficient PCC: 0.9172 ± 0.0098 and PCC: 0.9237 ± 0.01 for control and LPS stimulated cells, respectively (mean ± SEM) (Figure 7E). Knockdown of ERK3 expectedly abolished the observed nuclear co-localization (Figure 7B and E) and interestingly further reduced LPS-induced nuclear abundance of c-Jun (Figure 7B and F). These data suggested a critical role for ERK3 in maintaining the nuclear abundance of c-Jun and thus AP-1 activity.

ERK3 maintains transcriptional regulation of epithelial secretome and IL-8 mediated human leukocyte chemotaxis in vitro and in vivo

We next explored the physiological significance of the ERK3-IL-8 signaling pathway by performing chemotaxis experiments in vitro and in vivo, as described in the Materials and methods. Transwell migration experiments involving THP1 cells and human neutrophils revealed that depletion of ERK3 in the epithelial cells leads to a significant reduction in the chemotaxis of these leukocytes (Figure 8A–B). We then performed similar experiments in vivo by injecting the secretome of control or ERK3-depleted HCPECs into the peritoneal cavity of mice as presented in the experimental scheme (Figure 8C). Consistent with the observations we made in vitro, injection of the supernatants obtained from ERK3-depleted HCPECs (siERK3 supernatant) resulted in significantly reduced migration of granulocytes and monocytes to the intraperitoneal cavity in comparison to the controls (Figure 8D–E), while not exerting any significant effect on the lymphocytes recruitment (Figure 8F). To further reaffirm the role of IL-8 in mediating the chemotaxis of leukocytes, we employed an IL-8 neutralizing antibody. As shown in Figure 8A and B, the presence of the IL-8 antibody decreased the migration of neutrophils and THP1 cells. Moreover, neutralization antibody incubation indicated that the observed decrease in the chemotaxis is mediated by IL-8, as there is an additive effect between untreated and antibody treated variant within each condition (Control-Control+IL-8 Ab and ERK3 KD-ERK3 KD+IL-8 Ab). Importantly, although mice lack the IL-8 encoding gene, they do express a receptor analogous to human CXCR2, which in response to human IL-8 mediates neutrophil chemotaxis (Singer and Sansonetti, 2004). As expected, intraperitoneal injection of human recombinant IL-8 into mice significantly attracted leukocytes confirming the crucial role for IL-8 in this process (Figure 8D–F).

Figure 8 with 1 supplement see all

Download asset Open asset

ERK3 regulates epithelial secretome and IL-8-mediated chemotaxis of human neutrophils and monocytes in vitro and in vivo.

(**A–B**) In vitro migration of (A) neutrophils and (B) THP1 cells toward epithelium. CellTracker Green-stained cells were placed in the upper chamber of the transwell plate and supernatants obtained from control and ERK3-depleted HCPECs or HT-29 cells were placed in the lower chamber. IL-8 neutralizing antibody was used in each condition as a control. Following 2 hr incubation at 37°C, migration of neutrophils or THP1 cells to the lower chamber was measured using fluorescence. Fold change of Relative Fluorescence Units (RFU) was then calculated. Data represent mean ± SEM of three biological replicates (n = 3); *p<0.05, **p<0.01, ***p<0.001, one-way ANOVA, Turkey’s post-test. (**C–F**) Effect of ERK3-depleted epithelial supernatants on intraperitoneal leukocytes migration in vivo. The experimental procedure is explained in detail in Materials and methods. Briefly, groups of five 8-week-old C57BL/6J female mice were injected intraperitoneally (i.p) with one of the following: MEM without supplements (MEM control), MEM containing 900 ng of human recombinant CXCL8/IL-8 (rhCXCL8/IL-8), HCPEC siCo/siERK3-derived concentrated supernatants. 4 hr post-injections mice were sacrificed and peritoneal white blood cells populations were harvested by peritoneal lavage. (**D–F**) Scatter plots representing absolute number of (D) granulocytes, (E) monocytes and (F) lymphocytes. Data are represented as mean ± SEM, n = 5; *p<0.05, **p<0.01, ***p<0.001, t-test.

Previous studies showed that IL-8 upregulates intercellular adhesion molecule-1 (ICAM-1) in HT-29 cells, thus promoting neutrophil-epithelium cell adhesion (Kelly et al., 1994). Moreover, studies on epithelial cells revealed that secreted IL-8 enhances the expression of CD11/CD18 adhesion receptors by neutrophils, which enables the migration by promoting the interaction of the receptors with ICAM-1 (Kelly et al., 1994). Interestingly, in addition to IL-8, ERK3 also positively regulates ICAM-1 mRNA expression as revealed by the RNAseq analysis (Figure 8—figure supplement 1).

These results unveil ERK3 as a novel interacting partner of c-Jun and regulator of AP-1 activity and confirm the crucial role for the ERK3-IL-8 signaling axis in mediating epithelial chemotaxis both in vitro and in vivo (Figure 9).

Figure 9

Download asset Open asset

Schematic representation depicting the role of ERK3 in chemotaxis.

ERK3 interacts with c-Jun and by regulating its nuclear abundance controls DNA-binding activity of AP-1 TF, which is critically required for the activation of several cytokines, including IL-8 that contribute to the chemotaxis of leukocytes to the epithelium in response to LPS and other innate immune stimuli.

Discussion

MAPKs are members of a highly conserved kinase family, and the role of classical MAPKs in regulating innate immune responses is well documented (Arthur and Ley, 2013; Marie et al., 1999; Newton and Dixit, 2012). The intestinal epithelium serves as the first line of defence against pathogen entry and bacteria-derived products like LPS trigger TLR signaling, leading to the production of cytokines and chemokines that attract immune cells to the site of infection, thus initiating local inflammation (Abreu et al., 2002; Cario and Podolsky, 2000; Kawai and Akira, 2010; Mogensen, 2009; Sallusto and Baggiolini, 2008; Singer and Sansonetti, 2004). While the classical MAPKs have been shown to be activated and required for innate immune responses, the role of atypical MAPKs remains understudied.

This study demonstrates a role for ERK3 in regulating epithelial secretome and LPS-mediated immune responses. Although ERK3 protein levels alter during epithelial differentiation (Figure 1), loss-of-function studies revealed that ERK3 is probably not required for the establishment and maintenance of human gastric epithelium (Figure 4I–J). However, incorporation of the HGOs confirmed that depletion of ERK3 causes a decrease in CXCL8/IL-8 secretion by epithelial cells (Figure 4K). We observed that LPS treatment affected ERK3 protein stability in a cell-type-dependent manner. While LPS led to an enhanced ERK3 protein stability in oncogenic cells, opposing effects were observed in human primary colonic epithelial cells (Figure 2). Unlike the tumorigenic HT-29 cells, primary cells express low levels of TLR4 (Figure 2—figure supplement 2). Whether this discrepancy contributes to the effects observed on ERK3 protein levels remains unclear (Cario and Podolsky, 2000; Tang et al., 2010). Interestingly, upregulation of TLR4 is associated with inflammatory bowel diseases like ulcerative colitis (Cario and Podolsky, 2000; Fan and Liu, 2015; Tang et al., 2010). Moreover, observed discrepancies in responsiveness to LPS between colon carcinoma and primary epithelial cells can be further explained by previous studies describing upregulation of TLR4 in colorectal cancer, including HT-29 cells (Abreu et al., 2002; Furrie et al., 2005). Published observations indicate that LPS-TLR4 signaling results in tumor progression and metastasis (Gross et al., 1995; Tang et al., 2010; Yesudhas et al., 2014). Intestinal epithelium is constantly exposed to significant levels of luminal LPS and the low expression of TLR4 by HCPECs might provide an explanation why they can tolerate LPS and maintain hyporesponsiveness toward luminal bacteria (Otte et al., 2004). It is tempting to hypothesize that LPS triggers alterations in the ubiquitin signaling machinery contributing to ERK3 ubiquitination and degradation, leading to the attenuation of IL-8 production and inflammation in primary epithelium. While Usp20 has been shown to function as a DUB for ERK3, the E3 ubiquitin ligase of ERK3 is not known (Mathien et al., 2017). Also, the kind of ubiquitin chains synthesized on ERK3 in response to LPS deserves further investigations.

In order to gain more insight into the immune stimuli-dependent ERK3 kinetics in intestine epithelial cells, we tested two other TLR ligands, Pam3CSK4 (for TLR1/2) and R848 (for TLR7/8) as well as IL-1β. These experiments revealed that ERK3 is required in a stimulus- and cell-type-dependent manner for the production of IL-8. Further studies are warranted to uncover the underlying mechanisms contributing to these discrepancies. However, ERK3 is critically required for basal as well as LPS-induced IL-8 levels in both primary and tumor cells. IL-8 was first discovered as a leukocyte chemotactic factor and since then emerged as a double-edged sword of inflammation (Beck et al., 2016; Hammond et al., 1995; Long et al., 2016; Sallusto and Baggiolini, 2008; Singer and Sansonetti, 2004). Further, IL-8 has emerged as a crucial factor in mediating tumor angiogenesis, tumor cell survival and metastasis (David et al., 2016; Feng et al., 2018; Itoh et al., 2005; Li et al., 2003; Waugh and Wilson, 2008; Xu and Fidler, 2001). Loss-of-function studies in multiple cell lines confirmed the obligatory role for ERK3 in controlling IL-8 levels and several other chemokines and cytokines including CCL2, CXCL6 or adhesion molecules like ICAM-1 in HCPECs. Consequently, CRISPR/Cas9 knockout of ERK3 negatively affected secretion of CXCL8/IL-8 in human gastric organoids. Depletion of ERK3 from MDA-MB231 cells significantly inhibited breast cancer lung metastasis burden in mice (Figure 5C–F and Figure 5—figure supplement 1). These data suggest a crucial role for ERK3 in IL-8-mediated tumor progression and metastasis formation by regulating critical factors like CXCL8/IL-8.

Intriguingly, the effect is kinase-independent and we demonstrated that ERK3 controls the transcription factor AP-1/c-Jun in both, HCPECs and HT-29 cells (Figure 6D–E and Figure 6G, respectively). We further observed that ERK3-AP-1 activity directly correlates with IL-8 levels in both normal and transformed cells (Figure 6E–F and G–H, respectively).

In order to activate target genes, transcription factors such as c-Jun have to translocate to the nucleus (Schreck et al., 2011). Our studies revealed that ERK3 is required for nuclear abundance of c-Jun protein (Figure 7B and F). We provide evidence that ERK3 interacts with c-Jun and regulates the DNA-binding activity of AP-1 (Figure 6D–E and G and Figure 7) which might reflect a non-catalytic scaffolding function described for other kinases as well (Rauch et al., 2011). Activated JNK translocates to the nucleus, where it can phosphorylate c-Jun at S63/73 and T91/93, which in turn enables c-Jun homodimerization or heterodimerization with c-Fos (Deng and Karin, 1994; Gazon et al., 2017). Nevertheless, JNK controls c-Jun activity by sub-nuclear localization of AP-1 proteins (Gazon et al., 2017), therefore it is tempting to propose ERK3 as a novel MAPK required for the nuclear abundance of c-Jun. Whether ERK3 directly interacts with c-Jun and influences the stoichiometry of the AP-1 complex needs further studies.

ERK3 has already been reported to be constitutively localized to both, cytoplasmic and nuclear compartments (Julien et al., 2003), but its subcellular localization has been shown not to be affected by any of the common MAPKs activating stimuli (Julien et al., 2003). Here, we demonstrate that LPS stimulation triggers the accumulation of ERK3 protein, resulting in its enhanced expression in both, cytoplasm and nucleus (Figure 7B–D and Figure 7—figure supplement 1).

Furthermore, we consistently observed that loss of ERK3 inhibited IL-8 production and secretion in multiple cell types - despite the activation of classical MAPKs and NF-κB. Interestingly, NF-κB activity was increased upon ERK3 knockdown as indicated by TF activity profiling assay as well as by measuring IκBα degradation (Figure 6—figure supplement 3A and B, respectively), which is contradictory to the observed decrease in IL-8 production (Figure 6F). Worth mentioning is that LPS stimulation led to a downregulation of NF-κB activity in ERK3-depleted cells (Figure 6—figure supplement 3A), which surprisingly had no additive effect on neither protein (Figure 6F) nor mRNA (Figure 4—figure supplement 1A) levels of CXCL8/IL-8. The possible cross-talk between ERK3 and NF-κB deserves further investigations.

We were able to observe that inhibition of MEK1 with trametinib reduces the protein stability of ERK3 and thus the published results claiming a unique role for the classical MAPK in the production of IL-8 needs to be evaluated with caution. Our data suggest an obligatory and synergistic role for ERK3 in mediating LPS-induced chemokines. We also evaluated the role of ERK4 and MK5 in the regulation of ERK3 and IL-8. It is not clear if the heteromerization between these kinases is contributing to their protein stability.

While verifying the role of ERK3 in the regulation of CXCL8/IL-8, we uncover that ERK3 interacts with c-Jun and regulates AP-1 activity, which directly contributes to the high basal and LPS-mediated IL-8 levels in HCPECs and HT-29 cells, respectively. Although HCPECs and HT-29 cells respond differently to LPS, mechanisms regulating IL-8 in both cell types are ERK3-AP-1 dependent and the decrease in expression of ERK3 directly correlates with IL-8 levels. Taken together, these data present one of the first physiological roles for this understudied MAPK and unveil a critical role for ERK3-IL-8 signaling axis in regulating epithelial function and chemotaxis, which is critical for mediating inflammation and tumorigenesis.

Materials and methods

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Cell line (Homo sapiens)	HT-29	ATCC	ATCC HTB-38
Cell line (Homo sapiens)	Human Colonic Primary Epithelial Cells (HCPECs)	ATCC	CCD 841 CoN, ATCC–CRL-1790
Cell line (Homo sapiens)	CaCo2	kind gift from Prof. Monilola Olayioye (University of Stuttgart)
Cell line (Homo sapiens)	MDA-MB231	DSMZ	ACC 732
Cell line (Homo sapiens)	THP1	DSMZ	ACC 16
Cell line (Homo sapiens)	293 T cells	kind gift from Dr. Andreas Ernst (Goethe-University Frankfurt am Main, IBC2)
Chemical compound, drug	LPS	Sigma	Cat# L6143	Working concentration: 200 ng/ml
Chemical compound, drug	Human recombinant IL-1β	ImmunoTools	Cat# 11340013	Working concentration: 10 ng/ml
Chemical compound, drug	Pam3CSK4 TLR1/2 ligand	InvivoGen	Cat# tlrl-pms	Working concentration: 20 µg/ml
Chemical compound, drug	R848 TLR7/8 ligand	InvivoGen	Cat# tlrl-r848	Working concentration: 2.5 µg/ml
Chemical compound, drug	Cycloheximide (CHX)	Sigma	Cat# C-7698	Working concentration: 100 µg/ml
Chemical compound, drug	MG-132 inhibitor	Calbiochem, Merck Millipore	Cat# 474790	Working concentration: 10 µM
Chemical compound, drug	Selective MEK1/2 inhibitor trametinib GSK1120212	Selleckchem	Cat# S2673	Working concentration: 1 µM
Sequence-based reagent-shRNA	shMAPK6#1 (shERK3#1) NM_002748.x-3734s1c1	MISSION shRNA Human Library (Sigma)	TRCN0000001568	Sequence: CCGGGCTGTCCACGTACTTAATTTACTCGAGTAAATTAAGTACGTGGACAGCTTTTT
Sequence-based reagent-shRNA	shMAPK6#2 (shERK3#2) NM_002748.x-1564s1c1	MISSION shRNA Human Library (Sigma)	TRCN0000001569	Sequence: CCGGGACATGACTGAGCCACACAAACTCGAGTTTGTGTGGCTCAGTCATGTCTTTTT
Sequence-based reagent-shRNA	shMAPK6#3 (shERK3#3) NM_002748.x-798s1c1	MISSION shRNA Human Library (Sigma)	TRCN0000001570	Sequence: CCGGTGATCTGGGTTCTAGGTATATCTCGAGATATACCTAGAACCCAGATCATTTTT
Sequence-based reagent-shRNA	shMAPKAPK5#1 (shMK5#1) NM_003668.2–475 s1c1	MISSION shRNA Human Library (Sigma)	TRCN0000194823	Sequence: CCGGCCCAAACATAGTTCAGATTATCTCGAGATAATCTGAACTATGTTTGGGTTTTTTG
Sequence-based reagent-shRNA	shMAPKAPK5#5 (shMK5#5) NM_003668.x-1622s1c1	MISSION shRNA Human Library (Sigma)	TRCN0000000682	Sequence: CCGGGAAATTGTGAAGCAGGTGATACTCGAGTATCACCTGCTTCACAATTTCTTTTT
Sequence-based reagent-shRNA	shMAPK4#1 (shERK4#1) NM_002747.x-3808s1c1	MISSION shRNA Human Library (Sigma)	TRCN0000001374	Sequence: CCGGCTCACACCACACGCCTTAAATCTCGAGATTTAAGGCGTGTGGTGTGAGTTTTT
Sequence-based reagent-shRNA	shMAPK4#2 (shERK4#1) NM_002747.x-1105s1c1	MISSION shRNA Human Library (Sigma)	TRCN0000001375	Sequence: CCGGACTACACCAAAGCCATCGACACTCGAGTGTCGATGGCTTTGGTGTAGTTTTTT
Sequence-based reagent-shRNA	shMAPK4#5 (shERK4#5) NM_002747.x-1017s1c1	MISSION shRNA Human Library (Sigma)	TRCN0000001378	Sequence: CCGGGATCAGCATTACTCCCACAAGCTCGAGCTTGTGGGAGTAATGCTGATCTTTTT
Sequence-based reagent-siRNA	siMAPK6#1 (siERK3#1)	FlexiTube siRNA, Hs_MAPK6_5 Qiagen	Cat# SI00606025	Sequence: AGUUCAAUUUGAAAGGAAATT
Sequence-based reagent-CRISPR/Cas9	CRISPR ERK3	designed by Rule Set 2 of Azimuth 2.0 as described previously (Doench et al., 2016)		Selected gRNAs sequence: #1 5’-CACCGAGCCAATTAACAGACGATGT-3’ #2 5’-CACCGATACTTGTAACTACAAAACG-3’ #3 5’-CACCGCTGCTGTTAACCGATCCATG-3’
Recombinant DNA reagent-cDNA	ERK3 K49A K50A kinase dead mutant	Site-directed mutagenesis		Primers sequence: frw_5’ GCAATTGTCCTTACTGATCCCCAGAGTGTC, rev_5’ CGCGATGGCTACTCTTTTGTCACAGTC
Commercial assay, kit	Human IL-8 ELISA Ready-SET-Go! Kit	eBioscience	Cat# 88–8086
Commercial assay, kit	Cell Fractionation Kit	Invent Biotechnologies	Cat# SM-005
Commercial assay, kit	RayBiotech L-Series Human Antibody Array 1000	Tebu-Bio	Cat# AAH-BLG-1000
Commercial assay, kit	Nuclear Extraction Kit	Signosis	Cat# SK-0001
Commercial assay, kit	TF Activation Profiling Plate Array I	Signosis	Cat# FA-1001
Commercial assay, kit	Transcription factor Filter Plate Assay AP-1 probe	Signosis	Cat# FA-0004
Commercial assay, kit	Transcription factor Filter Plate Assay C/EBP probe	Signosis	Cat# PP-0011
Commercial assay, kit	Transcription factor Filter Plate Assay CREB probe	Signosis	Cat# PP-0015
Commercial assay, kit	CXCL8-Gaussia Luciferase GLuc-ON promoter reporter clone	Genecopoeia	Cat# HPRM15772
Antibody	Human CXCL8/IL-8 neutralizing antibody	R and D	Cat# MAB208	In vitro/in vivo chemotaxis experiments 2.8 ng/µl used for neutralization
Antibody	Rabbit anti-phospho-ERK3 (pSer189)	Sigma	Cat# SAB4504175	WB 1:500
Antibody	Rabbit anti-ERK3	Cell Signaling Technology	Cat# 4067	WB 1:500
Antibody	Rabbit anti- MK5/MAPKAPK5 (D70A10)	Cell Signaling Technology	Cat# 7419	WB 1:500
Antibody	Rabbit anti-V5-tag	Cell Signaling Technology	Cat# 13202	WB 1:500
Antibody	Rabbit anti-p44/42 MAPK (ERK1/2)	Cell Signaling Technology	Cat# 9102	WB 1:1000
Antibody	Rabbit anti-phospho-p44/42 MAPK (ERK1/2) (Thr202/Tyr204)	Cell Signaling Technology	Cat# 9101L	WB 1:1000
Antibody	Rabbit anti-phospho-p38 MAPK (Thr180/Tyr182)	Cell Signaling Technology	Cat# 9215	WB 1:500
Antibody	Rabbit anti-p38 MAPK antibody	Cell Signaling Technology	Cat# 9212	WB 1:500
Antibody	Rabbit anti-IκBα (44D4)	Cell Signaling Technology	Cat# 4812	WB 1:500
Antibody	Rabbit anti-phospho-SAPK/JNK (183/Y185)	Cell Signaling Technology	Cat# 9251	WB 1:500
Antibody	Normal Rabbit IgG	Cell Signaling Technology	Cat# 2729	Used as a control for IP
Antibody	Rabbit anti-c-Jun (60A8)	Cell Signaling Technology	Cat# 9165	WB 1:500 IF 1:400
Antibody	Rabbit anti-Histone H3 (D1H2)	Cell Signaling Technology	Cat# 4499	WB 1:500
Antibody	Mouse anti-M2-PK antibody	Schebo Biotech AG	Cat# S-1	WB 1:500
Antibody	Rabbit anti-MAPK4 (ERK4)	Abcam	Cat# ab211501	WB 1:500
Antibody	Rabbit anti-PRAK/MK5 (phospho T182) antibody	Abcam	Cat# ab138668	WB 1:500
Antibody	Anti-β-actin HRP conjugated	Abcam	Cat# ab49900	WB 1:40 000
Antibody	Mouse, anti-Keratin 20 (Krt20)	Agilent Dako	Cat# M701929	WB 1:1000
Antibody	Mouse anti-GAPDH antibody	GeneTex	Cat# GTX627408	WB 1:1000
Antibody	Mouse anti-α-tubulin antibody	GeneTex	Cat# GTX628802	WB 1:1000
Antibody	Mono- and polyubiquitin conjugates monoclonal HRP-coupled antibody (FK2)	Enzo	Cat# BML-PW8810	WB 1:250
Antibody	HRP-conjugated secondary antibody for rabbit IgG	Invitrogen	Cat# A16096	WB 1:40 000
Antibody	HRP-conjugated secondary antibody for rabbit IgG	Invitrogen	Cat# 32460	WB 1:2000
Antibody	HRP-conjugated secondary antibody for mouse IgG	GE Healthcare Life Sciences	Cat# NA9310	WB 1:20 000
Antibody	Anti-ERK3	R and D	Cat# MAB3196	IF 1:400
Antibody	Goat anti-rabbit IgG-Alexa 488	Thermo Fisher Scientific	Cat# A11008	IF, working concentration: 5 µg/ml
Antibody	Goat anti-mouse IgG-Cyanine3	Thermo Fisher Scientific	Cat# A10521	IF, working concentration: 2D cultures: 5 µg/ml 3D cultures: 8 µg/ml
Chemical compound, drug	DNA dye Hoechst 33342	Thermo Fisher Scientific	Cat# H3570	IF, working concentration: 10 µg/ml
Sequence-based reagent	qRT-PCR primers human ERK3	Sigma	Frw_5’ ATGGATGAGCCAATTTCAAG Rv_5’ CTGACAATCATGATACCTTTCC
Sequence-based reagent	qRT-PCR primers human CXCL8#1	Sigma	Frw_5’ GAGCACTCCATAAGGCACAAA Rv_5’ ATGGTTCCTTCCGGTGGT
Sequence-based reagent	qRT-PCR primers human CXCL8#3	Sigma	Frw_5’ TGTAAACATGACTTCCAAGC Rv_5’ AAAACTGCACCTTCACAC
Sequence-based reagent	qRT-PCR primers human IL16	Sigma	Frw_5’ CAGTGTTAATCCCTATTGCAC Rv_5’ ATTGTTGAGAGAGGGACTTC
Sequence-based reagent	qRT-PCR primers human CXCL6	Sigma	Frw_5’ CCTCTCTTGACCACTATGAG Rv_5’ GTTTTGGGGTTTACTCTCAG
Sequence-based reagent	qRT-PCR primers human TLR4	Sigma	Frw_5’ TGGAGGTGTGAAATCCAG Rv_5’ CTTGATAGTCCAGAAAAGGC
Sequence-based reagent	qRT-PCR primers housekeeping human 18 s	Sigma	Frw_5’ AGAAACGGCTACCACATCCA Rv_5’ CACCAGACTTGCCCTCCA
Sequence-based reagent	qRT-PCR primers housekeeping human GAPDH	Sigma	Frw_5’ CGACAGTCAGCCGCATCTT Rv_5’ CCCCATGGTGTCTGAGCG
Sequence-based reagent	qRT-PCR primers human GKN1	Sigma	Frw_ 5’ agctcctgccctagctaactataa Rv_ 5’ ttgtgttcattgttgacactcact	Used for HGOs qRT-PCR experiments
Sequence-based reagent	qRT-PCR primers human ERK3	Sigma	Frw_ 5’ tcgatgagtcggagaagtcc Rv_ 5’ gaagatgtcttttgttagtgatcaggt	Used for HGOs qRT-PCR experiments
Sequence-based reagent	qRT-PCR primers mouse Alpi	Sigma	Frw_ 5’ AGGATCCATCTGTCCTTTGGT Rv_ 5’ TTCAGCTGCCTTCTTGTTCC	Used for MCOs qRT-PCR experiments
Sequence-based reagent	qRT-PCR primers mouse Krt20	Sigma	Frw_ 5’ agtcccacctcagcatgaa Rv_ 5’ gagctcagcatctcctggat	Used for MCOs qRT-PCR experiments
Sequence-based reagent	qRT-PCR primers mouse Erk3	Sigma	Frw_ 5’ acgacatgactgagccacac Rv_ 5’ TCTGCTCCAGGAAATCCAGT	Used for MCOs qRT-PCR experiments
Sequence-based reagent	qRT-PCR primers housekeeping mouse Gapdh	Sigma	Frw_ 5’ GTGCCAGCCTCGTCC Rv_ 5’ ACCCCATTTGATGTTAGTGG	Used for MCOs qRT-PCR experiments
Software, algorithm	ImageJ	RRID:SCR_003070	RRID:SCR_003070 https://imagej.net/	Used for WB quantification and IF staining analyses
Software, algorithm	ImageJ Coloc2 Plugin	Self-modified version as described by French et al. (2008).	Self-modified version of ImageJ RRID:SCR_003070	Used to quantify Fluorescence co-localizations c-Jun and ERK3
Software, algorithm	Fiji	RRID:SCR_003070	Fiji (RRID:SCR_002285)http://fiji.sc	Used for IF images visualization

Share this article

Cite this article

Role of ERK3 in gastrointestinal organoids morphogenesis and differentiation.

Figure 1—source data 1

Effect of LPS on ERK3 expression and protein stability.

Figure 2—source data 1

RNA sequencing analysis of control and ERK3 knockdown HCPECs.

Figure 3—source data 1

Figure 3—source data 2

Figure 3—source data 3

Figure 3—source data 4

ERK3 regulates levels of IL-8 and other chemokines.

Figure 4—source data 1

ERK3 regulates levels of IL-8 in a kinase-independent manner and promotes lung metastasis of MDA-MB231 breast cancer cells.

Figure 5—source data 1

ERK3 positively regulates activity of IL-8 promoter and DNA binding activity of AP-1.

Figure 6—source data 1

Figure 6—source data 2

ERK3 interacts with c-Jun and regulates its nuclear abundance.

Figure 7—source data 1

ERK3 regulates epithelial secretome and IL-8-mediated chemotaxis of human neutrophils and monocytes in vitro and in vivo.

Schematic representation depicting the role of ERK3 in chemotaxis.

Author details

Katarzyna Bogucka

Contribution

Competing interests

Malvika Pompaiah

Contribution

Competing interests

Federico Marini

Contribution

Competing interests

Harald Binder

Contribution

Competing interests

Gregory Harms

Contribution

Competing interests

Manuel Kaulich

Contribution

Competing interests

Matthias Klein

Contribution

Competing interests

Christian Michel

Contribution

Competing interests

Markus P Radsak

Contribution

Competing interests

Sebastian Rosigkeit

Contribution

Competing interests

Peter Grimminger

Contribution

Competing interests

Hansjörg Schild

Contribution

Competing interests

Krishnaraj Rajalingam

Contribution

For correspondence

Competing interests

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Categories and tags

Research organisms

Further reading