1. Cell Biology
  2. Developmental Biology

Caenorhabditis elegans PIEZO channel coordinates multiple reproductive tissues to govern ovulation

  1. Xiaofei Bai
  2. Jeff Bouffard
  3. Avery Lord
  4. Katherine Brugman
  5. Paul W Sternberg
  6. Erin J Cram
  7. Andy Golden  Is a corresponding author
  1. National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, United States
  2. Department of Bioengineering, Northeastern University, United States
  3. Department of Biology, Northeastern University, United States
  4. Division of Biology and Biological Engineering, California Institute of Technology, United States
https://doi.org/10.7554/eLife.53603
Share this article
Cite this article
  1. Xiaofei Bai
  2. Jeff Bouffard
  3. Avery Lord
  4. Katherine Brugman
  5. Paul W Sternberg
  6. Erin J Cram
  7. Andy Golden
(2020)
Caenorhabditis elegans PIEZO channel coordinates multiple reproductive tissues to govern ovulation
eLife 9:e53603.
https://doi.org/10.7554/eLife.53603
  2. Download BibTeX
  3. Download .RIS
10 figures, 7 videos, 2 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
pezo-1 is widely expressed in C. elegans.

(A) Two fluorescent reporter genes were knocked-in to both N-terminus and C-terminus of pezo-1. (B) GFP::PEZO-1 is strongly expressed in multiple mechanosensitive tissues, such as the …

Figure 1—source data 1

Number of independent samples were collected for pezo-1 expression pattern in C. elegans.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig1-data1-v3.xlsx
Figure 1—figure supplement 1
Download asset Open asset
PEZO-1 is expressed in multiple tissues throughout development.

(A) There are 14 mRNA isoforms encoded by pezo-1. Isoforms i-l encode the six short forms of pezo-1 (red asterisks). The 5′−3′ orientation is right to left. (B–G) Both PEZO-1::mScarlet (magenta) and …

Figure 2 with 1 supplement
Download asset Open asset
Deletions of the pezo-1 gene cause a reduction in brood size.

(A) Brood size was significantly reduced in both pezo-1 NΔ and pezo-1 CΔ animals when compared with wildtype, and this reduction was most evident in older adult animals. (B) The percentage of viable …

Figure 2—source data 1

Quantification data describing brood size, the percentage of viable embryos and sperm counts of pezo-1 mutants compared with wild-type.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig2-data1-v3.xlsx
Figure 2—figure supplement 1
Download asset Open asset
Verification of CRISPR/Cas9-generated deletions in pezo-1 knockout animals.

(A) Representative PCR gel from genotyping single animals for pezo-1 C∆ knockout candidates. A positive homozygous knockout line is labeled with a red asterisk. Three primers (two that flank the …

Figure 2—figure supplement 1—source data 1

Quantification data describing brood size and the percentage of viable embryos of pezo-1 mutants compared with wild-type.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig2-figsupp1-data1-v3.xlsx
Figure 3
Download asset Open asset
PEZO-1 mutants exhibit severe ovulation defects.

(A–E) Ovulation in wildtype animals. (A, B) Ovulation is initiated by oocyte (yellow dotted circle) entry into the spermatheca, which was labelled by the apical junctional marker DLG-1::GFP (green). …

Figure 3—source data 1

Number of independent samples were collected for imaging ovulation defects in pezo-1 mutants.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig3-data1-v3.xlsx
Figure 4
Download asset Open asset
pezo-1 mutants show genetic interactions with cytosolic Ca2+ regulators.

(A) itr-1 (RNAi) reduced the brood size in pezo-1 CΔ animals. (B) By contrast, lfe-2 (RNAi) slightly rescued the smaller brood size in pezo-1 CΔ animals. (C) Depletion of both orai-1 and sca-1 by …

Figure 4—source data 1

Quantification of brood size for genetic interaction of pezo-1 mutants with RNAi depletion of calcium regulators.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig4-data1-v3.xlsx
Figure 5 with 1 supplement
Download asset Open asset
PEZO-1 mutants show normal GCaMP3 fluorescence during ovulation.

(A–E) mScarlet::PEZO-1 colocalizes with GCaMP3, which is driven by a spermatheca-specific promoter. These images represent the third ovulation for this spermatheca. (F–J′) Time series frames from …

Figure 5—source data 1

Quantification of calcium metrics in pezo-1 mutants and wild-type.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig5-data1-v3.xlsx
Figure 5—figure supplement 1
Download asset Open asset
Normal calcium signaling was observed in the spermathecal cells in pezo-1 mutants.

(A, B) GCaMP3 time series of normalized average pixel intensity from a single oocyte transit recording over the same spatial frame and time. (C) Heat map of GCaMP3 normalized average pixel intensity …

Figure 6 with 1 supplement
Download asset Open asset
Male sperm rescue the ovulation defects in pezo-1 mutants.

(A) Both pezo-1 C∆ and N∆ males are fertile and sire progeny when mated with fem-1(hc17ts) mutants (essentially female animals). (B) Mating with male sperm rescued fertility in Day 3 pezo-1 CΔ …

Figure 6—source data 1

Quantification of sire progeny in different mating assays.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig6-data1-v3.xlsx
Figure 6—figure supplement 1
Download asset Open asset
Male sperm rescue the fecundity in pezo-1 CΔ female.

(A) Brood size was significantly reduced in pezo-1 CΔ females when compared with fem-1(hc17) females only at permissive temperature (15°C). (B) Quantification of Mito-tracker-stained male sperm in …

Figure 6—figure supplement 1—source data 1

Quantification of sire progeny and sperm count in different mating assays.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig6-figsupp1-data1-v3.xlsx
Figure 7
Download asset Open asset
Sperm guidance and navigation is disrupted in pezo-1 mutants.

(A) To quantify sperm migration, this illustration indicates the three zones that were scored for sperm distribution. Zone 3 is the spermatheca region and the space containing the +1 fertilized …

Figure 7—source data 1

Quantification of sperm count in sperm distribution assays.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig7-data1-v3.xlsx
Figure 8 with 3 supplements
Download asset Open asset
Tissue-specific degradation of PEZO-1 causes a reduced brood size and sperm navigational defects.

(A) Schematic of the auxin-inducible degradation (AID) system. A degron tag was inserted at the 3′ end of the pezo-1 coding sequence using CRISPR/Cas9-mediated editing. (B) The eft-3 promoter was …

Figure 8—source data 1

Quantification of brood size and sperm counts in each AID strain.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig8-data1-v3.xlsx
Figure 8—figure supplement 1
Download asset Open asset
Expression pattern of tir-1::mRuby in reproductive tissues.

(A–A′′) The eft-3 promoter was used to drive TIR-1 expression in most or all somatic tissues, including the spermatheca but not in the sperm [dotted circles in lower part of panel (A)]. Strong GFP …

Figure 8—figure supplement 2
Download asset Open asset
Tissue-specific degradation of PEZO-1 displays a reduced GFP::PEZO-1 fluorescence in each tissue expressing tir-1::mRuby.

(A–A′′) GFP::PEZO-1::Degron localized to reproductive tissues, such as the plasma membrane of the germline cells, oocyte, somatic sheath cells (yellow arrow, A, A′′), spermatheca (yellow arrow, A, …

Figure 8—figure supplement 2—source data 1

Quantification of the fluorescent intensity of GFP-PEZO-1::Degron at different conditions.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig8-figsupp2-data1-v3.xlsx
Figure 8—figure supplement 3
Download asset Open asset
Somatic-tissue specific degradation of PEZO-1 causes severe ovulation defects.

(A–H) Abnormal ovulations were observed in the somatic-tissue-specific PEZO-1::Degron animals. Two different ovulation events are shown. (A, E) Ovulation initiated by oocyte (yellow dotted circle) …

Figure 9
Download asset Open asset
The PIEZO1 disease allele causes severe brood size reduction in C. elegans.

(A) Sequence alignment showing arginine 2405 (R2405) in C. elegans PEZO-1 is highly conserved with human and mouse PIEZO1 and PIEZO2. (B) A conserved patient-specific allele, pezo-1(R2405P), was …

Figure 9—source data 1

Quantification of brood size in mutants for the patient-specific allele pezo-1(R2405P) and the genetic interaction of pezo-1(R2405P) with the RNAi depletion of calcium regulators.

https://cdn.elifesciences.org/articles/53603/elife-53603-fig9-data1-v3.xlsx
Figure 10
Download asset Open asset
Working model for PEZO-1 during ovulation.

Step One: PEZO-1 regulates somatic sheath cells and the spermathecal distal valve to push the oocyte into the spermatheca. Once a matured oocyte is ready for ovulation, PEZO-1 (red trapezoids) on …

Videos

Video 1
Download asset
PEZO-1 expression pattern during ovulation.

Ovulation imaged in the genome-edited animals expressing GFP::PEZO-1 (green). The yellow arrow in the right panel indicates GFP::PEZO-1 expression on the spermathecal valves. White arrows in the righ…

Video 2
Download asset
Crushed oocyte phenotype frequently occurs in the pezo-1 CΔ mutant.

Time-lapse video recording showing a wildtype oocyte (top panel) entering into the spermatheca and completing fertilization in 5 min. The constricted spermatheca smoothly expels the oocyte into the …

Video 3
Download asset
The sp-ut valve fails to open during spermathecal contraction.

Time-lapse recordings on the left are of DIC and GFP. Recordings on right are of GFP alone. Oocyte entry occurs from the left at the 15 s mark. The spermatheca was labelled by the apical junctional …

Video 4
Download asset
Spermatheca dilation is defective in pezo-1 mutants.

Time-lapse video recording (DIC). Oocyte entry occurs from the left at the 35-s mark. The distal valve was not able to close completely and the oocyte was pinched. One portion of the broken oocyte …

Video 5
Download asset
Sheath cell contraction is defective in pezo-1 mutants.

Time-lapse video recording (DIC). An oocyte fails to enter the spermatheca after a few attempts. Sheath cells fail to contract and push the oocyte into the spermatheca (on the right) and the oocyte …

Video 6
Download asset
mScarlet::PEZO-1 colocalizes with spermathecal-specific GCaMP3.

Example of the colocalization of mScarlet::PEZO-1 (magenta) with the Pfln-1::GCaMP3 transgene (green) in the spermathecal cells in a wildtype animal. The top left recording shows the merged channel …

Video 7
Download asset
Normal GCaMP3 influx was observed in pezo-1 mutants.

Examples of GCaMP3 recordings of embryo transits in wildtype (left panels) and pezo-1 CΔ (right panels) animals. Recordings were temporally aligned to the start of oocyte entry at 50 s. GCaMP3 …

Tables

Table 1
C. elegans strains list in the study.
StrainGenotype
Figure 1AG404pezo-1(av142[mScarlet::pezo-1]) IV, CRISPR/Cas9 edit
AG408pezo-1(av146 [gfp::pezo-1]) IV, CRISPR/Cas9 edit
AG483pezo-1(av182 [pezo-1::mScarlet]) IV, CRISPR/Cas9 edit
Figure 2N2Bristol (wild-type)
AG406pezo-1(av144[N-∆]) IV, CRISPR/Cas9 edit, deletion of exon 1–13 and introns
AG416pezo-1(av149[C-∆]) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
AG530pezo-1(av149[C-∆]) IV; ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III
AZ212ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III
Figure 3N2Bristol (wild-type)
AG416pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
LP598dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X, CRISPR/Cas9 edit
AG491pezo-1(av149) IV; dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X
Figure 4N2Bristol (wild-type)
AG416pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
Figure 5UN1108xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
AG414pezo-1(av144) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
AG415pezo-1(av149) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
AG448pezo-1(av142 [mScarlet::pezo-1]) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
Figure 6N2Bristol (wild-type)
AG406pezo-1(av144) IV, CRISPR/Cas9 edit, deletion of exon 1–13 and introns
AG416pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
AG531spe-9(hc52ts) I; him-8(e1489) IV
BA17fem-1(hc17ts) IV
CB1489him-8(e1489) IV
Figure 7N2Bristol (wild-type)
AG416pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
Figure 8N2Bristol (wild-type)
AG487pezo-1(av190 [pezo-1::degron]) IV, CRISPR/Cas9 edit
AG493pezo-1(av190 [pezo-1::degron]) IV; ieSi65 [sun-1p::TIR1::sun-1 3’UTR + Cbr-unc-119(+)] II; unc-119(ed3) III
AG494pezo-1(av190 [pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
AG495pezo-1(av190[pezo-1::degron]) IV; fxIs1[pie-1p::TIR1::mRuby] I
AG564fxIs1[pie-1p::TIR1::mRuby] I
AG565ieSi65 [sun-1p::TIR1::sun-1 3’UTR + Cbr-unc-119(+)] II; unc-119(ed3) III.
AG566ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
Figure 9N2Bristol (wild-type)
AG437pezo-1(av165[R2405P]) IV, CRISPR/Cas9 edit.
AG531spe-9(hc52ts) I; him-8(e1489) IV
Figure 1—figure supplement 1AG404pezo-1(av142 [mScarlet::pezo-1]) IV, CRISPR/Cas9 edit
AG408pezo-1(av146 [gfp::pezo-1]) IV, CRISPR/Cas9 edit
AG483pezo-1(av182 [pezo-1::mScarlet]) IV, CRISPR/Cas9 edit
Figure 2—figure supplement 1N2Bristol (wild-type)
AG406pezo-1(av144) IV, CRISPR/Cas9 edit, deletion of exon 1–13 and introns
AG416pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
PS8111pezo-1(sy1199) IV, CRISPR/Cas9 edit, Stop-cassette
PS8546pezo-1(sy1398) IV, CRISPR/Cas9 edit, deletion of the first exon of isoforms i and j
AG570pezo-1(av240) IV, CRISPR/Cas9 edit, deletion of full length of pezo-1
Figure 5—figure supplement 1UN1108xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
AG414pezo-1(av144) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
AG415pezo-1(av149) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
Figure 6—figure supplement 1AG494pezo-1(av190 [pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
AG416pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
BA17fem-1(hc17ts) IV
AG571pezo-1(av149) IV; fem-1(hc17ts) IV
Figure 8—figure supplement 1AG493pezo-1(av190 [pezo-1::degron]) IV; ieSi65 [sun-1p::TIR1::sun-1 3’UTR + Cbr-unc-119(+)] II; unc-119(ed3) III
AG494pezo-1(av190 [pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
AG495pezo-1(av190[pezo-1::degron]) IV; fxIs1[pie-1p::TIR1::mRuby] I
Figure 8—figure supplement 2AG582pezo-1(av241 [gfp::pezo-1::degron]) IV, CRISPR/Cas9 edit
AG567pezo-1(av241 [gfp::pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
AG568pezo-1(av241 [gfp::pezo-1::degron]) IV; fxIs1[pie-1p::TIR1::mRuby] I
AG569pezo-1(av241 [gfp::pezo-1::degron]) IV; ieSi65 [sun-1p::TIR1::sun-1 3′UTR + Cbr-unc-119(+)] II; unc-119(ed3) III
Figure 8—figure supplement 3AG494pezo-1(av190 [pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
Video 1AG408pezo-1(av146 [gfp::pezo-1]) IV, CRISPR/Cas9 edit
Video 2N2Bristol (wild-type)
AG406pezo-1(av149)] IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
Video 3LP598dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X, CRISPR/Cas9 edit
AG491pezo-1(av149) IV; dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X
Video 4AG406pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
Video 5AG448pezo-1(av142 [mScarlet::pezo-1]) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
Video 6UN1108xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
AG415pezo-1(av149) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6D(su1006))] II
Table 2
List of the sequence for the CRISPR design.
StrainGenotypeDescriptionSequence nameSequence 5′−3′PAM
AG406pezo-1 (av144) IVDeletion of exons 1–13 and introns of pezo-1crRNA N-terminusACACAGCAACAACAGAATGACGG
 crRNA C-terminusTGGGGGTGTTGCAGTGGCTAAGG
 Repair templateatctgaatcggtggtcgtaacacagcaacaacagagtttgacacattttccgttgagacttgaaaaatag
 Genotyping F1GCGGTAAATCTGAATCGGTGG
 Genotyping R1TTGGAAAAGCAGGCACAACC
Genotyping
internal		CGATCCAGCGTGGATGAACT
AG416 pezo-1 (av149) IVDeletion of exons 27–33 and introns of pezo-1crRNA N-terminusCGGTGGCAGCGTACATTATCTGG
crRNA C-terminusCACCAGCGACACTCATCGAATGG
Repair templatetccagtctcccatatttattttttttctgttccagTAGATAAGTAAGAGCAAAAAGAAGCAAGAATAA
Genotyping F1AATCTGACTTGTGCCCTCCG
Genotyping R1AATCAGGCGAGCAGTGAGAG
Genotyping
internal		TCCACAGTCAATTCCTGCGT
AG404pezo-1(av142 [mScarlet::pezo-1]) IVKnock in mScarlet at N-terminus of pezo-1, mScarlet was amplified from plasmid pMS050crRNAACACAGCAACAACAGAATGACGG
Repair template F1tgaatcggtggtcgtaacacagcaacaacagaATG CTTGTAGAGCTCGTCCATTCC (mScarlet)
Repair template R1AATTTGACGACGCACGATTTTAAAAGCGGCGGGACTGT
CTTGTAGAGCTCGTCCATTCC (mScarlet)
AG408pezo-1(av146 [gfp::pezo-1]) IVKnock in GFP at N-terminus of pezo-1, GFP was amplified from plasmid pDD282crRNAACACAGCAACAACAGAATGACGG
Repair template F1tgaatcggtggtcgtaacacagcaacaacagaATG agtaaaggagaagaattgttc (GFP)
Repair template R1AATTTGACGACGCACGATTTTAAAAGCGGCGGGACTGT
CTTGTAGAGCTCGTCCATTC (GFP)
AG483pezo-1(av182 [pezo-1::mScarlet]) IV.Knock in mScarlet at C-terminus of pezo-1, mScarlet was amplified from plasmid pMS050NEST1 crRNACACCAGCGACACTCATCGAATGG
Repair templateAATATTCCTGTTCCGATCACCAGCGACACTCATCGAATGGACTCGTATGAGTAAGAAAAAACAGGAG
GTCTCCAAGGGAGAGGCCGTCATCAAGGAGTTCATGCGTTTCAAGGTCCAAGCGCTCCGAGGGACGTCACTCCACCGGAGGAATGGACGAGCTCTACAAGTAAatttaaatatttcactgtcaaatattctgcga (mScarlet)
Genotyping F1TGGTTCGAGAAGCGAAGGAC
Genotyping R1aatcaggcgagcagtgagag
NEST2 crRNATTCAAGGTCCAAGCGCTCCGAGG
Repair template F1GCCGTCATCAAGGAGTTCATGCGTTTCAAGGTCCACATGGAGGGATCCATGAACG
Repair template R1TAGAGCTCGTCCATTCCTCCGGTGGAGTGACGTCCTTCTGAACGCTCGTATTGCTCGACGACGGTG
AG487pezo-1(av190 [pezo-1::degron]) IVKnock in Degron sequence at C-terminus of pezo-1, Degron was amplified from plasmid pK0132crRNACACCAGCGACACTCATCGAATGG
Repair template F1AATATTCCTGTTCCGATCACCAGCGACACTCATCGAATGGACTCGTATGAGTAAGAAAAAACAGGAGggagcatcgggagcctcaggagcatcg (linker)GACTACAAAGACCATGACGGTG (Degron)
Repair template R1tcgcagaatatttgacagtgaaatatttaaatTTACTTCACGAACGCCGCC (Degron)
AG437pezo-1(av165[R2405P]) IVGenerate a point mutation R2405P in pezo-1crRNACTATTTGGTTCGAGAAGCGAAGG
Repair templateCATCTTCTCAAAATTTGTCTCGACATCTATTTGGTACCAGAAGCGAAAGACTTCATGTTGGAGCAGgtaattatttagtttta
AG570pezo-1(av240) IVDeletion of full length of pezo-1crRNA1ACACAGCAACAACAGAATGACGG
crRNA2CACCAGCGACACTCATCGAATGG
Repair templatectgaatcggtggtcgtaacacagcaacaacagaATGTAGATAAGTAAGAGCAAAAAGAAGCAAGAATAAatttaaatatttc
AG571pezo-1(av242) IVDeletion of exons 27–33 and introns of pezo-1 in fem-1(hc17)crRNA1CGGTGGCAGCGTACATTATCTGG
crRNA2CACCAGCGACACTCATCGAATGG
Repair templatetccagtctcccatatttattttttttctgttccagTAGATAAGTAAGAGCAAAAAGAAGCAAGAATAA
AG582pezo-1(av241) IVKnock in Degron sequence at C-terminus of pezo-1 in AG404,Degron was amplified from plasmid pK0132crRNACACCAGCGACACTCATCGAATGG
Repair template F1AATATTCCTGTTCCGATCACCAGCGACACTCATCGAATGGACTCGTATGAGTAAGAAAAAACAGGAGggagcatcgggagcctcaggagcatcg (linker)GACTACAAAGACCATGACGGTG (Degron)
Repair template R1tcgcagaatatttgacagtgaaatatttaaatTTACTTCACGAACGCCGCC (Degron)
PS8111pezo-1(sy1199) IVKnock in a stop cassette at C-terminus of pezo-1crRNACCAGAAGCTCGTAAGCCAGGAGG
Repair templatecttatcgctgtttctgaaccagaagctcgtaagccGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcaggaggcactgaagaaacggatggtgatgaag
Genotyping F1GACAGGACTTTCCCGCCAACTTAA
Genotyping R1ATCATTCGCCGATTGCACAAGTTG
PS8546pezo-1(sy1398) IVDeletion of the first exon of pezo-1 isoforms i and jcrRNA1gagaacttgaattcaatggAGG
crRNA2aagcttcttccgtctccggCGG
crRNA3gcagtatttgaccaactggTGG
crRNA4ataaaacaaggcaaccaggGGG
Genotyping F1CTCTCGCCTATCCACTTGAGCTTA
Genotyping R1GGAAACAATTGAGCCGAGAATGGA

  1. Note: Capital letters represent the ORF or exon sequence, small letters indicate the intron sequence. Bolded letters indicate the optimized bases needed for the CRISPR design.

Additional files

Transparent reporting form
https://cdn.elifesciences.org/articles/53603/elife-53603-transrepform-v3.docx

Download links