Caenorhabditis elegans PIEZO channel coordinates multiple reproductive tissues to govern ovulation

Version of Record

Accepted for publication after peer review and revision.

Download
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

Version of Record published: July 7, 2020 (This version)
Accepted Manuscript updated: June 4, 2020 (Go to version)
Accepted Manuscript published: June 3, 2020 (Go to version)
Accepted: June 2, 2020
Received: November 14, 2019

1. Of interest
Glucagon-like peptide-1 receptor activation stimulates PKA-mediated phosphorylation of Raptor and this contributes to the weight loss effect of liraglutide

Thao DV Le, Dianxin Liu ... Julio E Ayala

Research Article Dec 1, 2023
Further reading

Abstract
Introduction
Results
Discussion
Materials and methods
Data availability
References
Decision letter
Author response
Article and author information
Metrics

Abstract

PIEZO1 and PIEZO2 are newly identified mechanosensitive ion channels that exhibit a preference for calcium in response to mechanical stimuli. In this study, we discovered the vital roles of pezo-1, the sole PIEZO ortholog in Caenorhabditiselegans, in regulating reproduction. A number of deletion alleles, as well as a putative gain-of-function mutant, of PEZO-1 caused a severe reduction in brood size. In vivo observations showed that oocytes undergo a variety of transit defects as they enter and exit the spermatheca during ovulation. Post-ovulation oocytes were frequently damaged during spermathecal contraction. However, the calcium signaling was not dramatically changed in the pezo-1 mutants during ovulation. Loss of PEZO-1 also led to an inability of self-sperm to navigate back to the spermatheca properly after being pushed out of the spermatheca during ovulation. These findings suggest that PEZO-1 acts in different reproductive tissues to promote proper ovulation and fertilization in C. elegans.

Introduction

Mechanotransduction — the sensation and conversion of mechanical stimuli into biological signals — is essential for development. PIEZO1 and PIEZO2 are newly identified excitatory mechanosensitive proteinsthat play important roles in a wide range of developmental and physiological processes in mammals (Alper, 2017; Coste et al., 2010; Coste et al., 2012; Murthy et al., 2017; Wu et al., 2017). PIEZO1 is a non-selective ion channel that forms homotrimeric complexes at the plasma membrane; however, PIEZO1 exhibits a preference for Ca²⁺ in response to mechanical stimuli (Coste et al., 2010; Gnanasambandam et al., 2015; Syeda et al., 2015). Recent studies have shown that the human and mouse PIEZO1 channels respond to different mechanical stimuli, including static pressure, shear stress and membrane stretch (Coste et al., 2010; Poole et al., 2014; Ranade et al., 2014). PIEZO1 also regulates vascular branching and endothelial cell alignment upon sensing frictional force (shear stress) (Li et al., 2015; Nonomura et al., 2018). Stem cells also use PIEZO1 to sense mechanical signals and to initiate Ca²⁺ signaling to promote proliferation and differentiation (Del Mármol et al., 2018; He et al., 2018). PIEZO2 primarily functions as a key mechanotransducer for light touch, proprioception and breathing (Nonomura et al., 2017; Woo et al., 2015; Woo et al., 2014). Mutations in both human PIEZO1 and human PIEZO2 have been identified among patients suffering from channelopathy diseases, such as dehydrated hereditary stomatocytosis (DHSt), generalized lymphatic dysplasia (GLD), and distal arthrogryposis type 5 (DA5), in which osmoregulation is disturbed (Albuisson et al., 2013; Andolfo et al., 2013; Bae et al., 2013; Coste et al., 2013; Li et al., 2018; Lukacs et al., 2015; McMillin et al., 2014; Zarychanski et al., 2012). Loss-of-function mutations in the PIEZO1 gene cause autosomal recessive congenital lymphatic dysplasia, whereas gain-of-function mutations lead to autosomal dominant stomatocytosis (Alper, 2017). However, the cellular and molecular mechanisms of PIEZO dysfunction in these diseases are not well understood.

Caenorhabditis elegans is an attractive model system for the study of mechanotransduction in vivo. C. elegans contains multiple tubular tissues, including the reproductive system, that experience mechanical stimulation (Cram, 2014; Cram, 2015; Voglis and Tavernarakis, 2005). The C. elegans reproductive system consists of two U-shaped gonad arms, each ending with a spermatheca and joined in the center by a shared uterus. C. elegans hermaphrodites produce sperm during the L4 larval stage and then shift to produce oocytes during the adult stage. About 150 sperm are stored in each spermatheca, whereas the oocytes form in the oviduct in each gonad arm. The oocyte adjacent to the spermatheca undergoes oocyte maturation ~25 min before being ovulated into the spermatheca (Greenstein, 2005). Oocyte maturation is triggered by sperm-derived polypeptides known as major sperm proteins (MSPs), which activate the oocyte mitogen-activated protein kinase (MPK-1) (Miller, 2001; Yang et al., 2010). Once the oocyte matures, five pairs of contractile myoepithelial cells that make up the somatic gonad and that encase the germline, named sheath cells, push the matured oocyte into the spermatheca for fertilization. The spermatheca is an accordion-like multicellular tube, consisting of two spermathecal valves, the distal valve (closest to the oviduct) and the spermathecal-uterine (sp-ut) valve, and a bag-like chamber between the two valves (Kimble and Hirsh, 1979; McCarter et al., 1999).

The two spermathecal valves are spatiotemporally coordinated to allow oocyte entry during ovulation and exit after fertilization, through acto-myosin contractions (Kelley and Cram, 2019). Ovulation is triggered by signaling between oocytes, sheath cells, and sperm through increasing cytosolic inositol 1,4,5-trisphosphate (IP₃) and Ca²⁺ concentrations (Bui and Sternberg, 2002; Clandinin et al., 1998; Han et al., 2010). The ovulated oocyte spends 3–5 min in the dilated spermatheca with both valves closed to allow the oocyte and sperm to complete fertilization and to initiate eggshell formation (Johnston et al., 2010). The constriction of the spermathecal bag cells and the opening of the spermathecal-uterine valve cells expel the fertilized egg into the uterus. Meanwhile, the sperm that are swept out of the spermatheca during oocyte exit crawl back to the constricted spermatheca. The navigation of the sperm back to the spermatheca is regulated by the chemoattractant prostaglandin, which is secreted by the oocytes and sheath cells (Kubagawa et al., 2006). Despite the probable role of mechanical stimuli (such as stretch of oocyte entry or the contraction of the spermatheca) during this whole process, the mechanisms underlying the mechanosensitive channels in ovulation and fertilization remain largely unknown.

In this study, we hypothesized that a mechanosensitive protein such as PEZO-1, the sole PIEZO-like protein in C. elegans, is involved in processes that include cellular movements, such as those observed in ovulation where oocytes must transit into and out of the spermatheca. Multiple deletion mutations, as well as a putative gain-of-function mutation, caused severe reproductive deficiencies, such as reduced brood sizes and defects in ovulation and sperm navigation. Somewhat surprisingly, normal calcium release was observed in the spermatheca during early ovulations of pezo-1 mutants. Sperm that were readily washed out of the spermatheca during ovulation failed to migrate back to the spermatheca, thus depleting the spermatheca of sperm early in the reproductive lifecycle. Supplementing male sperm through mating significantly repopulated the spermatheca with cross-sperm and rescued the extremely low ovulation rate and reduced brood size of pezo-1 mutants. Using an auxin-inducible degradation (AID) system, we depleted PEZO-1 in somatic tissues and the germline. Reduced brood sizes were observed in each tissue-specific degradation strain, suggesting that PEZO-1 from many tissues has multiple inputs in regulating reproduction. Thus, our analysis of numerous pezo-1 mutants suggests that PEZO-1 has a complex role in a number of tissues that are required for reproduction.

Results

PEZO-1 is expressed in multiple tissues throughout development

The C. elegans genome encodes a single PIEZO ortholog, pezo-1, of which there are 14 mRNA isoformsas the result of differential splicing and transcriptional start sites (Figure 1—figure supplement 1A; Harris et al., 2019); these 14 isoforms code for 12 different PEZO-1 proteins. All isoforms share a common C-terminus. To visualize the expression pattern of pezo-1 in vivo accurately, we directly knocked-in different fluorescent reporter genes into both the N-terminus and C-terminus of the pezo-1 endogenous locus using CRISPR/Cas9. The C-terminal knock-in reporters should tag all pezo-1 isoforms, whereas the N-terminal knock-in reporters should only tag the eight longest pezo-1 isoforms (Figure 1A, Figure 1—figure supplement 1A). Both GFP and mScarlet were used as reporters to generate N- and C-terminal fusions proteins. GFP::PEZO-1, mScarlet::PEZO-1, and PEZO-1::mScarlet were widely expressed from embryonic stages through adulthood (Figure 1B–E,G–J, Figure 1—figure supplement 1B–G). The genome-edited animals behaved normally, suggesting that tagging PEZO-1 with these fluorescent reporter genes causes no functional disruption. Notably, PEZO-1 is strongly expressed in several tubular tissues, including the pharyngeal-intestinal and spermathecal-uterine valves, which is consistent with our hypothesis that pezo-1 may be responsible for mechanoperception in these tissues (Figure 1B, Figure 1—figure supplement 1B,C). Under higher magnification, we observed PEZO-1 on the plasma membranes of oocytes and embryonic cells during a variety of embryonic stages, suggesting that PEZO-1 is a transmembrane protein (Figure 1C–E). PEZO-1 is expressed in multiple reproductive tissues, including the germline, somatic oviduct, and spermatheca (Figure 1F–J). Higher magnification imaging of the spermatheca revealed that PEZO-1 is also expressed on sperm membranes (Figure 1J). Consistent with the hypothesis that reproductive tissues are regulated by mechanosensitive stimuli in C. elegans, expression of PEZO-1 probably functions to sense physical strain or contractility during ovulation and fertilization. Live imaging and detailed analysis of PEZO-1 expression patterns during reproduction revealed that GFP::PEZO-1 is expressed in sheath cells, sperm, both spermathecal valves and the spermathecal bag cells (Figure 1K–O, Video 1). The fluorescent signal of GFP::PEZO-1 is observed in both spermathecal valves, suggesting that PEZO-1 may function to sense the mechanical stimuli at the valves during ovulation (Figure 1K,M,N, Video 1). As the fertilized oocyte is pushed into the uterus, GFP::PEZO-1-labeled sperm crawl back into the constricting spermatheca after each ovulation (Figure 1O, Video 1). Collectively, these data indicate that PEZO-1 is expressed in the somatic gonadal cells and germline cells.

Figure 1 with 1 supplement see all

Download asset Open asset

*pezo-*1 is widely expressed in *C. elegans.*

(A) Two fluorescent reporter genes were knocked-in to both N-terminus and C-terminus of *pezo-1*. (B) GFP::PEZO-1 is strongly expressed in multiple mechanosensitive tissues, such as the pharyngeal-intestinal valve, spermatheca, and vulva (red arrows). (**C, E**) GFP::PEZO-1 (green) is expressed in the plasma membrane of different-staged embryos. (D) PEZO-1::mScarlet (magenta) also localizes to the plasma membranes of embryos. (F) A schematic of the *C. elegans* gonad. (**G–J**) Both PEZO-1::mScarlet (magenta) and GFP::PEZO-1 (green) localize to reproductive tissues, such as the plasma membranes of the germline cells (**G–I**), somatic gonad (**G–J**), spermatheca (I; in white box), and sperm (J; red arrows). PEZO-1::mScarlet (magenta) also labels the spermatids that have not yet migrated into the spermatheca (small circles, white box in panel [G]) and the residual bodies not yet engulfed by the sheath cells (bigger circles, white box in panel [G]) (Huang et al., 2012). (**K–O**) Representative images of PEZO-1 localization during ovulation and fertilization. GFP::PEZO-1 (green) localizes to the sheath cell (white arrow) and the spermathecal distal valve (yellow arrow (K), which remains closed before ovulation. The oocyte is ovulated, enters into the spermatheca (L) and remains enclosed in the spermatheca until fertilization is completed (M). During fertilization, GFP::PEZO-1 remained on the spermathecal-uterine (sp-ut) valve as indicated by a yellow arrow (**M, N**). The bag cells of the spermatheca also express GFP::PEZO-1 at this time (representative bag cells are marked by white arrows in panels (**L–N**). After fertilization, the sp-ut valve opened (N, yellow arrow) and allowed the newly fertilized zygote to exit the constricting spermatheca (**N, O**). Constriction of the spermatheca pushes the fertilized zygote into the uterus; sperm can be seen in the constricted spermatheca (O, yellow arrow). The black arrow above panel (K) shows the direction of embryo travelthrough the spermatheca from left to right. The timing of each step is labeled on the top right in minutes and seconds. Scale bars are indicated in each panel.

Figure 1—source data 1 Number of independent samples were collected for pezo-1 expression pattern in C. elegans.: https://cdn.elifesciences.org/articles/53603/elife-53603-fig1-data1-v3.xlsx
Download elife-53603-fig1-data1-v3.xlsx

Video 1

Download asset

posterframe for video — PEZO-1 expression pattern during ovulation.

Ovulation imaged in the genome-edited animals expressing GFP::PEZO-1 (green). The yellow arrow in the right panel indicates GFP::PEZO-1 expression on the spermathecal valves. White arrows in the right panel indicate GFP::PEZO-1 expression on the bag cells. After fertilization, GFP::PEZO-1-labeled sperm crawled back to the spermatheca. The left panel shows the merged channel of DIC (grey) with GFP (green). The right panel indicates the GFP (green) channel only. Images are single z planes taken every 2 s. Timing is indicated in the lower right panel. Playback rate is 15 frames/second. A scale bar is shown in the left panel.

Deletion of pezo-1 causes a decrease in brood size

To investigate the function of pezo-1, the phenotypes of pezo-1 knockout (pezo-1^KO) animals were analyzed. Three candidate null alleles were generated by CRISPR/Cas9 genome editing; one allele was a deletion of exons 1–13 (pezo-1 NΔ), a second had a deletion of the last seven exons, 27–33 (pezo-1 CΔ) (Figure 2—figure supplement 1A,B), and a third had a full-length deletion of the entire pezo-1 coding sequence (pezo-1 full deletion). Two other alleles were generated by CRISPR/Cas9: pezo-1(sy1398), which has a deletion of an exon unique to the two shortest isoforms, i and j, and a putative null allele, pezo-1(sy1199), which has a ‘STOP-IN’ mutation in exon 27 that should interfere with translation of the C-termini of all isoforms (Figure 2—figure supplement 1B). Although GFP::PEZO-1 and PEZO-1::mScarlet are expressed widely in adult worms, we did not observe obvious morphological differences between homozygous pezo-1^KO mutants and control animals. However, in all tested pezo-1 mutants, the number of F₁ progeny was significantly lower than in the wild type (Figure 2A, Figure 2—figure supplement 1C). The decrease in brood size was enhanced as animals aged (36–60 hr post mid-L4, Figure 2—figure supplement 1C) or when grown at a higher temperature (25°C, Figure 2—figure supplement 1D). In addition, about 5–25% of F₁ embryos failed to hatch from pezo-1 CΔ homozygous mutants (Figure 2B). To mimic a gain-of-function phenotype in pezo-1, we fed wildtype animals with Yoda1, a PIEZO1-specific chemical agonist that keeps the channel open (Syeda et al., 2015). Reduced brood sizes were observed when wildtype animals were exposed to 20 μM Yoda1 (Figure 2C). This phenotype did not worsen when pezo-1^KO animals were also treated with Yoda (Figure 2C). These data suggest that either deletion or overactivation of PEZO-1 is sufficient to disrupt brood size.

Figure 2 with 1 supplement see all

Download asset Open asset

Deletions of the *pezo-1* gene cause a reduction in brood size.

(A) Brood size was significantly reduced in both *pezo-1 NΔ* and *pezo-1 CΔ* animals when compared with wildtype, and this reduction was most evident in older adult animals. (B) The percentage of viable embryos was reduced in the *pezo-1 CΔ* animals. (C) Dietary supplementation of a PIEZO1-channel-specific activator Yoda1 in wildtype animals significantly reduced the brood size compared with control treatment, but brood size was not further reduced in *pezo-1 C∆* when treated with Yoda1. (**D, E**) DIC images of the uteri of gravid adult animals. Wildtype animals had young embryos in their uteri (D), whereas only a large ooplasmic mass was observed in *pezo-1 CΔ* mutant uteri (E). (F) Quantification of the percentage of uteri with ooplasmic masses in wildtype and *pezo-1* deletion mutants. N2 is the wildtype strain. (**G, H**) DAPI staining demonstrated that multicellular embryos (white circles in panel [G]) were present in the uteri of wildtype animals, whereas only oocyte meiotic chromosomes (white circles and rectangle) were observed in the uteri of *pezo-1 CΔ* mutants (panel [H]; inset in the top right white box shows an amplified image of the meiotic chromatin marked with a white rectangle). The yellow dotted lines indicate the boundaries of the uteri in panels (G) and (H). (**I, J**) Only unfertilized oocytes and newly fertilized zygotes are permeable to BODIPY (green) in wildtype (WT) animals (I), whereas staining was observed throughout the entire uterine mass (yellow circle in panel [J]) of *pezo-1 CΔ* animals. (**K, L**) An H2B::GFP transgene was crossed into our strains to visualize oocyte and sperm chromatin. (K) Sperm labeled by H2B::GFP (green cells in yellow circle) reside in the spermatheca (yellow circle) of Day 2 adults (48 hr post mid-L4). (L) Only oocyte debris (yellow circle) is left in the spermatheca of an age-matched *pezo-1 CΔ* mutant. (M) Quantification of sperm counts in both wildtype and *pezo-1 CΔ* hermaphrodites at different time windows. (N) Quantification of the oocyte ovulation rate of wildtype and *pezo-1 CΔ* adults at different ages. The oocyte ovulation rate was significantly reduced in the older *pezo-1 CΔ* mutant adults. P-values: *, p=0.031 (B); *, p=0.012(M); ****, p<0.0001 (t-test).

Figure 2—source data 1 Quantification data describing brood size, the percentage of viable embryos and sperm counts of pezo-1 mutants compared with wild-type.: https://cdn.elifesciences.org/articles/53603/elife-53603-fig2-data1-v3.xlsx
Download elife-53603-fig2-data1-v3.xlsx

Severe ovulation defects were observed in the pezo-1 mutants

Using differential interference contrast (DIC) and confocal microscopy, we analyzed the defects associated with the observed reduction in brood size. Although embryos fill the uterus in wildtype mothers (Figure 2D), a mass of ooplasm in the uteri of both pezo-1^KO and STOP-IN mutants was observed (Figure 2E, Figure 2—figure supplement 1E). Occasionally, a few fertilized embryos were observed inside this mass of ooplasm (data not shown). pezo-1 CΔ and STOP-IN mutants displayed the most severe defects, with 100% of animals having a uterus filled with ooplasm at 60 hr post L4 (Figure 2F, Figure 2—figure supplement 1E). Staining with DAPI in pezo-1^KO uteri revealed chromosome structures that were indicative of diakinesis-staged oocytes (Figure 2H). Sperm chromatin was not clearly observed, so we cannot state for certain that these crushed oocytes were not fertilized. By contrast, only mitotic chromatin of variably aged embryos were detected in control animals (Figure 2G). Consistent with this observation, only unfertilized oocytes and newly fertilized embryos without intact eggshells were stained with the lipophilic dye, BODIPY, in wildtype animals (Figure 2I). BODIPY staining revealed widespread penetration of the entire ooplasmic mass in the uteri of pezo-1 CΔ animals (Figure 2J). These data suggest that some oocytes are not fertilized upon transit through the spermatheca and that these unfertilized oocytes may be crushed when they pass through the spermathecal valves. Although these crushed oocyte phenotypes are reminiscent of those observed in animals depleted of some eggshell components (Johnston et al., 2010), there are notable differences. The pezo-1 mutant oocytes are not fertilized and do not make an eggshell. The lack of fertilization or eggshell synthesis is not likely to be responsible for the crushed oocyte phenotype, because the oocytes in spe mutants survive spermatheca transit and are often laid after passing through the uterus. A more detailed characterization of the ovulation defects is provided below.

In addition to these apparently crushed oocytes, reduced numbers of sperm resident in the spermatheca were observed in Day 1 pezo-1 adults (0–24 hr post mid-L4) and even fewer were observed in the spermathecae in Day 2–3 adults (24–48 hr post mid-L4) compared with wild type (Figure 2K–M). Normal numbers of sperm were present in these mutant hermaphrodites prior to the first ovulation, suggesting that the ability of the sperm to return to the spermatheca after each ovulation was disrupted (Figure 2M). Sperm loss could also contribute to the low brood sizes observed in our pezo-1 mutants.

Ovulation rates were significantly reduced in pezo-1 CΔ Day 2 (post mid-L4 48 hr) animals (Figure 2N), which is consistent with the reduced brood sizes that worsen in Day 2 animals. As the presence of sperm in the spermatheca is known to stimulate ovulation (McCarter et al., 1999; Miller, 2001), the reduction in sperm number could be responsible for this reduction in ovulation rate. Overall, the reduced brood size in pezo-1 mutants is probably due to a combination of defects in multiple tissues, resulting in defective ovulations, crushed oocytes, and defects in the ability of sperm to navigate back into the spermatheca after each ovulation.

To characterize the transit of oocytes through the spermatheca carefully, we performed live imaging to record the ovulation and fertilization process in both wildtype and pezo-1^KO animals (Figure 3A–E’, Videos 2 and 3). The imaging began with the mature oocyte entering the spermatheca, labeled by the apical junction marker DLG-1::GFP (Figure 3A,B). In wildtype animals, the contracting sheath cells push the oocyte into the spermatheca, and simultaneously pull the open spermatheca over the oocyte (Videos 2 and 3). Once the oocyte enters the spermatheca, both spermatheca valves remain closed during fertilization (Figure 3C). Opening of the sp-ut valve allows the fertilized oocyte to be expelled into the uterus (Figure 3D,E). In pezo-1 mutants, many of the oocytes that did successfully enter the spermatheca were crushed when they exited through the sp-ut valve (Figure 3A′–E′, Videos 2 and 3). We observed that the sp-ut valve, labeled by DLG-1::GFP, did not completely open when the oocyte attempted to exit the spermatheca, which may lead to crushing the oocyte (Figure 3C′–E′, Video 3). The ooplasm from the crushed oocytes accumulated in the uterus (Figure 3E’, Video 3) as a large ooplasmic mass (as shown in Figure 2E). During our analysis of the pezo-1 mutants, we frequently observed that oocytes partially entered the spermatheca but were then pinched off and broken into two pieces, one of which remained trapped in the oviduct (proximal gonad; Figure 3F–I, Video 4). Moreover, some oocytes failed to enter the spermatheca and slid back into the oviduct (Figure 3J–M, Video 5). The defective ovulation is probably due to incomplete constriction of the sheath cells. Overall, disrupted ovulation and oocyte transit defects were observed in pezo-1 mutants, consistent with the decreased brood size observed in all of our pezo-1 mutants.

Figure 3

Download asset Open asset

PEZO-1 mutants exhibit severe ovulation defects.

(**A–E**) Ovulation in wildtype animals. (**A, B**) Ovulation is initiated by oocyte (yellow dotted circle) entry into the spermatheca, which was labelled by the apical junctional marker DLG-1::GFP (green). (C) Fertilization occurs in the occupied spermatheca (yellow dotted circle). (**D, E**) After fertilization, the sp-ut valve (red arrows) opened immediately to allow the newly fertilized zygote (yellow dotted circle) to exit the spermatheca and enter the uterus. (**A′–E′**) Abnormal ovulation was observed in *pezo-1 CΔ* animals. Control of the spermathecal valves was aberrant (**C′–E′**) during ovulation and the DLG-1::GFP labelled sp-ut valve (red arrow) never fully opened; the oocyte was crushed as it was expelled (E′). (**F–M**) Two examples of ovulation defects observed in the *pezo-1 C∆* mutants. (**F–I**) The ovulating oocyte (white dotted circle) was pinched off by the spermathecal distal valve (red arrows in panel [H]). This oocyte never exited into the uterus. (**J–M**) *pezo-1 CΔ* oocytes frequently failed to enter the spermatheca and were retained in the oviduct (M). The black arrow above panel (A) shows the direction of embryo travel through the spermatheca from left to right. All four image time series follow this same left to right orientation. The timing of each step is labeled on the bottom right in minutes and seconds. Scale bars are shown in each panel.

Figure 3—source data 1 Number of independent samples were collected for imaging ovulation defects in pezo-1 mutants.: https://cdn.elifesciences.org/articles/53603/elife-53603-fig3-data1-v3.xlsx
Download elife-53603-fig3-data1-v3.xlsx

Video 2

Download asset

Video 3

Download asset

Video 4

Download asset

Video 5

Download asset

PEZO-1 mutants are affected upon depletion of cytosolic Ca²⁺ regulators

Given that PEZO-1 is the ortholog of mammalian mechanosensitive calcium channels and that Ca²⁺ signaling is a major regulator of C. elegans spermathecal contractility, we tested whether there was suppression or enhancement when pezo-1 mutants were combined with the depletion of several important cytosolic Ca²⁺ regulators. To manipulate potential calcium signaling, an ER Ca²⁺ release channel, ITR-1, and an inositol-1,4,5-triphosphate (IP₃) kinase, LFE-2, were depleted by RNAi in both wildtype and pezo-1 mutants. IP₃ binding to ITR-1 releases Ca²⁺ from the ER, which activates myosin for spermathecal contractility (Bouffard et al., 2019; Clandinin et al., 1998; Kovacevic et al., 2013). Therefore, we hypothesized that combining pezo-1 mutants with itr-1 RNAi would greatly enhance the reduction in brood size if they were both critical to ovulation and fertilization. We carefully calibrated itr-1 RNAi treatment and determined that feeding L4 animals for 36–60 hr produced optimal intermediate conditions that caused minimal developmental defects and normal brood sizes in wildtype animals. Consistent with our hypothesis, feeding itr-1 RNAi resulted in even smaller broods than those observed in pezo-1 mutants alone (Figure 4A). By contrast, feeding lfe-2 RNAi, which should elevate cytosolic Ca²⁺, partially rescued the reduced brood size (Figure 4B). Therefore, pezo-1^KO mutants were further compromised with itr-1 (RNAi), yet partially rescued when combined with lfe-2 (RNAi). Similarly, depletion of the plasma membrane Ca²⁺ channel orai-1, which is activated to replenish Ca²⁺in the cytosol from an extracellular source (Lorin-Nebel et al., 2007), led to nearly zero brood size in pezo-1 CΔ mutant but only a 40% reduction in brood size in wild type (Figure 4C). Furthermore, disruption of ER Ca²⁺ stores with sarcoplasmic/ER Ca²⁺ ATPase (SERCA) sca-1 (RNAi) (Yan et al., 2006) also caused an extremely low brood size in pezo-1 CΔ (Figure 4C), whereas sca-1 (RNAi) slightly increased the brood size in wild type (Figure 4C). Therefore, these observations are consistent with the hypothesis that pezo-1 may function in cytosolic and ER Ca²⁺ homeostasis, which is crucial for proper spermathecal contractility and dilation. pezo-1 mutants show normal calcium signaling in spermatheca cells during ovulation.

Figure 4

Download asset Open asset

*pezo-1* mutants show genetic interactions with cytosolic Ca²⁺ regulators.

(A) *itr-1* (RNAi) reduced the brood size in *pezo-1 CΔ* animals. (B) By contrast, *lfe-2* (RNAi) slightly rescued the smaller brood size in *pezo-1 CΔ* animals. (C) Depletion of both *orai-1* and *sca-1* by RNAi also enhanced the brood size reduction of *pezo-1 CΔ* mutants. P-values: *, p=0.025 (C); **, p=0.0048 (A); ***, p=0.0001 (B); ****, p<0.0001 (t-test).

Figure 4—source data 1 Quantification of brood size for genetic interaction of pezo-1 mutants with RNAi depletion of calcium regulators.: https://cdn.elifesciences.org/articles/53603/elife-53603-fig4-data1-v3.xlsx
Download elife-53603-fig4-data1-v3.xlsx

Owing to the permeability of PIEZO channels to Ca²⁺ and the importance of calcium signaling in regulating spermathecal contractility, we tested whether the deletion of pezo-1 disrupted cytosolic Ca²⁺ homeostasis. We imaged oocyte passage through the spermathecae of both wild type and pezo-1 mutants expressing the Ca²⁺ indicator GCaMP3, which was driven by a spermatheca-specific fln-1 promoter (Bouffard et al., 2019; Kovacevic et al., 2013). Co-localization of the GCaMP3 transgene with mScarlet::PEZO-1 in the spermatheca suggested that this transgene would be useful for the analysis of pezo-1 function in spermathecal calcium signaling (Figure 5A–E, Video 6). To determine whether calcium signaling was altered in our pezo-1 mutants, a set of high-speed GCaMP imaging data from different animals was generated and the average pixel intensity of each frame was quantified (Figure 5F–J', Figure 5—figure supplement 1A–D, Video 6). We defined the initial time frame as the time just before the oocyte entered the spermatheca. In wildtype animals, the fluorescent intensity of GCaMP3 at the sp-ut valve immediately increased when the oocyte entered the spermatheca (Figure 5A,F and F', Videos 6 and 7). During fertilization, an increase in intensity of GCaMP3 was frequently observed in the bag cells and the sp-ut valve until the oocyte exited the spermatheca (Figure 5B–D,G–I and G'–I', Videos 6 and 7). The GCaMP3 signal decreased to basal intensity after the fertilized oocyte was expelled into the uterus (Figure 5E,J and J', Videos 6 and 7). To quantify statistically and to analyze the oocyte transit, we defined a series of parameters, including the dwell time and two calcium signaling metrics from the GCaMP3 time series (Bouffard et al., 2019). A spermathecal tissue function metric, dwell time, is defined as the time from spermathecal distal valve closure to sp-ut valve opening, which represents the time during which the oocyte resides in the enclosed spermatheca. The calcium signaling metric, fraction over half max, is defined as the duration of the dwell time over the GCaMP3 half-maximal value divided by the total dwell time. The fraction over half max allows us to capture the relative level of calcium throughout the time during which the embryo passes through the spermatheca. Rising time indicates the time from the opening of the distal valve to the first time point at which the GCaMP fluorescent intensity reaches half maximum (Bouffard et al., 2019). In pezo-1 CΔ mutants, longer transit times of the oocyte through the spermatheca resulted in elongated dwell times (Figure 5K, Video 7), suggesting that deletion of pezo-1 resulted in disrupted tissue function. Surprisingly, GCaMP3 fluorescence in pezo-1 was not significantly different from that in the wildtype (Figure 5L,M, Video 7; see 'Materials and methods'). GCaMP3 time series (Figure 5—figure supplement 1A,B, Video 7), heat maps (Figure 5—figure supplement 1C), and kymograms (Figure 5—figure supplement 1D,E) also displayed normal Ca²⁺ levels during oocyte passage through the spermatheca in pezo-1 mutants. It should be noted that we only imaged the GCaMP3 reporter during the very first three ovulations in young adult animals to avoid Ca²⁺ signaling interference from a distorted gonad morphology and mechanical pressure from a gravid uterus. Furthermore, it is difficult to monitor older pezo-1 hermaphrodites as they do not ovulate on microscope slides. As only mild defects were observed in the pezo-1 mutants during these early ovulations and oocyte transit defects increased in severity over time (Figure 2F), our data does not exclude the possibility that Ca²⁺ signaling may be more severely disrupted as the animal goes through more ovulation cycles. Alternatively, the live imaging assay may not be sensitive enough to detect subtle variations in calcium signaling.

Figure 5 with 1 supplement see all

Download asset Open asset

PEZO-1 mutants show normal GCaMP3 fluorescence during ovulation.

(**A–E**) mScarlet::PEZO-1 colocalizes with GCaMP3, which is driven by a spermatheca-specific promoter. These images represent the third ovulation for this spermatheca. (**F–J′**) Time series frames from GCaMP3 recordings in the third ovulation of both wildtype animals (**F–J**) and *pezo-1 C∆* animals (**F′–J′**). Ca²⁺ influx was quantified during ovulation and fertilization, as indicated by the intensity of GCaMP3 pixels (colored bar in panel [F]). (**F, F′**) Oocyte entry into the spermatheca in wildtype and *pezo-1 CΔ.* (**G, G′**) Oocytes in the spermatheca, (**H, H′**) Ca²⁺ influx during fertilization, (**I, I′**) intense Ca²⁺ influx as the sp-ut valve closes to push newly fertilized zygote into the uterus, and (**J, J′**) the return to basal levels as the spermatheca prepares for the next ovulation. (K) Dwell time is a tissue function metric calculated as the time the oocyte resides in the spermatheca from the closing of the distal valve to the opening of the sp-ut valve. (**L, M**) Calcium signaling metrics: fraction over half max (L) and rising time (M) in *pezo-1* mutants showed normal calcium levels during ovulation compared with wild type (Bouffard et al., 2019). The black arrow above panel (A) shows the direction of embryo travel through the spermatheca from left to right. All three image time series follow this same left to right orientation. The timing of each step is labeled in the bottom right in minutes and seconds (**A–E**), or on the top left in seconds (**F–J′**). Scale bars are shown in each panel.

Figure 5—source data 1 Quantification of calcium metrics in pezo-1 mutants and wild-type.: https://cdn.elifesciences.org/articles/53603/elife-53603-fig5-data1-v3.xlsx
Download elife-53603-fig5-data1-v3.xlsx

Video 6

Download asset

Video 7

Download asset

Sperm from matings rescues the low brood size phenotype in pezo-1 mutants

In C. elegans, successful ovulation and fertilization requires signal coordination between sperm, oocytes, and sheath cells (Han et al., 2010). Given that PEZO-1 is expressed in these tissues, it is plausible that oocyte transit defects and reduced brood sizes are the result of impaired inter-tissue signaling, which may be mediated by PEZO-1. To investigate how this may occur, bidirectional signaling between sperm and oocytes was first tested. To test for the ability of sperm to fertilize oocytes, both wildtype and pezo-1 mutant males were mated with fem-1(hc17) hermaphrodites, which do not produce any sperm or self-progeny (Doniach and Hodgkin, 1984) and are essentially females. The fem-1(hc17) animals produced cross-progeny after mating with pezo-1 mutant males, indicating that the pezo-1 mutant males are fertile and that their sperm can crawl through the uterus to the spermatheca upon mating (Figure 6A). As pezo-1 mutant hermaphrodites do not produce any self-progeny after Day 3 (60 hours post mid-L4) (Figure 6B), we tested whether mating with either wildtype or mutant males would result in any cross progeny in the aged pezo-1 mutants. pezo-1 mutant hermaphrodites resumed ovulation and fertilization upon mating once the male’s sperm (from either wildtype or pezo-1 males) reached the spermatheca (Figure 6B–D). To test whether sperm signaling was defective in inducing ovulation in pezo-1 mutants, we mated both spe-9(hc52ts) and control him-8(e1489) males with both wildtype and pezo-1 mutant hermaphrodites. spe-9(hc52ts) male sperm can physically contact the oocytes but fail to fertilize them, although the sperm signaling is apparently normal and triggers ovulation (Singson et al., 1998). Interestingly, the low ovulation rate in older pezo-1 CΔ animals was significantly rescued by spe-9(hc52ts) sperm (Figure 6E), although the ovulated oocytes were not fertilized. An additional experiment was performed to test the ability of the sheath to respond to the sperm signal that triggers ovulation. Even though our data in Figure 6E suggest that just the presence of sperm can trigger ovulation, we went on to show that purified MSP-fluorescein can also trigger ovulation in older pezo-1 C∆ hermaphrodites that are depleted of sperm and are no longer ovulating (Figure 6F–H). Overall, these data suggest that the absence of self-sperm contributes to a profound reduction of oocyte maturation, ovulation rate, and self-fertility in the aged pezo-1 mutants.

Figure 6 with 1 supplement see all

Download asset Open asset

Male sperm rescue the ovulation defects in *pezo-1* mutants.

(A) Both *pezo-1 C∆* and N∆ males are fertile and sire progeny when mated with *fem-1(hc17ts)* mutants (essentially female animals). (B) Mating with male sperm rescued fertility in Day 3 *pezo-1 CΔ* adults (72 hr post mid-L4). (C) The oocyte maturation and ovulation rate are very low in Day 3 *pezo-1 CΔ* mutant adults, and oocytes accumulate in the proximal gonad arm (yellow dashed circle). (D) By contrast, the ovulation rates are recovered to high levels after mating with wildtype male sperm. Newly fertilized embryos pushed the ooplasmic mass out of the uterus. Yellow asterisks indicate the spermatheca (**C, D**). (E) Quantification of the oocyte ovulation rate of wildtype and *pezo-1 CΔ* adults at different ages. *him-8(e1489)* and *spe-9 (hc52ts)* sperm significantly rescue ovulation rates in *pezo-1 CΔ* hermaphrodites, even though they do not fertilize oocytes. (**F, G**) Injection of purified fluorescein-tagged MSP in the uteri of both wildtype and *pezo-1 C∆* aged adults. Fluorescein-tagged MSP moved through the entire uterus to localize next to the spermatheca. The yellow dotted circle represents the spermatheca. The yellow arrows indicate the fluorescein-tagged MSP (green) localized next to the spermatheca. (H) Quantification of the oocyte ovulation rate of wildtype and *pezo-1 C∆* adults without or without injections of fluorescein-tagged MSP. P-values: ****, p<0.0001 (t-test). Scale bars are shown in panels (C, D, F, G).

Figure 6—source data 1 Quantification of sire progeny in different mating assays.: https://cdn.elifesciences.org/articles/53603/elife-53603-fig6-data1-v3.xlsx
Download elife-53603-fig6-data1-v3.xlsx

Sperm guidance and navigation is disrupted in pezo-1 mutants

In wildtype hermaphrodites, the sperm are constantly being pushed out of the spermatheca each time the sp-ut valve opens to expel the fertilized oocyte into the uterus. These sperm, however, are fully capable of crawling back to the spermatheca to induce high levels of oocyte maturation and ovulation (Miller, 2001; Miller et al., 2003). This is a very efficient mechanism, such that almost every self-sperm in a hermaphrodite is used to fertilize an oocyte. It is sperm number that defines brood size; oocytes are in excess. Oocytes secrete F-series prostaglandins derived from polyunsaturated fatty acids (PUFAs) to guide sperm to the spermatheca (Han et al., 2010; Kubagawa et al., 2006). To test whether pezo-1 hermaphrodites fail to attract the sperm back to the spermatheca, male sperm navigational performance was assessed in vivo by staining males with a vital fluorescent dye, MitoTracker CMXRos, which efficiently stains sperm in live animals (Whitten and Miller, 2007). Both wildtype and pezo-1 CΔ stained males were mated to non-labeled wildtype hermaphrodites for 30 min. The sperm distribution was assessed and quantified by dividing the uterus into three zones (Figure 7A) and counting the number of fluorescent sperm in each zone (McKnight et al., 2014) one hour after males were removed from the mating plates. In wildtype hermaphrodites, most fluorescent sperm from both wildtype and pezo-1 CΔ males navigated through the uterus and accumulated in the spermatheca (Figure 7B,C,F,G). However, fewer fluorescent male sperm reached the spermatheca in Day 3 adult pezo-1 CΔ hermaphrodites, and most sperm remained throughout zones 1 and zone 2, the zones furthest from the spermatheca (Figure 7D,E,H,I). This was observed for both wildtype and pezo-1 mutant male sperm in mating with pezo-1 CΔ hermaphrodites (Figure 7J). These observations suggest that in the reproductive tracts of wildtype hermaphrodites, pezo-1 mutant male sperm are motile and display normal navigational behavior. However, in pezo-1 mutant hermaphrodite reproductive tracts, both wildtype and pezo-1 mutant sperm were compromised in their navigational behavior over the time frame of this experiment. Although it remains possible that the ooplasmic masses that accumulate in the uterus of pezo-1 mutant hermaphrodites could physically interfere with the migration of wildtype and pezo-1 mutant sperm back to the spermatheca, our labeled sperm experiments with female pezo-1 mutants (see below) suggest that this is not a likely explanation.

Figure 7

Download asset Open asset

Sperm guidance and navigation is disrupted in *pezo-1* mutants.

(A) To quantify sperm migration, this illustration indicates the three zones that were scored for sperm distribution. Zone 3 is the spermatheca region and the space containing the +1 fertilized embryo (yellow dotted circles in panels (B, **D, F, H**), whereas Zone 1 is the area closest to the vulva. Sperm distribution is measured 1 hr after males were removed from the mating plate. (**B–I**) The distribution of fluorescent male sperm labeled with MitoTracker in the three zones in both wildtype and *pezo-1* mutants 1 hr after the males were removed. Yellow asterisks indicate the vulva (**C, E, G, I**). Scale bars are indicated in each panel. (J) Quantification of sperm distribution values. The numbers of the scored uteri are shown above each of the bars. P-values: ****, p<0.0001 (t-test).

Figure 7—source data 1 Quantification of sperm count in sperm distribution assays.: https://cdn.elifesciences.org/articles/53603/elife-53603-fig7-data1-v3.xlsx
Download elife-53603-fig7-data1-v3.xlsx

To test whether the defective ovulation and sperm attraction were just self-sperm problems, we generated the same pezo-1 CΔ (used throughout this study) in temperature-sensitive fem-1(hc17ts) females. In pezo-1 CΔ female mutants, the number of F₁ progeny was significantly reduced compared with that in control fem-1(hc17ts) at the permissive temperature of 15°C, which allows for the production of self-sperm (Figure 6—figure supplement 1A). We then mated these Day 2 (36 hours post mid-L4) females with both wildtype and mutant males and scored for cross progeny at the non-permissive temperature of 25°C. The male sperm were labeled by MitoTracker CMXRos before mating. We carefully quantified the number of male sperm in the reproductive tract of the pezo-1 C∆ females after mating for 30 min (Figure 6—figure supplement 1B). All tested female animals sired crossed progeny but at greatly reduced levels in pezo-1 CΔ females (Figure 6—figure supplement 1C,D). This suggests that the attractive signal from the oocytes or sheath cells are defective in their ability to attract male sperm to the spermatheca. Thus, the defect in the ability to attract sperm to the spermatheca is not just a self-sperm problem; cross sperm from males also fail to migrate to the spermatheca.

The data shown in Figure 6A and B suggest that mutant sperm, when mated with WT hermaphrodites or fem-1 females, can migrate to the spermatheca and fertilize a large number of oocytes. However, when mated into the pezo-1 C∆ hermaphrodites, these mutant sperm do sire cross progeny but at greatly reduced levels compared to wildtype male sperm (Figure 6B, right side). This result supports the conclusion that an attractive signal from the oocytes or sheath cells is missing or reduced in pezo-1 hermaphrodites. Thus, we believe that there is no problem with the ability of sperm to crawl and fertilize oocytes.

Tissue-specific degradation of PEZO-1 reveals multiple roles of PEZO-1 in both somatic tissues and germline cells

Our study aims to reveal the role of PEZO-1 in regulating reproduction and coordinating inter-tissue signaling. To dissect PEZO-1 function in distinct tissues, we utilized an auxin-inducible degradation system (AID) to degrade PEZO-1 in the soma and the germ line (Zhang et al., 2015). We knocked-in the degron coding sequence at the pezo-1 C-terminus using CRISPR/Cas9, so that all isoforms would be targeted (Figure 8A). To activate the AID system, this line was then crossed with the strains expressing the degron interactor transgene tir-1::mRuby driven by the following promoters: P_eft-3, P_pie-1 and P_sun-1 (Zhang et al., 2015). P_eft-3::tir-1::mRuby was expressed in most or all somatic tissues, including the spermatheca and the sheath cells (Figure 8B), whereas P_pie-1::tir-1::mRuby and P_sun-1::tir −1::mRuby were expressed in the germ line (Figure 8C,D). Weak TIR1-1::mRuby expression was observed in the sperm and oocytes of the germline strains (Figure 8C,D, Figure 8—figure supplement 1A–C).

Figure 8 with 3 supplements see all

Download asset Open asset

Tissue-specific degradation of PEZO-1 causes a reduced brood size and sperm navigational defects.

(A) Schematic of the auxin-inducible degradation (AID) system. A degron tag was inserted at the 3′ end of the *pezo-1* coding sequence using CRISPR/Cas9-mediated editing. (B) The *eft-3* promoter was used to drive TIR-1 expression in most or all somatic tissues, including the spermatheca and the sheath cells. TIR-1::mRuby driven by the germline-specific promoters *sun-1* and *pie-1* is strongly expressed in the germline and oocytes (**C, D**), and weakly expressed in the sperm (asterisks in panels [C, D]). (**E, F**) Brood size and embryonic viability were reduced in all degron strains when animals were treated with 2 mM auxin. Data are presented as the mean ± standard error from at least two independent experiments. (**G–J**) Sperm distribution 1 hr after the removal of males from mating plates. The germline-specific PEZO-1::Degron hermaphrodites were mated with wildtype males for 30 min. The representative images show that *pezo-1* degradation in the germ line influences sperm distribution from the vulva (zone 1) to the spermatheca (zone 3). (K) Quantification of sperm distribution in the PEZO-1::Degron strains grown on plates with (+) or without (–) 2 mM auxin. P-values: *, p=0.0146 (F); *. p=0.016 (K); **, p=0.0030 (F); **, p=0.0053 (F); ****, p<0.0001 (**E, K**) (t-test). Scale bars are shown in each micrograph.

Figure 8—source data 1 Quantification of brood size and sperm counts in each AID strain.: https://cdn.elifesciences.org/articles/53603/elife-53603-fig8-data1-v3.xlsx
Download elife-53603-fig8-data1-v3.xlsx

To assess the efficacy of PEZO-1 degradation in different reproductive tissues, we generated a strain in which the pezo-1 gene was tagged at its N-terminus with GFP and at its C-terminus with the degron (GFP::PEZO-1::Degron). This strain was crossed with the strains expressing tir-1::mRuby driven by the three different promoters described above (Figure 8—figure supplement 2B–B′′; D–D′′, F–F′′). GFP::PEZO-1::Degron strongly expresses at the plasma membrane of germline cells, oocytes, sperm, somatic sheath cells, and spermathecal cells (Figure 8—figure supplement 2A–A′′, B–B′′, D–D′′, F–F′′). The animals were exposed to either 0.25% ethanol as control or 2 mM auxin (indole-3-acetic acid, or IAA) for one generation, and the GFP fluorescent intensity in their F₁ progeny was analyzed. The strain expressing the degron interactor transgene P_eft-3::tir-1::mRuby had a significant reduction of the fluorescent intensity of GFP::PEZO-1::Degron at the sheath and spermathecal cells (Figure 8—figure supplement 2C–C′′). GFP fluorescence intensities in the germline and on oocytes in the germline-specific GFP::PEZO-1::Degron animals were 2–3 fold lower when the animals were exposed to auxin, but the intensities were not affected in the somatic tissues (Figure 8—figure supplement 2E–E′′, G–G′′, H, I). Therefore, auxin-inducible degradation of GFP::PEZO-1::Degron in the different tissues is consistent with the TIR-1::mRuby expression pattern.

To characterize further the defects associated with the degradation of PEZO-1 in these different tissues, L4 animals were exposed to either 0.25% ethanol as control or 2 mM auxin, and brood sizes were determined 0–60 hr post L4 (Day 1–3). Interestingly, the brood sizes were significantly reduced in each of the PEZO-1::Degron strains compared with control, regardless of the promoter used. However, the reduction in brood size was less severe than that observed in the pezo-1^ko mutants (Figures 8E,F and 2A). To ensure efficient degradation, we exposed animals to auxin for one generation and analyzed the brood size of their F₁ progeny. This longer auxin exposure did not significantly enhance the reduction in brood size (data not shown).

Depletion of PEZO-1 in the somatic tissues, including spermathecal and sheath cells, led to a variety of ovulation defects (Figure 8—figure supplement 3A–I). Pinched oocytes were frequently observed during ovulation (N = 9/27, Figure 8—figure supplement 3I). A fraction of the pinched oocytes entered the spermatheca, whereas the rest were left in the oviduct (Figure 8—figure supplement 3C,D,I). Surprisingly, most of the pinched oocytes were successfully expelled into the uterus and underwent embryogenesis as smaller embryos (data not shown). In addition, the process of oocyte entry into the spermatheca was frequently delayed or blocked (Figure 8—figure supplement 3E–I), suggesting that the distal spermathecal valve remained closed. In experiments in which wildtype sperm were in vivo labeled as described earlier, and mated into control and somatic-specific PEZO-1::Degron hermaphrodites, nearly 90% of the labeled sperm reached the spermatheca (zone 3) and only a few labeled sperm were observed in the uterus (Figure 8G,H,K). Notably, the ooplasmic uterine masses that we observed in our pezo-1^ko mutants were rarely observed in the somatic-specific degron strain.

Consistent with our male mating experiments, only 69% of the MitoTracker-labelled wildtype sperm accumulated at the spermatheca (zone 3) in the germline-specific PEZO-1::Degron animals exposed to auxin (Figure 8I–K). The remaining sperm were observed throughout the whole uterus (zones 1 and 2) after one hour of mating (Figure 8I,J). Crushed oocytes were rarely observed in the uterus of the germline-specific PEZO-1::Degron animals, in which the sperm distribution assay was performed. Therefore, the degradation of PEZO-1 in the germ line did not cause the severe uterine ooplasmic masses as we have observed for our pezo-1^ko mutants but it did interfere with sperm navigation to the spermatheca, suggesting impaired attractant signaling. This is a more likely explanation as uterine ooplasmic masses are not a physical impediment that could account for the defects in sperm migration.

Modeling human PIEZO genetic diseases in C. elegans

PIEZO patient-specific alleles, which are known to disrupt the normal physiological functioning of the cardiovascular, musculoskeletal, and blood systems in humans, were the motivation for examining the role of pezo-1 in the tubular structures of C. elegans. Our studies with null alleles of pezo-1 provide strong evidence that pezo-1 is essential for normal C. elegans reproduction. It is therefore reasonable to model human monogenic diseases that are associated with PIEZO1 and PIEZO2 mutations using the C. elegans reproductive system as a read-out of function. Individuals diagnosed with Dehydrated Hereditary Stomatocytosis (DHSt) were found to have a missense mutation in a conserved arginine residue (R2488Q) of PIEZO1. The orthologous residue (R2718L/P) was also mutated in PIEZO2 in individuals with Distal Arthrogryposis type 5 (DA5) (Andolfo et al., 2013; Coste et al., 2013; Li et al., 2018; McMillin et al., 2014).

Previous studies have shown that these arginine changes are functioning as gain-of-function mutations in their respective PIEZO protein (Albuisson et al., 2013; Coste et al., 2013; Li et al., 2018; McMillin et al., 2014). Sequence alignment indicated that R2405 in C. elegans PEZO-1 is the arginine residue homologous to both R2488 in human PEIZO1 and R2718 in human PIEZO2 (Figure 9A). Using CRISPR/Cas9, we generated the patient-specific PIEZO2 allele (p.R2718P) in C. elegans, named pezo-1(R2405P). To compare this patient-specific allele with that of our null alleles, and to determine the phenotypic consequences of a patient-specific allele, homozygous animals carrying the pezo-1(R2405P) mutation were created. Such homozygotes displayed reproductive defects similar to the pezo-1^ko mutants, including reduced ovulation rates, ooplasmic uterine masses (Figure 9B), and reduced brood sizes (Figure 9C). In addition, the phenotypes of pezo-1(R2405P) homozygotes were mildly enhanced in combination with itr-1 RNAi and suppressed with lfe-2 RNAi, consistent with our findings with pezo-1^ko mutants (Figure 9D). Interestingly, similar to the rescue assay in pezo-1 CΔ, the reduced ovulation rate in pezo-1(R2405P) was also significantly rescued by spe-9(hc52ts) sperm, suggesting that this variant of pezo-1 may similarly disrupt ovulation and sperm-to-sheath signaling, leading to self-sterility (Figure 9E). Overall, these observations support the idea that C. elegans is an appropriate model system for the study of PIEZO diseases. Future suppressor screens with this and other pezo-1 patient-specific alleles should help to identify other genetic interactors.

Figure 9

Download asset Open asset

The *PIEZO1* disease allele causes severe brood size reduction in *C. elegans.*

(A) Sequence alignment showing arginine 2405 (R2405) in *C. elegans* PEZO-1 is highly conserved with human and mouse PIEZO1 and PIEZO2. (B) A conserved patient-specific allele, *pezo-1(R2405P)*, was generated and causes uterine ooplasmic masses and (C) a severe reduction in brood size. (D) *itr-1(RNAi)* enhanced the brood size reduction of *pezo-1(R2405P)* mutants, while *lfe-2(RNAi)* slightly rescued the reduced brood size. (E) *spe-9(hc52ts)* sperm rescued the very low ovulation rate in *pezo-1(R2405P)* hermaphrodites. P-values: *, p=0.0393 (D); **, p=0.0079 (D); ****, p<0.0001 (C) (t-test).

Figure 9—source data 1 Quantification of brood size in mutants for the patient-specific allele pezo-1(R2405P) and the genetic interaction of pezo-1(R2405P) with the RNAi depletion of calcium regulators.: https://cdn.elifesciences.org/articles/53603/elife-53603-fig9-data1-v3.xlsx
Download elife-53603-fig9-data1-v3.xlsx

Discussion

The PIEZO proteins are responsible for sensing mechanical stimuli during physiological processes. Most studies of PIEZOs have focused on electrophysiological assays in cultured cells. To take advantage of an in vivo system to investigate the developmental roles of the PIEZO channel in mechanotransduction, we generated deletion alleles as well as a patient-specific allele in the sole C. elegans pezo-1 gene. The C. elegans reproductive system is an tubular system that is attractive for studies of PIEZO function and for mimicking the PIEZO patient-specific alleles, which are known to disrupt the normal physiological functioning of the cardiovascular, musculoskeletal, and blood systems in humans (Albuisson et al., 2013; Alper, 2017; Andolfo et al., 2013; Bae et al., 2013). Although the PEZO-1 protein is broadly expressed throughout the animal, we focused on the reproductive system because of its striking phenotypes. Utilizing different pezo-1 mutants and the tissue-specific degradation of PEZO-1, our data indicate that dysfunction of pezo-1 led to a significantly reduced brood size. This reduced brood size phenotype worsens with age. In C. elegans, the reproductive process incorporates a series of sequential events, including proper ovulation, fertilization, expulsion of the fertilized zygote into the uterus, and sperm navigation back to the spermatheca after each fertilization event, all of which are regulated by multiple inter-tissue signaling pathways.

PEZO-1 channel regulates ovulation and expulsion of the fertilized zygote possibly by maintaining cytosolic Ca²⁺ homeostasis

Ovulation is driven by the rhythmic and coordinated contraction of the gonadal sheath cells and the opening of the spermathecal distal valve (McCarter et al., 1999). Similarly, expulsion of the fertilized zygote into the uterus is achieved by the contraction of the spermatheca and the opening of the spermathecal-uterine valve. Mutations in the pezo-1 gene cause dramatic effects on this entire process. We observed sheath cell defects such that the mature oocyte was not properly pushed into the spermatheca. In addition, spermathecal valve defects either inhibited proper entry of the oocyte into the spermatheca, or proper exit. In many cases, the oocyte was crushed as it progressed through the spermatheca, resulting in accumulation of ooplasm in the uterus. Genetic interactions between pezo-1 mutants and itr-1 or lfe-2 RNAi support the idea that pezo-1 may play a role in maintaining Ca²⁺ homeostasis during ovulation and zygote expulsion from the spermatheca. This is consistent with previous studies showing PIEZO1 responses to mechanical stimuli through Ca²⁺ signaling (He et al., 2018; Li et al., 2014).

On the basis of the present studies, we hypothesize a few possible pathways for a Ca²⁺-mediated response to mechanical stimuli to which PEZO-1 may contribute. One possibility is that PEZO-1 may detect when cytosolic Ca²⁺ levels are extremely low and might replenish the cell with extracellular Ca²⁺, in a manner similar to that involving the CRAC channel ORAI-1 (Lorin-Nebel et al., 2007). Consistent with this idea, our genetic data revealed an enhancement of the pezo-1 phenotype upon CRAC channel orai-1 RNAi, which is responsible for replenishing cytosolic Ca²⁺ (Figure 4C). This suggests that PEZO-1 and ORAI-1 act in parallel pathways to replenish cytosolic Ca²⁺.

Previous studies identified the ER Ca²⁺ pump sarco/endoplasmic reticulum Ca²⁺ ATPase (SERCA) as an interacting partner of PIEZO1, which suppresses PIEZO1 activation (Zhang et al., 2017). SERCA is essential for recycling Ca²⁺ into SR/ER Ca²⁺ stores, which is an important process for maintaining Ca²⁺ homeostasis during tissue contractility (Periasamy and Huke, 2001; Zwaal et al., 2001). PIEZO1 has been reported to be involved in integrin activation to recruit the small GTPase R-Ras to the ER, which promotes Ca²⁺ release from an intracellular store to the cytosol (McHugh et al., 2010). These observations suggest that PEZO-1 may act as an ER Ca²⁺ channel to regulate ER Ca²⁺ homeostasis.

Last, normal spermathecal GCaMP fluorescence was observed during the first three ovulations in pezo-1 mutants, suggesting that other Ca²⁺ or mechanosensitive channels may perform redundant functions during Ca²⁺ influx. One alternative model could be that PEZO-1 acts in parallel to these Ca²⁺ regulators and yet does not have a direct role in calcium homeostasis itself. Future studies will be required to resolve the precise molecular effect of PEZO-1 on Ca²⁺ and to understand how PEZO-1 regulates inter/intra cellular communication with/without Ca²⁺ and potentially how other interacting partners coordinate during these processes.

PEZO-1 channel is required for sperm navigation

C. elegans employs multiple peptide and lipophilic hormones to coordinate different tissues during reproduction. Ovulation is initiated by MSP (major sperm proteins) signaling derived from sperm to trigger oocyte maturation and sheath cell contraction (Kuwabara, 2003; McCarter et al., 1999; Miller, 2001). After each fertilization event, oocytes secrete F-series prostaglandins (F-PGs) into the extracellular environment of the reproductive tract and stimulate sperm attraction back to the spermatheca (Hoang et al., 2013). Our observations revealed a strong expression of PEZO-1 on the plasma membranes of both oocytes and sperm. Dysfunction of pezo-1 causes a severe reduction of the ovulation rate and defective sperm navigation back to the spermatheca in aged animals. Male mating significantly rescued the very low ovulation rate in pezo-1 mutants, as did the injection of purified fluorescently tagged MSP. Furthermore, the sperm navigation defects were observed in the germline-specific degradation of PEZO-1 animals, which showed fewer sperm successfully navigating back to the spermatheca. Collectively, depletion of PEZO-1 disrupted the ability of sperm to navigate back to the spermatheca, which may contribute to the reduced ovulation rate and defective sheath cell contraction.

Working model

Our study supports the working model that PEZO-1 functions to promote the sheath cell contractions that push the oocyte into the spermatheca as the first step in ovulation (Figure 10, step 1). Simultaneously, PEZO-1 may play a role in sensing the sheath cell contractions and in triggering the spermathecal distal valve to open to allow oocyte entry into the spermatheca. During fertilization, the distal and spermathecal-uterine valves have to remain closed, which is probably influenced by PEZO-1 (Figure 10, step 2). After fertilization, PEZO-1 regulates the spermathecal tissues and controls the sp-ut valve to trigger a series of events to expel the fertilized oocyte into the uterus. Last, PEZO-1 appears to function in the attraction of the sperm back into the spermatheca after being pushed out by the exiting of the newly fertilized oocyte (Figure 10, step 3). Thus, dysfunction of PEZO-1 may contribute to multiple defects in all of these steps, including failure of oocyte entry into the spermatheca, the crushing of oocytes as they transit through the ovary and spermatheca, and defective sheath-to-sperm signaling that perturbs the ability of sperm to crawl back into the spermatheca after each ovulation (Figure 10). Future studies are underway to determine the PEZO-1 function in each tissue (sheath, spermatheca, oocyte, and sperm) more precisely using even more cell-specific promoters in the AID degradation system.

Figure 10

Download asset Open asset

Working model for PEZO-1 during ovulation.

Step One: PEZO-1 regulates somatic sheath cells and the spermathecal distal valve to push the oocyte into the spermatheca. Once a matured oocyte is ready for ovulation, PEZO-1 (red trapezoids) on the somatic sheath cells (yellow) triggers the contraction of the sheath to push the oocyte into the dilating spermatheca, through the distal valve. Meanwhile, the activated PEZO-1 (red trapezoids) on the distal valve (yellow) keeps the valve open and allows oocyte entry the spermatheca (green). Step Two: during fertilization, the PEZO-1 (red trapezoids) coordinates both distal (yellow) and spermathecal-uterine valves (yellow) to remain closed for 3–5 min. Step Three: After fertilization, PEZO-1 (red trapezoids) is activated on the spermathecal bag cells (yellow) and the sp-ut valve (yellow) to trigger a series of mechanical events (including spermathecal contractions and sp-ut valve opening) to expel the fertilized oocyte into the uterus (green). After oocyte entry into the uterus, we speculate that the PEZO-1 (red trapezoids) on the oocyte (far left) also functions to attract the sperm (green cells) back to the spermatheca. The precise mechanism of how PEZO-1 regulates sperm attraction remains unknown. Dysfunction of PEZO-1 causes the oocytes to be crushed as they are pushed into (Step 1) and expelled from the spermatheca (Step 3). The yellow represents the tissues that are under mechanical tension at each step during ovulation. PEZO-1 probably functions at the plasma membrane to sense the mechanical stimuli and to trigger intracellular signaling. The black arrows indicate the direction of extracellular cation influx when PEZO-1 channels are activated.

Modeling PIEZO diseases in the C. elegans reproductive system

Clinical reports indicate that either gain-of-function or loss-of-function mutations in human PIEZO1 and PIEZO2 cause a variety of physiological disorders (Alper, 2017). Interestingly, both gain-of-function and loss-of-function missense mutations were identified in the same PIEZO disease, such as hydrops fetalis and lymphatic dysplasia. However, the molecular mechanism underlying both extremes of PIEZO channel dysfunction remains unclear (Alper, 2017). Complete knockout of PIEZO1 and PIEZO2 in mammalian models results in embryonic lethality and fetal cardiac defects, suggesting an important role of PIEZO1/2 in embryonic and cardiac development (Ranade et al., 2014; Zhang et al., 2019). However, the lack of surviving homozygous PIEZO1/2 mutants in mammalian models makes it challenging to investigate the PIEZO function during embryogenesis and development.

A DA5 patient-specific allele in the C. elegans pezo-1 gene displayed reproductive phenotypes that were identical to those of our pezo-1 deletion mutants, suggesting that this allele must be loss-of-function. The observation that our pezo-1 deletion strains and a putative patient-specific gain-of-function mutation both lead to reproductive defects suggests that either hypomorphic or hypermorphic PEZO-1 channel activity is harmful. Therefore, our study demonstrates the usefulness of C. elegans as a model system to investigate PIEZO-derived human diseases.

The phenotypes described here in C. elegans do not exactly resemble those of the PIEZO-derived human diseases, but there are similarities at the cellular level that may be relevant to the human diseases. Stretch-sensitive channels from the Piezo family are important for vascular development and lymphatic valve formation. In zebrafish, Piezo channels sense fluid flow to regulate both endothelial and smooth muscle cell maturation and heart valve development (Duchemin et al., 2019). In mice, PIEZO1 is required for the formation of lymphatic valves, a key structure for proper lymphatic circulation in the body (Nonomura et al., 2018). However, both the mechanisms by which Piezo proteins operate and the proteins with which they interact remain unclear. In our study, we introduce a facile in vivo system for the study of PEZO-1 in the reproductive tract of C. elegans, a tubular tissue (spermatheca) with valves (spermatheca-uterine valve and distal valve) that must sense the incoming and exiting oocyte during ovulation and fertilization. The formation and function of these structures are probably conserved between humans and C. elegans.

The dramatic reduction in brood size that we observed in all of our pezo-1 mutants will allow us to screen plausible chemical antagonists and agonists for PIEZO1 and PIEZO2 patient-specific alleles in vivo. In summary, we have demonstrated that the C. elegans PIEZO1/2 ortholog pezo-1 is required for efficient reproduction, and demonstrate the utility of C. elegans for the study of PIEZO functions. Future studies will determine whether other patient-specific alleles disrupt ovulation and sperm navigational signaling. Using promoters with more restricted expression patterns, the tissue-specific degradation system used in this report will also allow us to further dissect the cells or tissues that influence each of the phenotypes that we observed in this study. Future genetic and FDA-approved drugs screens will be used to identify putative suppressors in pezo-1 mutants. These screens may provide insightful approaches for future clinical therapy.

Materials and methods

C. elegans strains used in this study

Request a detailed protocol

C. elegans strains were maintained with standard protocols. Strain information is listed in Table 1. AG493, AG494 and AG495 were created by crossing AG487 (pezo-1::Degron) males with hermaphrodites containing ieSi65 [Psun-1::tir1::sun-1 3′UTR + Cbr-unc-119(+)] II, ieSi57 [Peft-3::tir1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II, and fxIs1[Ppie-1::tir1::mRuby] I, respectively. We screened the F₃ adults for the presence of the tir-1::mRuby transgene by microscopy and genotyped for the pezo-1::Degron by PCR. AG532 was created by crossing pezo-1(av146 [gfp::pezo-1]) IV males with the unc-119(ed3); pwIs98 [YP170::tdimer2 + unc-119(+)] III hermaphrodites containing YP170::tdimer2. F₃ adults with YP170::tdimer2 were genotyped by PCR screening for the pezo-1^KO allele.

Table 1

C. elegans strains list in the study.

	Strain	Genotype
Figure 1	AG404	pezo-1(av142[mScarlet::pezo-1]) IV, CRISPR/Cas9 edit
	AG408	pezo-1(av146 [gfp::pezo-1]) IV, CRISPR/Cas9 edit
	AG483	pezo-1(av182 [pezo-1::mScarlet]) IV, CRISPR/Cas9 edit
Figure 2	N2	Bristol (wild-type)
	AG406	pezo-1(av144[N-∆]) IV, CRISPR/Cas9 edit, deletion of exon 1–13 and introns
	AG416	pezo-1(av149[C-∆]) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
	AG530	pezo-1(av149[C-∆]) IV; ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III
	AZ212	ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III
Figure 3	N2	Bristol (wild-type)
	AG416	pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
	LP598	dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X, CRISPR/Cas9 edit
	AG491	pezo-1(av149) IV; dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X
Figure 4	N2	Bristol (wild-type)
Figure 4	AG416	pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
Figure 5	UN1108	xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II
	AG414	pezo-1(av144) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II
	AG415	pezo-1(av149) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II
	AG448	pezo-1(av142 [mScarlet::pezo-1]) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II
Figure 6	N2	Bristol (wild-type)
	AG406	pezo-1(av144) IV, CRISPR/Cas9 edit, deletion of exon 1–13 and introns
	AG416	pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
	AG531	spe-9(hc52ts) I; him-8(e1489) IV
	BA17	fem-1(hc17ts) IV
	CB1489	him-8(e1489) IV
Figure 7	N2	Bristol (wild-type)
Figure 7	AG416	pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
Figure 8	N2	Bristol (wild-type)
	AG487	pezo-1(av190 [pezo-1::degron]) IV, CRISPR/Cas9 edit
	AG493	pezo-1(av190 [pezo-1::degron]) IV; ieSi65 [sun-1p::TIR1::sun-1 3’UTR + Cbr-unc-119(+)] II; unc-119(ed3) III
	AG494	pezo-1(av190 [pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
	AG495	pezo-1(av190[pezo-1::degron]) IV; fxIs1[pie-1p::TIR1::mRuby] I
	AG564	fxIs1[pie-1p::TIR1::mRuby] I
	AG565	ieSi65 [sun-1p::TIR1::sun-1 3’UTR + Cbr-unc-119(+)] II; unc-119(ed3) III.
	AG566	ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
Figure 9	N2	Bristol (wild-type)
	AG437	pezo-1(av165[R2405P]) IV, CRISPR/Cas9 edit.
	AG531	spe-9(hc52ts) I; him-8(e1489) IV
Figure 1—figure supplement 1	AG404	pezo-1(av142 [mScarlet::pezo-1]) IV, CRISPR/Cas9 edit
	AG408	pezo-1(av146 [gfp::pezo-1]) IV, CRISPR/Cas9 edit
	AG483	pezo-1(av182 [pezo-1::mScarlet]) IV, CRISPR/Cas9 edit
Figure 2—figure supplement 1	N2	Bristol (wild-type)
	AG406	pezo-1(av144) IV, CRISPR/Cas9 edit, deletion of exon 1–13 and introns
	AG416	pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
	PS8111	pezo-1(sy1199) IV, CRISPR/Cas9 edit, Stop-cassette
	PS8546	pezo-1(sy1398) IV, CRISPR/Cas9 edit, deletion of the first exon of isoforms i and j
	AG570	pezo-1(av240) IV, CRISPR/Cas9 edit, deletion of full length of pezo-1
Figure 5—figure supplement 1	UN1108	xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II
	AG414	pezo-1(av144) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II
	AG415	pezo-1(av149) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II
Figure 6—figure supplement 1	AG494	pezo-1(av190 [pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
	AG416	pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
	BA17	fem-1(hc17ts) IV
	AG571	pezo-1(av149) IV; fem-1(hc17ts) IV
Figure 8—figure supplement 1	AG493	pezo-1(av190 [pezo-1::degron]) IV; ieSi65 [sun-1p::TIR1::sun-1 3’UTR + Cbr-unc-119(+)] II; unc-119(ed3) III
	AG494	pezo-1(av190 [pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
	AG495	pezo-1(av190[pezo-1::degron]) IV; fxIs1[pie-1p::TIR1::mRuby] I
Figure 8—figure supplement 2	AG582	pezo-1(av241 [gfp::pezo-1::degron]) IV, CRISPR/Cas9 edit
	AG567	pezo-1(av241 [gfp::pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
	AG568	pezo-1(av241 [gfp::pezo-1::degron]) IV; fxIs1[pie-1p::TIR1::mRuby] I
	AG569	pezo-1(av241 [gfp::pezo-1::degron]) IV; ieSi65 [sun-1p::TIR1::sun-1 3′UTR + Cbr-unc-119(+)] II; unc-119(ed3) III
Figure 8—figure supplement 3	AG494	pezo-1(av190 [pezo-1::degron]) IV; ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II
Video 1	AG408	pezo-1(av146 [gfp::pezo-1]) IV, CRISPR/Cas9 edit
Video 2	N2	Bristol (wild-type)
Video 2	AG406	pezo-1(av149)] IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
Video 3	LP598	dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X, CRISPR/Cas9 edit
Video 3	AG491	pezo-1(av149) IV; dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X
Video 4	AG406	pezo-1(av149) IV, CRISPR/Cas9 edit, deletion of exon 27–33 and introns
Video 5	AG448	pezo-1(av142 [mScarlet::pezo-1]) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II
Video 6	UN1108	xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II
Video 6	AG415	pezo-1(av149) IV; xbIs1101 [fln-1p::GCaMP3; pRF4(rol-6^D(su1006))] II

RNAi treatment

Request a detailed protocol

The RNAi-feeding constructs were obtained from the Ahringer and Vidal libraries (Fraser et al., 2000; Rual et al., 2004). RNAi bacteria were grown until log phase was reached and spread on MYOB plates containing 1 mM IPTG and 25 μg/ml carbenicillin and incubated overnight. To silence the target genes itr-1 and lfe-2, mid-L4 hermaphrodites were picked onto plates with the IPTG-induced bacteria. Animals were grown on RNAi plates at 20°C for 36–60 hr. In order to improve the RNAi penetrance of orai-1 and sca-1, L1 hermaphrodites were picked for RNAi-feeding assays. Alternatively, mid-L4 hermaphrodites were incubated on the orai-1 or sca-1 RNAi plates for one generation, and F₁ mid-L4 hermaphrodites were moved to fresh RNAi plates for brood size assays.

Brood size determinations and embryonic viability assays

Request a detailed protocol

Single mid-L4 hermaphrodites were picked onto 35 mm MYOB plates seeded with 10 μl of OP50 bacteria and allowed to lay eggs for 36 hr (plate one contains the brood size from 0 to 36 hr post mid-L4). The same hermaphrodite was moved to a new 35 mm MYOB plate to lay eggs for another 24 hr and then were removed from the plate (this plate contains the brood size from 36 to 60 hr post mid-L4). Twenty-four hours after removing the mothers, only fertilized embryos and larvae were counted to determine brood size. Brood sizes were determined at 36 hr and 60 hr. Percentage of embryonic viability = (the number of hatched larva/the total brood size) *100%.

BODIPY 493/503 staining

Request a detailed protocol

BODIPY 493/503 (Invitrogen # D3922) was dissolved in 100% DMSO to 1 mg/ml. BODIPY stock was diluted by M9 to 6.7 μg/ml BODIPY (final concentration of DMSO was 0.8%) as the working stock. Hermaphrodites were washed in M9 three times and incubated in 6.7 μg/ml BODIPY for 20 min and then washed again in M9 at least three times. All washes and incubations were performed in a concavity slide (ThermoFisher, # S99369). The stained hermaphrodites were anesthetized with 0.1% tricaine and 0.01% tetramisole in M9 buffer for 15–30 min. The anesthetized animals were then transferred to a 5% agarose pad for imaging. Image acquisition was captured using a Nikon 60 × 1.2 NA water objective with 1 μm z-step size.

Whole-animal DAPI staining

Request a detailed protocol

Animals were washed in M9 in a concavity slide, and then transferred to 1 μl of egg white/M9/azide on SuperFrost slides (Daigger # EF15978Z). Alternatively, animals were directly picked from plates into egg white/M9/azide, trying not to carry over too much bacteria. With an eyelash, buffer around animals was spread out to a very thin layer, until the animals were almost desiccated onto the slide. Slides were immersed in a Coplin jar containing Carnoy’s fixative and fixed for a minimum of 1.5 hr or for as long as one week at room temperature or 4°C. Sequential ethanol (EtOH) rehydration was carried out in coplin jars containing about 50 ml of the following solutions for 2 min each: 90% EtOH in water, 70% EtOH in water, 50% EtOH in PBS, 25% EtOH in PBS, and PBS alone. Slides were then immersed in coplin jars containing DAPI stain (1 μg/ml) in PBS for 10 min. Slides were rinsed three times, 5 min each, in PBS. A drop of Vectashield mounting medium (#H-1500–10) was added, as was a coverslip, followed by nail polish to seal the coverslip. Image acquisition was captured by a Nikon 60 × 1.2 NA water objective with 1 μm z-step size.

Yoda-1 dietary supplementation

Request a detailed protocol

Yoda1 (Tocris # 5586) was dissolved in DMSO to a stock concentration of 2.5 mM. This stock was added to 100 ml MYOB medium to a final concentration of 20 µM. Single mid-L4 hermaphrodites were picked onto 35 mm Yoda1-supplemented MYOB plates and control DMSO-only MYOB plates, each seeded with 10 μl of OP50 bacteria and allowed to lay eggs for 36 hr (plate one contains the brood from 0 to 36 hr post mid-L4). Each hermaphrodite was moved to a new 35 mm MYOB plate (with or without Yoda1) to lay eggs for another 24 hr and then was removed from the plate (this plate contains the brood from 36 to 60 hr post mid-L4). Twenty-four hours after removing the mothers, only fertilized embryos and larvae were counted to determine the brood size. Brood sizes were determined at 60 hr. Percentage of embryonic viability = (the number of hatched larva/the total number of hatched and unhatched animals) *100%.

Live imaging to determine ovulation rates

Request a detailed protocol

For imaging ovulation, animals were immobilized on 4% agar pads with anesthetic (0.1% tricaine and 0.01% tetramisole in M9 buffer). DIC image acquisition was captured by a Nikon 60 × 1.2 NA water objective with 1–2 μm z-step size; 10–15 z planes were captured. Time interval for ovulation imaging was every 45–60 s, and duration of imaging was 60–90 min. Ovulation rate = (number of successfully ovulated oocytes)/total image duration.

CRISPR design

Request a detailed protocol

We used the Bristol N2 strain as the wild type for CRISPR/Cas9 editing. The gene-specific 20-nucleotide sequences for crRNA synthesis were selected with the help of a guide RNA design checker from Integrated DNA Technologies (IDT) (https://www.idtdna.com) and were ordered as 20 nmol or 4 nmol products from Dharmacon (https://dharmacon.horizondiscovery.com), along with tracrRNA. Repair template design followed the standard protocols (Paix et al., 2015; Vicencio et al., 2019). Approximately 30 young gravid animals were injected with the prepared CRISPR/Cas9 injection mix, as described in the literature (Paix et al., 2015). pezo-1 NΔ and pezo-1 CΔ mutants were generated by CRISPR/Cas9 mixes that contained two guide RNAs at flanking regions of pezo-1 coding regions. Heterozygous pezo-1 deletion animals were first screened by PCR and then homozygosed in subsequent generations. mScarlet insertions at the pezo-1 C-terminus were performed by Nested CRISPR (Vicencio et al., 2019). Homozygous nest-1 edited animals were confirmed by PCR and restriction enzyme digestion and selected for the secondary CRISPR/Cas9 editing. Full-length mScarlet insertion animals were screened by PCR and visualized by fluorescence microscopy. All homozygous animals edited by CRISPR/Cas9 were confirmed by Sanger sequencing (Eurofins). The detailed sequence information for the repair template and guide RNAs are listed in Table 2.

Table 2

List of the sequence for the CRISPR design.

Strain	Genotype	Description	Sequence name	Sequence 5′−3′		PAM
AG406	pezo-1 (av144) IV	Deletion of exons 1–13 and introns of pezo-1	crRNA N-terminus	ACACAGCAACAACAGAATGA		CGG
			crRNA C-terminus	TGGGGGTGTTGCAGTGGCTA		AGG
			Repair template	atctgaatcggtggtcgtaacacagcaacaacagagtttgacacattttccgttgagacttgaaaaatag
			Genotyping F₁	GCGGTAAATCTGAATCGGTGG
			Genotyping R₁	TTGGAAAAGCAGGCACAACC
			Genotyping internal	CGATCCAGCGTGGATGAACT
AG416	pezo-1 (av149) IV	Deletion of exons 27–33 and introns of pezo-1	crRNA N-terminus	CGGTGGCAGCGTACATTATC		TGG
			crRNA C-terminus	CACCAGCGACACTCATCGAA		TGG
			Repair template	tccagtctcccatatttattttttttctgttccagTAGATAAGTAAGAGCAAAAAGAAGCAAGAATAA
			Genotyping F₁	AATCTGACTTGTGCCCTCCG
			Genotyping R₁	AATCAGGCGAGCAGTGAGAG
			Genotyping internal	TCCACAGTCAATTCCTGCGT
AG404	pezo-1(av142 [mScarlet::pezo-1]) IV	Knock in mScarlet at N-terminus of pezo-1, mScarlet was amplified from plasmid pMS050	crRNA	ACACAGCAACAACAGAATGA		CGG
			Repair template F₁	tgaatcggtggtcgtaacacagcaacaacagaATG CTTGTAGAGCTCGTCCATTCC (mScarlet)
			Repair template R₁	AATTTGACGACGCACGATTTTAAAAGCGGCGGGACTGT CTTGTAGAGCTCGTCCATTCC (mScarlet)
AG408	pezo-1(av146 [gfp::pezo-1]) IV	Knock in GFP at N-terminus of pezo-1, GFP was amplified from plasmid pDD282	crRNA	ACACAGCAACAACAGAATGA		CGG
			Repair template F₁	tgaatcggtggtcgtaacacagcaacaacagaATG agtaaaggagaagaattgttc (GFP)
			Repair template R₁	AATTTGACGACGCACGATTTTAAAAGCGGCGGGACTGT CTTGTAGAGCTCGTCCATTC (GFP)
AG483	pezo-1(av182 [pezo-1::mScarlet]) IV.	Knock in mScarlet at C-terminus of pezo-1, mScarlet was amplified from plasmid pMS050	NEST1 crRNA	CACCAGCGACACTCATCGAA		TGG
			Repair template	AATATTCCTGTTCCGATCACCAGCGACACTCATCGAATGGACTCGTATGAGTAAGAAAAAACAGGAG GTCTCCAAGGGAGAGGCCGTCATCAAGGAGTTCATGCGTTTCAAGGTCCAAGCGCTCCGAGGGACGTCACTCCACCGGAGGAATGGACGAGCTCTACAAGTAAatttaaatatttcactgtcaaatattctgcga (mScarlet)
			Genotyping F₁	TGGTTCGAGAAGCGAAGGAC
			Genotyping R₁	aatcaggcgagcagtgagag
			NEST2 crRNA	TTCAAGGTCCAAGCGCTCCG		AGG
			Repair template F₁	GCCGTCATCAAGGAGTTCATGCGTTTCAAGGTCCACATGGAGGGATCCATGAACG
			Repair template R₁	TAGAGCTCGTCCATTCCTCCGGTGGAGTGACGTCCTTCTGAACGCTCGTATTGCTCGACGACGGTG
AG487	pezo-1(av190 [pezo-1::degron]) IV	Knock in Degron sequence at C-terminus of pezo-1, Degron was amplified from plasmid pK0132	crRNA	CACCAGCGACACTCATCGAA	TGG
			Repair template F1	AATATTCCTGTTCCGATCACCAGCGACACTCATCGAATGGACTCGTATGAGTAAGAAAAAACAGGAGggagcatcgggagcctcaggagcatcg (linker)GACTACAAAGACCATGACGGTG (Degron)
			Repair template R₁	tcgcagaatatttgacagtgaaatatttaaatTTACTTCACGAACGCCGCC (Degron)
AG437	pezo-1(av165[R2405P]) IV	Generate a point mutation R2405P in pezo-1	crRNA	CTATTTGGTTCGAGAAGCGA	AGG
AG437	pezo-1(av165[R2405P]) IV	Generate a point mutation R2405P in pezo-1	Repair template	CATCTTCTCAAAATTTGTCTCGACATCTATTTGGTACCAGAAGCGAAAGACTTCATGTTGGAGCAGgtaattatttagtttta
AG570	pezo-1(av240) IV	Deletion of full length of pezo-1	crRNA1	ACACAGCAACAACAGAATGA	CGG
			crRNA2	CACCAGCGACACTCATCGAA	TGG
			Repair template	ctgaatcggtggtcgtaacacagcaacaacagaATGTAGATAAGTAAGAGCAAAAAGAAGCAAGAATAAatttaaatatttc
AG571	pezo-1(av242) IV	Deletion of exons 27–33 and introns of pezo-1 in fem-1(hc17)	crRNA1	CGGTGGCAGCGTACATTATC	TGG
			crRNA2	CACCAGCGACACTCATCGAA	TGG
			Repair template	tccagtctcccatatttattttttttctgttccagTAGATAAGTAAGAGCAAAAAGAAGCAAGAATAA
AG582	pezo-1(av241) IV	Knock in Degron sequence at C-terminus of pezo-1 in AG404,Degron was amplified from plasmid pK0132	crRNA	CACCAGCGACACTCATCGAA	TGG
			Repair template F₁	AATATTCCTGTTCCGATCACCAGCGACACTCATCGAATGGACTCGTATGAGTAAGAAAAAACAGGAGggagcatcgggagcctcaggagcatcg (linker)GACTACAAAGACCATGACGGTG (Degron)
			Repair template R₁	tcgcagaatatttgacagtgaaatatttaaatTTACTTCACGAACGCCGCC (Degron)
PS8111	pezo-1(sy1199) IV	Knock in a stop cassette at C-terminus of pezo-1	crRNA	CCAGAAGCTCGTAAGCCAGG	AGG
			Repair template	cttatcgctgtttctgaaccagaagctcgtaagccGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcaggaggcactgaagaaacggatggtgatgaag
			Genotyping F1	GACAGGACTTTCCCGCCAACTTAA
			Genotyping R₁	ATCATTCGCCGATTGCACAAGTTG
PS8546	pezo-1(sy1398) IV	Deletion of the first exon of pezo-1 isoforms i and j	crRNA1	gagaacttgaattcaatgg	AGG
			crRNA2	aagcttcttccgtctccgg	CGG
			crRNA3	gcagtatttgaccaactgg	TGG
			crRNA4	ataaaacaaggcaaccagg	GGG
			Genotyping F₁	CTCTCGCCTATCCACTTGAGCTTA
			Genotyping R₁	GGAAACAATTGAGCCGAGAATGGA

Note: Capital letters represent the ORF or exon sequence, small letters indicate the intron sequence. Bolded letters indicate the optimized bases needed for the CRISPR design.

The short isoform deletion, pezo-1(sy1398), was generated using Cas9 expressed from a plasmid (Friedland et al., 2013) and four guides (GAGAACTTGAATTCAATGG, AAGCTTCTTCCGTCTCCGG, GCAGTATTTGACCAACTGG, ATAAAACAAGGCAACCAGG) along with a dpy-10 guide and repair oligo. These reagents were injected into young adult N2 animals, and successful injections were identified by the presence of roller or dumpy progeny on the plate. Roller progeny were singled out and screened via PCR for the deletion mutation. The deletion was verified by Sanger sequencing using two external primers (CTCTCGCCTATCCACTTGAGCTTA and GGAAACAATTGAGCCGAGAATGGA) to amplify the region. This deletion should only disrupt the expression of isoforms i and j (Figure 2—figure supplement 1B). The CRISPR-Cas9 STOP-IN mutant, pezo-1(sy1199), was generated using purified Cas9 protein at 10 μg/μl concentration, a purified guide RNA near the mutation location (CCAGAAGCTCGTAAGCCAGG), and a single-stranded DNA repair oligo containing three stop codons, one in every reading frame (underlined, cttatcgctgtttctgaaccagaagctcgtaagccGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcaggaggcactgaagaaacggatggtgatgaag). These reagents were injected into N2 young adults along with a dpy-10 guide and repair oligo. Successful injections were identified by the presence of dumpy and roller progeny. Thirty roller progeny were singled out from ‘jackpot’ plates (plates with a high incidence of dumpy and roller progeny) and screened via PCR (GACAGGACTTTCCCGCCAACTTAA and ATCATTCGCCGATTGCACAAGTTG) and the presence of a NheI restriction site that was included in the repair oligo.

Male mating assay with Day 3 hermaphrodites

Request a detailed protocol

25–30 mid-L4 wildtype or pezo-1 mutant hermaphrodites were isolated to a fresh growth plate for 60 hr (such animals should be Day 3 adults at this time). To ensure mating success, ~30 adult males and 10–15 Day 3 hermaphrodites were transferred onto a 35 mm MYOB plate seeded with 10–20 μl of OP50 bacteria and allowed to mate for 12 hr. The other 10–15 Day 3 hermaphrodites were singled and transferred to 35 mm MYOB plates seeded with 10 μl of OP50 bacteria as the controls. After the group mating, single mated hermaphrodites (72 hr post mid-L4) and 3–5 adult males were then transferred to a fresh 35 mm growth plate where mating could continue for another 24 hr. After 24 hr, the hermaphrodites (96 hr post mid-L4) and males were removed. The brood size (those embryos laid between 72–96 hr post mid-L4) and embryonic viability were determined 24 hr later after removal of all adults. Meanwhile, the broods from 60 to 96 hr post-mid L4 were also determined for the other 10–15 unmated Day 3 hermaphrodites that were kept on single plates as controls.

Mating assay with the fem-1 mutant

Request a detailed protocol

10–15 mid-L4 BA17 fem-1(hc17ts) hermaphrodites raised from embryos at the non-permissive temperature of 25°C were picked to mate with ~30 adult males for 12 hr at 25°C. Single mated hermaphrodites and 3–5 males were then transferred to a fresh 35 mm growth plate and allowed to mate for another 24 hr at 25°C before all adults were removed from the plates. As control, 10–15 unmated BA17 hermaphrodites grown at 25°C were kept on single plates. The brood sizes and embryonic viability were determined 24 hr later. Alternatively, 10–15 L1 BA17 fem-1(hc17ts) hermaphrodites were isolated on a fresh growth plate and incubated at 25°C for 48 hr (young adult hermaphrodites). Approximately 30 adult males and 10–15 BA17 young hermaphrodites were then transferred onto a 35 mm MYOB plate seeded with 10–20 ul of OP50 bacteria and allowed to mate for 12 hr at 25°C. Single mated hermaphrodites and 3–5 males were then transferred to a fresh 35 mm growth plate. After laying embryos for 24 hr, the hermaphrodites and males were removed. Meanwhile, the other same-age 10–15 unmated Day 3 hermaphrodites were kept on single plates as the control. The brood size and embryonic viability were counted 24 hr later after removal of all adults. All of the animals were incubated at 25°C during mating and propagation to ensure the penetration of the fem-1(hc17ts) phenotype.

Mating assay with the spe-9 mutant

Request a detailed protocol

10–15 hermaphrodites were picked to mate with ~30 AG521 [spe-9(hc52ts)] adult males for 12 hr at 25°C. Mated hermaphrodites were immobilized on 4% agar pads with anesthetic (0.1% tricaine and 0.01% tetramisole in M9 buffer) for ovulation rate assays. The acquisition of DIC images was performed by confocal imaging system (see below) with a Nikon 60 × 1.2 N with 1–2 μm z-step size and 10–15 z planes. Time interval for ovulation imaging is every 45–60 s, and the duration of imaging is 60–90 min. Ovulation rate = (number of successfully ovulated oocytes)/total image duration.

Sperm distribution assay and mating assay

Request a detailed protocol

MitoTracker Red CMXRos (MT) (Invitrogen # M7512) was used to label male sperm following the protocol adapted from previous studies (Hoang et al., 2013; Kubagawa et al., 2006). MT was dissolved in 100% DMSO to 1 mM. About 100 males were transferred to a concavity slide (ThermoFisher, # S99369) with 150 μl 10 μM MT solution (diluted in M9 buffer). Males were incubated in the MT buffer for 2 hr and then transferred to fresh growth plates to recover overnight. The plates were covered by foil to prevent light exposure. About 30 males were placed with 10 anesthetized hermaphrodites (0.1% tricaine and 0.01% tetramisole in M9 buffer) on MYOB plates seeded with a 50–100 μl OP50 bacteria. After 30 min of mating, hermaphrodites were then isolated and allowed to rest on food for one hour. The mated hermaphrodites were then mounted for microscopy on 5% agarose pads with the anesthetic. Image acquisition was captured by a Nikon 60 × 1.2 NA water objective with 1 um z-step size. Quantification of sperm distribution in the uterus starts at the vulva and extends up to and includes the spermatheca. The sperm counted were throughout the gonad at a focal depth of about 30 μm. The whole uterus was divided into three zones. Zone 1 contains the vulva region, and Zone 3 contains the spermatheca. The number of sperm was manually counted within each zone. The distribution percentage = (the number in each zone) / (the total labeled sperm observed) * 100%. The quantified data contains at least 30 total stained sperm in the entire uterus. At least 3–7 mated hermaphrodites were counted in each mating assay, and experiments were repeated at least 3 times.

Auxin-inducible treatment in the degron strains

Request a detailed protocol

Animals were grown on bacteria-seeded MYOB plates containing auxin. The natural auxin indole-3-acetic acid (IAA) was purchased from Alfa Aesar (#A10556). IAA was dissolved in ethanol as a 400 mM stock solution. Auxin was added to autoclaved MYOB agar when it cooled to about 50–60°C before pouring. MYOB plates containing the final concentration of auxin (1 or 2 mM) were used to test the degron-edited worms.

To degrade the target protein efficiently, L1 or L2 hermaphrodites were picked onto auxin plates. Animals were grown on the plates at 20°C for 36–60 hr for the brood size assay. Alternatively, mid-L4 hermaphrodites were incubated on the auxin plate for one generation, and F₁ mid-L4 hermaphrodites were picked to a fresh auxin plate for the brood size assay or for phenotypic imaging.

The microinjection of fluorescein-labeled MSP into aged pezo-1 CΔ

Request a detailed protocol

The microinjection of 101.6 μM NHS-Fluorescein-labeled MSP-142 into both aged (day 2, 48 hr post mid-L4) wildtype and pezo-1 CΔ hermaphrodites was performed as previously described (Miller, 2001). The injected worms recovered for 4 hr on MYOB plates with OP50 food before imaging. The acquisition of GFP and DIC images was performed by our confocal imaging system (see below) with 1–2 μm z-step size and 10–15 z planes. Time interval for ovulation imaging was every 45–60 s, and duration of imaging was 60–90 min. Ovulation rate = number of successfully ovulated oocytes / total duration of imaging.

Microscopy

Request a detailed protocol

Live imaging was performed on a spinning disk confocal system that uses a Nikon 60 × 1.2 NA water objective, a Photometrics Prime 95B EMCCD camera, and a Yokogawa CSU-X1 confocal scanner unit. Images were acquired and analyzed by Nikon’s NIS imaging software and ImageJ/FIJI Bio-formats plugin (National Institutes of Health) (Linkert et al., 2010; Schindelin et al., 2012). GCaMP3 images were also acquired by a 60×/1.40 NA oil-immersion objective on a Nikon Eclipse 80i microscope equipped with a SPOT RT39M5 sCMOS camera (Diagnostic Instruments, Sterling Heights, MI, USA) with a 0.63x wide field adapter, controlled by SPOT Advanced imaging software (v. 5.0) with Peripheral Devices and Quantitative Imaging modules. Images were acquired at 2448 × 2048 pixels, using the full camera chip, and saved as 8-bit TIFF files. Fluorescence excitation was provided by a Nikon Intensilight C-HGFI 130 W mercury lamp and shuttered with a Lambda 10-B SmartShutter (Sutter Instruments, Novato, CA), also controlled through the SPOT software. Single-channel GCaMP time-lapse movies were acquired using a GFP filter set (470/40 × 495 lpxr 525/50 m) (Chroma Technologies, Bellows Falls, VT) at 1 frame per second, with an exposure time of 40–60 ms, gain of 8, and neutral density of 16.

GCaMP3 imaging acquisition and data processing

Request a detailed protocol

For all GCaMP3 imaging data, animals were immobilized on 7.5% agarose pads with 0.05 μm polystyrene beads and imaged using confocal microscopy as described above. Images were acquired every 1 s and saved as 16-bit TIFF files. DIC images were acquired every 3 s. Only successful embryo transits (embryos that were expelled through the sp-ut valve) were analyzed for this GCaMP3 study. The GCaMP3 metrics, including rising time and fraction over half max data, as well as the GCaMP3 intensity heat map were processed by the custom Fiji and Matlab coded platform (Bouffard et al., 2019). GCaMP3 kymograms were generated by custom Fiji code using the commands Image > Stacks > Reslice followed by Image > Stacks > Z Project (Average Intensity) (Bouffard et al., 2019). Only the very first three ovulations were imaged for each animal. Detailed processing and analysis of the GCaMP time series was performed exactly as described in Bouffard et al., 2019.

Statistics

Statistical significance was determined by p-value from an unpaired two-tailed t-test. P-values: ns, not significant; *, <0.05; **, <0.01; ***, <0.001; ****, <0.0001. Both the Shapiro-Wilk and the Kolmogorov-Smirnov Normality test indicated that all data follow normal distributions.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided for all Figures and figure supplements.

References

(2013) Dehydrated hereditary stomatocytosis linked to gain-of-function mutations in mechanically activated PIEZO1 ion channels
Nature Communications 4:1884.
https://doi.org/10.1038/ncomms2899
- PubMed
- Google Scholar
1. Alper SL
(2017) Genetic diseases of PIEZO1 and PIEZO2 dysfunction
Current Topics in Membranes 79:97–134.
https://doi.org/10.1016/bs.ctm.2017.01.001
- PubMed
- Google Scholar
1. Andolfo I
2. Alper SL
3. De Franceschi L
4. Auriemma C
5. Russo R
6. De Falco L
7. Vallefuoco F
8. Esposito MR
9. Vandorpe DH
10. Shmukler BE
11. Narayan R
12. Montanaro D
13. D'Armiento M
14. Vetro A
15. Limongelli I
16. Zuffardi O
17. Glader BE
18. Schrier SL
19. Brugnara C
20. Stewart GW
21. Delaunay J
22. Iolascon A
(2013) Multiple clinical forms of dehydrated hereditary stomatocytosis arise from mutations in PIEZO1
Blood 121:3925–3935.
https://doi.org/10.1182/blood-2013-02-482489
- PubMed
- Google Scholar
(2013) Xerocytosis is caused by mutations that alter the kinetics of the mechanosensitive channel PIEZO1
PNAS 110:E1162–E1168.
https://doi.org/10.1073/pnas.1219777110
- PubMed
- Google Scholar
(2019) The RhoGAP SPV-1 regulates calcium signaling to control the contractility of the Caenorhabditis elegans spermatheca during embryo transits
Molecular Biology of the Cell 30:907–922.
https://doi.org/10.1091/mbc.E18-10-0633
- PubMed
- Google Scholar
1. Bui YK
2. Sternberg PW
(2002) Caenorhabditis elegans inositol 5-phosphatase homolog negatively regulates inositol 1,4,5-triphosphate signaling in ovulation
Molecular Biology of the Cell 13:1641–1651.
https://doi.org/10.1091/mbc.02-01-0008
- PubMed
- Google Scholar
(1998) Inositol trisphosphate mediates a RAS-independent response to LET-23 receptor tyrosine kinase activation in C. elegans
Cell 92:523–533.
https://doi.org/10.1016/S0092-8674(00)80945-9
- PubMed
- Google Scholar
1. Coste B
2. Mathur J
3. Schmidt M
4. Earley TJ
5. Ranade S
6. Petrus MJ
7. Dubin AE
8. Patapoutian A
(2010) Piezo1 and Piezo2 are essential components of distinct mechanically activated cation channels
Science 330:55–60.
https://doi.org/10.1126/science.1193270
- PubMed
- Google Scholar
1. Coste B
2. Xiao B
3. Santos JS
4. Syeda R
5. Grandl J
6. Spencer KS
7. Kim SE
8. Schmidt M
9. Mathur J
10. Dubin AE
11. Montal M
12. Patapoutian A
(2012) Piezo proteins are pore-forming subunits of mechanically activated channels
Nature 483:176–181.
https://doi.org/10.1038/nature10812
- PubMed
- Google Scholar
1. Coste B
2. Houge G
3. Murray MF
4. Stitziel N
5. Bandell M
6. Giovanni MA
7. Philippakis A
8. Hoischen A
9. Riemer G
10. Steen U
11. Steen VM
12. Mathur J
13. Cox J
14. Lebo M
15. Rehm H
16. Weiss ST
17. Wood JN
18. Maas RL
19. Sunyaev SR
20. Patapoutian A
(2013) Gain-of-function mutations in the mechanically activated ion channel PIEZO2 cause a subtype of distal arthrogryposis
PNAS 110:4667–4672.
https://doi.org/10.1073/pnas.1221400110
- PubMed
- Google Scholar
1. Cram EJ
(2014) Mechanotransduction in C. elegans morphogenesis and tissue function
Progress in Molecular Biology and Translational Science 126:281–316.
https://doi.org/10.1016/B978-0-12-394624-9.00012-9
- PubMed
- Google Scholar
1. Cram EJ
(2015) Mechanotransduction: feeling the squeeze in the C. elegans reproductive system
Current Biology 25:R74–R75.
https://doi.org/10.1016/j.cub.2014.12.007
- PubMed
- Google Scholar
(2018) Piezo1 forms a slowly-inactivating mechanosensory channel in mouse embryonic stem cells
eLife 7:e33149.
https://doi.org/10.7554/eLife.33149
- PubMed
- Google Scholar
1. Doniach T
2. Hodgkin J
(1984) A sex-determining gene, fem-1, required for both male and hermaphrodite development in Caenorhabditis elegans
Developmental Biology 106:223–235.
https://doi.org/10.1016/0012-1606(84)90077-0
- PubMed
- Google Scholar
(2019) Mechanically activated piezo channels modulate outflow tract valve development through the Yap1 and Klf2-Notch signaling Axis
eLife 8:e44706.
https://doi.org/10.7554/eLife.44706
- PubMed
- Google Scholar
(2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference
Nature 408:325–330.
https://doi.org/10.1038/35042517
- PubMed
- Google Scholar
(2013) Heritable genome editing in C. elegans via a CRISPR-Cas9 system
Nature Methods 10:741–743.
https://doi.org/10.1038/nmeth.2532
- PubMed
- Google Scholar
(2015) Ionic selectivity and permeation properties of human PIEZO1 channels
PLOS ONE 10:e0125503.
https://doi.org/10.1371/journal.pone.0125503
- PubMed
- Google Scholar
1. Greenstein D
(2005) Control of oocyte meiotic maturation and fertilization
WormBook 28:1–12.
https://doi.org/10.1895/wormbook.1.53.1
- Google Scholar
(2010) Sperm and oocyte communication mechanisms controlling C. elegans fertility
Developmental Dynamics : An Official Publication of the American Association of Anatomists 239:1265–1281.
https://doi.org/10.1002/dvdy.22202
- PubMed
- Google Scholar
1. Harris TW
2. Arnaboldi V
3. Cain S
4. Chan J
5. Chen WJ
6. Cho J
7. Davis P
8. Gao S
9. Grove CA
10. Kishore R
11. Lee RYN
12. Muller H-M
13. Nakamura C
14. Nuin P
15. Paulini M
16. Raciti D
17. Rodgers FH
18. Russell M
19. Schindelman G
20. Auken KV
21. Wang Q
22. Williams G
23. Wright AJ
24. Yook K
25. Howe KL
26. Schedl T
27. Stein L
28. Sternberg PW
(2019) WormBase: a modern model organism information resource
Nucleic Acids Research 29:D762–D767.
https://doi.org/10.1093/nar/gkz920
- Google Scholar
1. He L
2. Si G
3. Huang J
4. Samuel ADT
5. Perrimon N
(2018) Mechanical regulation of stem-cell differentiation by the stretch-activated piezo channel
Nature 555:103–106.
https://doi.org/10.1038/nature25744
- PubMed
- Google Scholar
(2013) A heterogeneous mixture of F-series prostaglandins promotes sperm guidance in the Caenorhabditis elegans reproductive tract
PLOS Genetics 9:e1003271.
https://doi.org/10.1371/journal.pgen.1003271
- PubMed
- Google Scholar
1. Huang J
2. Wang H
3. Chen Y
4. Wang X
5. Zhang H
(2012) Residual body removal during spermatogenesis in C. elegans requires genes that mediate cell corpse clearance
Development 139:4613–4622.
https://doi.org/10.1242/dev.086769
- PubMed
- Google Scholar
(2010) Eggshell chitin and chitin-interacting proteins prevent polyspermy in C. elegans
Current Biology 20:1932–1937.
https://doi.org/10.1016/j.cub.2010.09.059
- PubMed
- Google Scholar
1. Kelley C
2. Cram E
(2019) Regulation of actin dynamics in the C. elegans Somatic Gonad
Journal of Developmental Biology 7:6.
https://doi.org/10.3390/jdb7010006
- Google Scholar
1. Kimble J
2. Hirsh D
(1979) The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans
Developmental Biology 70:396–417.
https://doi.org/10.1016/0012-1606(79)90035-6
- PubMed
- Google Scholar
(2013) Filamin and phospholipase C-ε are required for calcium signaling in the Caenorhabditis elegans spermatheca
PLOS Genetics 9:e1003510.
https://doi.org/10.1371/journal.pgen.1003510
- PubMed
- Google Scholar
1. Kubagawa HM
2. Watts JL
3. Corrigan C
4. Edmonds JW
5. Sztul E
6. Browse J
7. Miller MA
(2006) Oocyte signals derived from polyunsaturated fatty acids control sperm recruitment in vivo
Nature Cell Biology 8:1143–1148.
https://doi.org/10.1038/ncb1476
- PubMed
- Google Scholar
1. Kuwabara PE
(2003) The multifaceted C. elegans major sperm protein: an ephrin signaling antagonist in oocyte maturation
Genes & Development 17:155–161.
https://doi.org/10.1101/gad.1061103
- PubMed
- Google Scholar
1. Li J
2. Hou B
3. Tumova S
4. Muraki K
5. Bruns A
6. Ludlow MJ
7. Sedo A
8. Hyman AJ
9. McKeown L
10. Young RS
11. Yuldasheva NY
12. Majeed Y
13. Wilson LA
14. Rode B
15. Bailey MA
16. Kim HR
17. Fu Z
18. Carter DA
19. Bilton J
20. Imrie H
21. Ajuh P
22. Dear TN
23. Cubbon RM
24. Kearney MT
25. Prasad RK
26. Evans PC
27. Ainscough JF
28. Beech DJ
(2014) Piezo1 integration of vascular architecture with physiological force
Nature 515:279–282.
https://doi.org/10.1038/nature13701
- PubMed
- Google Scholar
1. Li J
2. Hou B
3. Tumova S
4. Muraki K
5. Bruns A
6. Ludlow MJ
7. Sedo A
8. Hyman AJ
9. McKeown L
10. Young RS
11. Yuldasheva NY
12. Majeed Y
13. Wilson LA
14. Rode B
15. Bailey MA
16. Kim HR
17. Fu ZJ
18. Carter DAL
19. Bilton J
20. Imrie H
21. Ajuh P
22. Dear TN
23. Cubbon RM
24. Kearney MT
25. Prasad KR
26. Evans PC
27. Ainscough JFX
28. Beech DJ
(2015) Piezo1 integration of vascular architecture with physiological force
FASEB Journal 29:639.2.
https://doi.org/10.1096/fasebj.29.1_supplement.639.2
- Google Scholar
1. Li S
2. You Y
3. Gao J
4. Mao B
5. Cao Y
6. Zhao X
7. Zhang X
(2018) Novel mutations in TPM2 and PIEZO2 are responsible for distal arthrogryposis (DA) 2B and mild DA in two chinese families
BMC Medical Genetics 19:179.
https://doi.org/10.1186/s12881-018-0692-8
- PubMed
- Google Scholar
1. Linkert M
2. Rueden CT
3. Allan C
4. Burel JM
5. Moore W
6. Patterson A
7. Loranger B
8. Moore J
9. Neves C
10. Macdonald D
11. Tarkowska A
12. Sticco C
13. Hill E
14. Rossner M
15. Eliceiri KW
16. Swedlow JR
(2010) Metadata matters: access to image data in the real world
The Journal of Cell Biology 189:777–782.
https://doi.org/10.1083/jcb.201004104
- PubMed
- Google Scholar
1. Lorin-Nebel C
2. Xing J
3. Yan X
4. Strange K
(2007) CRAC channel activity in C. elegans is mediated by Orai1 and STIM1 homologues and is essential for ovulation and fertility
The Journal of Physiology 580:67–85.
https://doi.org/10.1113/jphysiol.2006.124883
- PubMed
- Google Scholar
1. Lukacs V
2. Mathur J
3. Mao R
4. Bayrak-Toydemir P
5. Procter M
6. Cahalan SM
7. Kim HJ
8. Bandell M
9. Longo N
10. Day RW
11. Stevenson DA
12. Patapoutian A
13. Krock BL
(2015) Impaired PIEZO1 function in patients with a novel autosomal recessive congenital lymphatic dysplasia
Nature Communications 6:8329.
https://doi.org/10.1038/ncomms9329
- PubMed
- Google Scholar
1. McCarter J
2. Bartlett B
3. Dang T
4. Schedl T
(1999) On the control of oocyte meiotic maturation and ovulation in Caenorhabditis elegans
Developmental Biology 205:111–128.
https://doi.org/10.1006/dbio.1998.9109
- PubMed
- Google Scholar
1. McHugh BJ
2. Buttery R
3. Lad Y
4. Banks S
5. Haslett C
6. Sethi T
(2010) Integrin activation by Fam38A uses a novel mechanism of R-Ras targeting to the endoplasmic reticulum
Journal of Cell Science 123:51–61.
https://doi.org/10.1242/jcs.056424
- PubMed
- Google Scholar
1. McKnight K
2. Hoang HD
3. Prasain JK
4. Brown N
5. Vibbert J
6. Hollister KA
7. Moore R
8. Ragains JR
9. Reese J
10. Miller MA
(2014) Neurosensory perception of environmental cues modulates sperm motility critical for fertilization
Science 344:754–757.
https://doi.org/10.1126/science.1250598
- PubMed
- Google Scholar
1. McMillin MJ
2. Beck AE
3. Chong JX
4. Shively KM
5. Buckingham KJ
6. Gildersleeve HI
7. Aracena MI
8. Aylsworth AS
9. Bitoun P
10. Carey JC
11. Clericuzio CL
12. Crow YJ
13. Curry CJ
14. Devriendt K
15. Everman DB
16. Fryer A
17. Gibson K
18. Giovannucci Uzielli ML
19. Graham JM
20. Hall JG
21. Hecht JT
22. Heidenreich RA
23. Hurst JA
24. Irani S
25. Krapels IP
26. Leroy JG
27. Mowat D
28. Plant GT
29. Robertson SP
30. Schorry EK
31. Scott RH
32. Seaver LH
33. Sherr E
34. Splitt M
35. Stewart H
36. Stumpel C
37. Temel SG
38. Weaver DD
39. Whiteford M
40. Williams MS
41. Tabor HK
42. Smith JD
43. Shendure J
44. Nickerson DA
45. Bamshad MJ
46. University of Washington Center for Mendelian Genomics
(2014) Mutations in PIEZO2 cause Gordon syndrome, Marden-Walker syndrome, and distal arthrogryposis type 5
The American Journal of Human Genetics 94:734–744.
https://doi.org/10.1016/j.ajhg.2014.03.015
- PubMed
- Google Scholar
1. Miller MA
(2001) A sperm cytoskeletal protein that signals oocyte meiotic maturation and ovulation
Science 291:2144–2147.
https://doi.org/10.1126/science.1057586
- Google Scholar
(2003) An eph receptor sperm-sensing control mechanism for oocyte meiotic maturation in Caenorhabditis elegans
Genes & Development 17:187–200.
https://doi.org/10.1101/gad.1028303
- PubMed
- Google Scholar
(2017) Piezos thrive under pressure: mechanically activated ion channels in health and disease
Nature Reviews Molecular Cell Biology 18:771–783.
https://doi.org/10.1038/nrm.2017.92
- PubMed
- Google Scholar
1. Nonomura K
2. Woo SH
3. Chang RB
4. Gillich A
5. Qiu Z
6. Francisco AG
7. Ranade SS
8. Liberles SD
9. Patapoutian A
(2017) Piezo2 senses airway stretch and mediates lung inflation-induced apnoea
Nature 541:176–181.
https://doi.org/10.1038/nature20793
- PubMed
- Google Scholar
1. Nonomura K
2. Lukacs V
3. Sweet DT
4. Goddard LM
5. Kanie A
6. Whitwam T
7. Ranade SS
8. Fujimori T
9. Kahn ML
10. Patapoutian A
(2018) Mechanically activated ion channel PIEZO1 is required for lymphatic valve formation
PNAS 115:12817–12822.
https://doi.org/10.1073/pnas.1817070115
- PubMed
- Google Scholar
(2015) High efficiency, Homology-Directed genome editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes
Genetics 201:47–54.
https://doi.org/10.1534/genetics.115.179382
- PubMed
- Google Scholar
1. Periasamy M
2. Huke S
(2001) SERCA pump level is a critical determinant of ca(2+)homeostasis and cardiac contractility
Journal of Molecular and Cellular Cardiology 33:1053–1063.
https://doi.org/10.1006/jmcc.2001.1366
- PubMed
- Google Scholar
1. Poole K
2. Herget R
3. Lapatsina L
4. Ngo HD
5. Lewin GR
(2014) Tuning piezo ion channels to detect molecular-scale movements relevant for fine touch
Nature Communications 5:3520.
https://doi.org/10.1038/ncomms4520
- PubMed
- Google Scholar
1. Ranade SS
2. Qiu Z
3. Woo SH
4. Hur SS
5. Murthy SE
6. Cahalan SM
7. Xu J
8. Mathur J
9. Bandell M
10. Coste B
11. Li YS
12. Chien S
13. Patapoutian A
(2014) Piezo1, a mechanically activated ion channel, is required for vascular development in mice
PNAS 111:10347–10352.
https://doi.org/10.1073/pnas.1409233111
- PubMed
- Google Scholar
1. Rual JF
2. Ceron J
3. Koreth J
4. Hao T
5. Nicot AS
6. Hirozane-Kishikawa T
7. Vandenhaute J
8. Orkin SH
9. Hill DE
10. van den Heuvel S
11. Vidal M
(2004) Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library
Genome Research 14:2162–2168.
https://doi.org/10.1101/gr.2505604
- PubMed
- Google Scholar
1. Schindelin J
2. Arganda-Carreras I
3. Frise E
4. Kaynig V
5. Longair M
6. Pietzsch T
7. Preibisch S
8. Rueden C
9. Saalfeld S
10. Schmid B
11. Tinevez JY
12. White DJ
13. Hartenstein V
14. Eliceiri K
15. Tomancak P
16. Cardona A
(2012) Fiji: an open-source platform for biological-image analysis
Nature Methods 9:676–682.
https://doi.org/10.1038/nmeth.2019
- PubMed
- Google Scholar
(1998) The C. elegans spe-9 gene encodes a sperm transmembrane protein that contains EGF-like repeats and is required for fertilization
Cell 93:71–79.
https://doi.org/10.1016/S0092-8674(00)81147-2
- PubMed
- Google Scholar
1. Syeda R
2. Xu J
3. Dubin AE
4. Coste B
5. Mathur J
6. Huynh T
7. Matzen J
8. Lao J
9. Tully DC
10. Engels IH
11. Petrassi HM
12. Schumacher AM
13. Montal M
14. Bandell M
15. Patapoutian A
(2015) Chemical activation of the mechanotransduction channel Piezo1
eLife 4:e07369.
https://doi.org/10.7554/eLife.07369
- Google Scholar
(2019) Efficient generation of endogenous fluorescent reporters by nested CRISPR in Caenorhabditis elegans
Genetics 211:1143–1154.
https://doi.org/10.1534/genetics.119.301965
- PubMed
- Google Scholar
Book
1. Voglis G
2. Tavernarakis N
(2005)
Mechanotransduction in the Nematode Caenorhabditis elegans

In: Kamkin A, Kiseleva I, editors. Mechanosensitivity in Cells and Tissues. Moscow: Springer. pp. 23–56.
- Google Scholar
1. Whitten SJ
2. Miller MA
(2007) The role of gap junctions in Caenorhabditis elegans oocyte maturation and fertilization
Developmental Biology 301:432–446.
https://doi.org/10.1016/j.ydbio.2006.08.038
- PubMed
- Google Scholar
1. Woo SH
2. Ranade S
3. Weyer AD
4. Dubin AE
5. Baba Y
6. Qiu Z
7. Petrus M
8. Miyamoto T
9. Reddy K
10. Lumpkin EA
11. Stucky CL
12. Patapoutian A
(2014) Piezo2 is required for Merkel-cell mechanotransduction
Nature 509:622–626.
https://doi.org/10.1038/nature13251
- PubMed
- Google Scholar
(2015) Piezo2 is the principal mechanotransduction channel for proprioception
Nature Neuroscience 18:1756–1762.
https://doi.org/10.1038/nn.4162
- PubMed
- Google Scholar
1. Wu J
2. Lewis AH
3. Grandl J
(2017) Touch, tension, and transduction - The function and regulation of piezo ion channels
Trends in Biochemical Sciences 42:57–71.
https://doi.org/10.1016/j.tibs.2016.09.004
- PubMed
- Google Scholar
1. Yan X
2. Xing J
3. Lorin-Nebel C
4. Estevez AY
5. Nehrke K
6. Lamitina T
7. Strange K
(2006) Function of a STIM1 homologue in C. elegans: evidence that store-operated Ca2+ entry is not essential for oscillatory Ca2+ signaling and ER Ca2+ homeostasis
Journal of General Physiology 128:443–459.
https://doi.org/10.1085/jgp.200609611
- PubMed
- Google Scholar
1. Yang Y
2. Han SM
3. Miller MA
(2010) MSP hormonal control of the oocyte MAP kinase cascade and reactive oxygen species signaling
Developmental Biology 342:96–107.
https://doi.org/10.1016/j.ydbio.2010.03.026
- PubMed
- Google Scholar
(2012) Mutations in the mechanotransduction protein PIEZO1 are associated with hereditary xerocytosis
Blood 120:1908–1915.
https://doi.org/10.1182/blood-2012-04-422253
- PubMed
- Google Scholar
1. Zhang L
2. Ward JD
3. Cheng Z
4. Dernburg AF
(2015) The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans
Development 142:4374–4384.
https://doi.org/10.1242/dev.129635
- PubMed
- Google Scholar
1. Zhang T
2. Chi S
3. Jiang F
4. Zhao Q
5. Xiao B
(2017) A protein interaction mechanism for suppressing the mechanosensitive piezo channels
Nature Communications 8:1797.
https://doi.org/10.1038/s41467-017-01712-z
- PubMed
- Google Scholar
1. Zhang M
2. Wang Y
3. Geng J
4. Zhou S
5. Xiao B
(2019) Mechanically activated piezo channels mediate touch and suppress acute mechanical pain response in mice
Cell Reports 26:1419–1431.
https://doi.org/10.1016/j.celrep.2019.01.056
- PubMed
- Google Scholar
1. Zwaal RR
2. Van Baelen K
3. Groenen JT
4. van Geel A
5. Rottiers V
6. Kaletta T
7. Dode L
8. Raeymaekers L
9. Wuytack F
10. Bogaert T
(2001) The sarco-endoplasmic reticulum ^Ca2+ ATPase is required for development and muscle function in Caenorhabditis elegans
The Journal of Biological Chemistry 276:43557–43563.
https://doi.org/10.1074/jbc.M104693200
- PubMed
- Google Scholar

Decision letter

Diana S Chu

Reviewing Editor; San Francisco State University, United States
Didier YR Stainier

Senior Editor; Max Planck Institute for Heart and Lung Research, Germany
Diana S Chu

Reviewer; San Francisco State University, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This work using C. elegans represents one of the first descriptions of PIEZO proteins in the regulation of germ cell production and function. This careful analysis shows how the C. elegans PIEZO-1 protein may modulate this complex process at multiple points and serves as a basis for other studies investigating PIEZO function in mechanotransduction and how model organisms can be used to reveal fundamental information on proteins that are tied to specific diseases.

Decision letter after peer review:

Thank you for submitting your article "Caenorhabditis elegans PIEZO channel coordinates multiple reproductive tissues to govern ovulation" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Diana S Chu as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Didier Stainier as the Senior Editor.

Essential revisions:

1) Because the overall set of data do not directly support that PIEZO in C. elegans is a calcium regulator, the authors should revise the manuscript, particularly many of the conclusions reached, to less strongly advocate that their data supports a role for this C. elegans homolog in calcium signaling. The reviewers agree this, in fact, does not detract from the interest of the paper but instead reveals important information about the potential function of these proteins in different developmental contexts.

2) The experiments and explanations of roles in sperm signaling (in particular comments from reviewer 3 on spe-9 experiments) and experiments and conclusions about sperm navigation were either incomplete or confusing. It is not clear why the defects may not arise as secondary effects from the oocyte production defects. The authors should address all reviewer comments in order to re-evaluate the conclusions that can be reached regarding these experiments in order to make claims about such roles.

3) There should be more controls (or better explanation that address the need for controls) as requested by reviewers for some of the experiments presented, particularly the AID, spe-9, and Yoda1 experiments.

4) Evidence for inter-tissue signaling is not well supported and thus, unless the authors have additional, stronger data, should be removed from the manuscript.

Overall, we would like authors to 1) revise the manuscript to be careful about claims that PEZO-1 functions as a calcium regulator and to consider other roles or functions that may be revealed by their data , 2) revise the presentation and provide controls (or potentially add new data if available to strengthen their points) about claims for PEZO-1 function in sperm signaling or navigation. 3) provide controls for other experiments requested in individual reviewer comments. Reviewers felt that these issues should not warrant significant new experimental analysis.

Reviewer #1:

The manuscript describes the characterization of the function of PEZO-1 in C. elegans. PEZO-1 is the homolog of PIEZO1 and PIEZO2 in humans, which are mechano-sensitive channel proteins. The authors generate GFP-tagged versions of PEZO-1 to show that it is expressed broadly in many cell types, including reproductive tissues. They examine knock-out mutants of pezo-1 and find severe defects in fertility. They find that loss of pezo-1 causes oocytes to be crushed during the processes of ovulation, fertilization, and expulsion to the uterus. They further show that defective sperm navigation may also contribute to fertility defects. The authors have evidence that PEZO-1 works through calcium signaling – mutation in pezo-1 shows synergistic defects when combined with reduction of calcium signaling regulators, but calcium signaling itself was not different in their assays. Both tissue-specific knock-down of C. elegans pezo-1 and introduction of PIEZO patient-specific alleles in C. elegans also lead to fertility defects.

The work is interesting and novel. This is the first characterization of PIEZO function in C. elegans, where it is possible to use a variety of approaches to assess PIEZO function in a model organism. The high-quality data obtained through a combination of genetic knock-downs and AID degradation, in vivo imaging of tagged proteins, fertility assays, and calcium imaging is a strength of the work. Though PIEZO proteins are known to be important for mechanosensory transduction in several contexts in other systems, including humans and Drosophila, this is also the first demonstration that PEZO-1 is important for fertility, in particular, the production of germ cells that requires an orchestration of movements. In particular, the 'crushed oocyte' phenotype is quite striking. Their demonstration that PIEZO patient-specific alleles also result in fertility defects links the C. elegans work to understanding human disease and show that there is potential to use this system in the future to further dissect PIEZO function in developmental contexts in a tractable system. Because of these numerous strengths, I would recommend publication in eLife.

There are a few revisions that are required. One modest concern which is that the role of PEZO-1 in mechanical signal transduction is still not described in a concrete way. Of course, this is partially due to the obviously complicated nature of the fertility process that is affected. There are multiple points at which the mechano-sensation and transduction may be affected that result in the major phenotype of oocyte crushing. This could be improved by revising Figure 10. Instead of highlighting 'PEZO-1 Dysfunction' it would be clearer for the authors to highlight where they think PEZO-1 IS functioning. This could be done by either by adding a clear point at each step that describes that function or retitling each step to better highlight PEZO-1. The model as is now (in the text and figure) is more a reiteration of results and not so much a model for how and where PEZO-1 may be 'sensing' or 'responding' to mechanical stress. It is actually interesting that the phenotype is complicated because PIEZO proteins in other organisms may also have likewise complex roles.

Reviewer #2:

This paper explores for the first time the role of the piezo-1/2 ortholog in C. elegans, pezo-1, and it identifies a critical function in retaining sperm in the spermatheca. In the absence of pezo-1 sperm are quickly depleted from the spermatheca and as a consequence embryo production is halted and oocyte crushing begins on both ends of the spermatheca. The quality of the work is high and its results are novel and of broad interest. However, the paper suffers from several problems that must be rectified before publication. Likely because piezo-1/2 are known to be mechanosensing calcium channels, the authors probably started this project with the hypothesis that pezo-1 functions as a mechanosensitive calcium channel. However, nature being as it is, in the end they don't have any evidence for such a function. That in itself is not a problem. What is problematic in my view is that in writing the paper they nevertheless continue to push a narrative of pezo-1 regulating calcium in the reproductive system, despite there not being any evidence for this. The second problem I have as a reviewer with the current paper is that the interpretation of many of the experiments is taken too far and it is done in the Results section, which could lead a reader to confuse speculations (or wishful thinking) for actual results. The defect in pezo-1 mutants that can explain all of the observed phenotypes is the rapid depletion of sperm from the spermatheca because they fail to return after being washed out with embryos exiting into the uterus. The mating experiments and somatic or germline specific AID experiments were supposed to clarify whether the sperm navigation defect is due to lack of pezo-1 activity in the sperm or in the somatic gonad. Unfortunately, the data presented is contradictory (or perhaps only not explained well) because after reading and rereading the paper I still can't figure out if pezo-1 is required in the sperm or in the gonad or both. Once the authors clarify this point, remove experiments that don't lead to a conclusion (inx-14/22, YP170::tdimer2), remove overinterpretation statements from the Results section, and add missing controls for some experiments (Yoda1, AID) as detailed in my comments below, I believe the paper will be worthy of publication in eLife.

1) In multiple places the authors jump to conclusions based on associative evidence such as localization or genetic interaction. For example: "Notably, PEZO-1 is strongly expressed in several tubular tissues, including the pharyngeal-intestinal and spermathecal-uterine valves, which is consistent with our hypothesis that pezo-1 may be responsible for mechanoperception in these tissues." And: "Consistent with the hypothesis that reproductive tissues are regulated by mechanosensitive stimuli in C. elegans, expression of PEZO-1 likely functions to sense physical strain or contractility during ovulation and fertilization." – such sentences push a narrative of pezo-1 function in mechanoperception without any support in the data. Speculations and interpretations belong in the discussion. The result section should present the results without biasing the reader to a single interpretation.

2) "Partial co-localization of PEZO-1 with the ER marker SP12::GFP suggested that PEZO-1 may be processed in the ER and transported to the plasma membrane (Figure 1E)." – based on the image in Figure 1E the localization of SP12 and PEZO-1 is complementary and primarily non-overlapping. If the authors have reason to believe there is substantial co-localization they need to show and quantify it. In any case, it isn't clear why this is an important point to focus on. If the authors think the location of function of PEZO-1 is the plasma membrane then why not just focus on that localization?

3) "The genome-edited animals behaved normally, suggesting no functional disruption of tagging PEZO-1 with these fluorescent reporter genes." – This statement is questionable in light of what is visible in Figure 1F, where there is an accumulation of small oocyte pieces or vesicles or something else that looks abnormal between the -1 oocyte and spermatheca.

4) "The fluorescent signal of GFP::PEZO-1 is observed in both spermathecal valves until the valves open, suggesting that PEZO-1 may function to sense the mechanical stimuli at the valves during ovulation" – since the fluorescent protein is at the membrane it is expected to give a higher signal when the tissue is contracted compared to when it is dilated. The change in fluorescence intensity observed in the GFP::PEZO-1 movie on its own is not an indication of any mechanosensing. If the authors wish to claim enrichment in the valve at a certain time point they would need to do a ratiometric comparison with a membrane marker such as PH::mCherry.

5) "To mimic a gain-of-function phenotype in pezo-1, we fed wildtype animals with Yoda1, a PIEZO1 specific chemical agonist, which keeps the channel open" – No control was performed to show that Yoda1 doesn't have side effects in worms. There are plenty of chemicals that are supposedly specific but actually are not. A simple experiment that could at least show Yoda1's phenotype is PEZO-1-dependent is to perform the treatment on pezo-1KO, which we expect to be refractory to the drug and display the same brood size as pezo-1KO on its own.

6) "The defective ovulation is likely due to incomplete constriction of the sheath cells and improper gating of the distal spermathecal valve." – Incomplete constriction of the sheath is sufficient to explain the entry phenotype and it is not necessary to invoke improper gating of the distal spermathecal valve, which was not specifically tested. Moreover, improper sheath contraction is consistent with the absence of sperm, while distal valve defects are not.

7) "Of the oocytes that did successfully enter the spermatheca, many were frequently crushed when they exited through the sp-ut valve (Figure 3A'-E', Video 2-3). We observed that the sp-ut valve, labeled by DLG-1::GFP, did not completely open when the oocyte attempted to exit the spermatheca, which may lead to crushing the oocyte" – again, a defect in the sp-ut valve is not necessary to explain the phenotype because oocytes are not normally meant to pass through the sp-ut valve and the egg shell normally protects the exiting embryo.

8) Knocking down the positive calcium regulators itr-1, sca-1, and orai-1 by RNAi enhanced the pezo-1 null phenotype and knocking down the negative calcium regulator lfe-1 partially rescued the null phenotype. Based on these findings the authors write: "Therefore, these observations are consistent with the hypothesis that pezo-1 may regulate cytosolic and ER Ca²⁺ homeostasis, which is crucial for proper spermathecal contractility and dilation." – However, there is no direct evidence in the paper to support the hypothesis that pezo-1 is controlling calcium levels in the reproductive system. Furthermore, in the following section the authors observe and measure directly calcium signaling in the spermatheca and observe no defects. It appears that the authors approached this project with a strong preconception of what pezo-1 is doing (based on literature in other systems) and do not allow the observations to lead to the most plausible explanations.

9) "Surprisingly, GCaMP3 fluorescence in pezo-1 was not significantly different than wildtype" – to me this is not surprising, since the phenotype looks like a problem with sheath contraction due to absence of sperm. Perhaps if the authors imaged GCaMP3 in the sheath they would see a lower signal in the mutant, but that could also be because of the absence of sperm and not a direct role of pezo-1 in calcium release.

10) "It should be noted that we only imaged the GCaMP3 reporter during the very first three ovulations in young adult animals to avoid Ca²⁺ signaling interference from a distorted gonad morphology and mechanical pressure from a gravid uterus… our data does not exclude the possibility that Ca²⁺ signaling may be more severely disrupted as the animal goes through more ovulation cycles.” – despite the technical difficulties, the authors could image older worms in order to rule out or prove that Ca²⁺ signaling may be disrupted in the spermatheca.

11) I'm confused about the data regarding sperm navigation to the spermatheca. In subsection Sperm from matings rescues low brood size phenotype in pezo-1 mutants it is shown that pezo-1 mutant hermaphrodites resumed ovulation and fertilization upon mating once the male's sperm (from either wildtype, spe-9(hc52ts), or pezo-1 males) reached the spermatheca. From this we can conclude that pezo-1 spermatheca have no problem to attract sperm. (the same conclusion is also drawn from the AID experiment in which pezo-1 is degraded in the somatic tissues and rescued by mating with wt male sperm). However, in subsection Sperm guidance and navigation is disrupted in pezo-1 mutants it is shown that in pezo-1 hermaphrodites few sperm reach the spermatheca after mating and most sperm remained in zones furthest from the spermatheca. This was observed for both wildtype and pezo-1 mutant male sperm in mating with pezo-1 hermaphrodites. To me, these two results are contradictory, and the authors must clarify this point. Are pezo-1 hermaphrodites defective in attracting sperm to the spermatheca? And if so, how can mating rescue their phenotype?

12) Auxin Induced Degradation is performed by tagging pezo-1 with the degron sequence and crossing with tir-1::mRuby expressing worms. However, the authors don't show any data regarding the efficacy of the degradation. Since the protein is membranal, it is expected that ubiquitination of the degron might not lead immediately to degradation. If the authors labelled the fluorescently-tagged versions of pezo-1 they could quantify the degradation by measuring fluorescence. Another option would be to perform a Western blot, if they have an antibody that recognizes pezo-1. Without such controls it is hard to draw a conclusion from the AID experiments because we don't know how much of the protein was actually degraded in either the germline or somatic tissues. Is the reason for the weaker phenotype compared to the KO the tissue specificity or residual protein?

13) Figure 8 panels H-L – the text describing these results is not clear and the labeling of two of the images must be wrong because they are all labelled with Ppie-1::tir-1::mRuby but in the graph two bars are labelled with Peft-3. In the text it is hard to follow in which case auxin was added, what the promoter was and what the result was. From the text I understood that there was a sperm navigation defect when pezo-1 was degraded in the somatic tissues, but from the graph it appears the sperm navigation defect was only observed when pezo-1 was degraded in the germline.

14) The rationale behind the experiments with inx-14 and inx-22 is not clear and I disagree with the authors conclusion that "the enhancement of phenotypes with these innexins suggests that PEZO-1 may be involved in regulating inter-tissue signaling.". In my view this is a sick + sick = sicker scenario and without further experiments to directly tie pezo-1 to inter-tissue signaling the authors cannot make such claims.

15) Similarly, the observation of yolk accumulation in the pseudocoelomic cavity surrounding the gonad of the pezo-1 mutants is an intriguing observation that could be developed with further experiments (in a future manuscript), but on its own does not warrant a place in this paper. The suggesting that yolk endocytosis into the oocytes is defective and that the reduced endocytosis of yolk may disrupt prostaglandin synthesis in the oocyte, which may lead to a defect in the oocytes' ability to attract sperm towards the spermatheca is super speculative and does not belong in the Results section.

Reviewer #3:

General assessment: This paper describes a functional analysis of pezo-1, the sole PIEZO channel ortholog in C. elegans. PIEZO channels are involved in mechanotransduction in a variety of systems and contexts. Here, several mutations are created and analyzed including deletions, an early stop, and gain-of-function mutations associated with human disease. pezo-1 is widely expressed in different worm tissues, notably reproductive tissues including both somatic and germline, and disruption of pezo-1 leads to fecundity defects. Assays for reproductive processes implicate defects in ovulation and sperm targeting that likely lead to this decreased fertility. While calcium signaling appears normal, mutations in genes involved in calcium signaling enhance pezo-1 as does certain disruptions of gonadal signaling. Tissue-specific rescue experiments and auxin-induced degradation are used to analyze the focus of action of pezo-1 in different reproductive processes. This paper covers a lot of ground: analysis of several distinct phenotypes in pezo-1 mutants, calcium imaging, genetic interactions, interrogation of disease alleles, and use of the relatively new auxin-induced degradation system to assess tissue specific effects. Overall, the experiments fit together well and make a coherent story.

While I have extensive comments, my major specific questions and concerns are about the following, described in more detail below (*):

1) Description and interpretation of experiments involving spe-9

2) Controls for the experiment shown in Figure 6E

3) Compared to other experiments, the inx genetic interaction experiments are relatively uninformative, and I suggest toning down the interpretation of the results. I agree that pezo-1 appears to be required for "inter-tissue signaling" but it is not clear how many cases are direct.

4) Auxin experiment controls

5) Details of sperm navigation experiments

Comments:

Re: Widespread expression of PEZO-1:

Multiple reporter knock-ins are used to examine where PEZO-1 is expressed. Images in Figures 1 and Figure 1—figure supplement 1 clearly show that PEZO-1 is expressed in several tissues including germ line. However, whether different transgenes showed consistent expression patterns should be stated. A schematic of the C. elegans gonad would help non-experts interpret the images and some added labeling would be useful.

In particular:

In Figure 1B, label intestine

For Figure 1F, additional description and labeling is needed for context. Does the lower right of the panel show developing sperm, developing oocytes, or something else?

For 1G, label both oocytes and the central structure (intestine?).

For 1J, indicate the sheath cells with an arrow.

Re Figure 1—figure supplement 1D: Why are both "GFP" and mScarlet shown in this image; and what structures is GFP associated with?

Subsection “PEZO-1 is expressed in multiple tissues throughout development”. This section, especially the statement "GFP::PEZO-1 is expressed in both spermathecal valves until the valves open" might be read to indicate that PEZO-1 localization changes during valve opening or other events of ovulation. Was this observed? This should be clarified, and any data indicating change in localization would need to be pointed out.

Re: Deletion of pezo-1 reduces brood size

These data show several different deletion/ putative loss of function alleles of pezo-1 were generated and give similar – though different strength – phenotypes of reduced fecundity and embryonic inviability. The fecundity defect worsens with age of the hermaphrodite. Treatment with a PIEZO agonist causes a phenotype similar to that of deletion alleles. It is notable that both lof and gof cause similar phenotypes. How do the authors interpret this effect? Is it consistent with other studies of PIEZO activity in other systems and the known mechanisms of action of these channels?

Since treatment with either of two different concentrations of the agonist yields similar effects, it does not seem necessary to show both concentrations. If a wider range of concentrations was tested and gave dose-dependent effects, this could be informative. Some deletion mutants might have a different dose-response curve than the wild type.

It seems like more could be done to take advantage of this pharmacological tool, though this is not necessary.

Re: severe ovulation defects

Live observations of ovulation reveal defects in sheath contractions and valve opening that move the oocyte/embryo forward through the gonad.

These data are convincing, though it would make sense to group the observations about oocyte crushing, oocytic masses, etc. from the previous section of the results with this section – or to simply combine the two sections into one.

Re: PEZO-1 mutants genetically interact with cytosolic Ca++ regulators/ show normal calcium signaling during ovulation

While most of the ms is nicely written, this section is hard to follow.

*In this reviewer's opinion, the term "genetically interact" can be problematic since it is neither precise for geneticists nor very accessible to non-geneticists. Even though calcium imaging appears normal in the pezo mutant, these experiments establish a potential link between the mechanisms of PEZO-1 and canonical PIEZO channels. It would be clearer for most readers to frame them in terms of manipulating Ca and avoid terms like positive or negative genetic interactions or phrases like "enhancing the reduction of brood size". This is especially important because these are such interesting experiments.

Brood size data are presented as scatterplots with separate counts of early progeny and later progeny. For most of the analysis, it is unclear why splitting the data in this manner is necessary. In many cases, it makes it more difficult for a reader to compare the phenotypes of different strains, e.g. for comparing pezo-1 alleles and in the genetic interaction experiments.

In addition, the wild-type brood sizes are surprisingly variable. Does the variability decrease if full brood sizes are considered? One explanation for this could be variability in staging L4s. In turn, this raises the question of whether splitting the data is the most accurate way to show brood sizes (at least in cases where progeny are abundant at both time points – when essentially all offspring are produced early, splitting the data is indeed helpful).

Overall, it seems worth considering 1- if the data could be presented in a simpler format for some experiments and 2- if the format is not revised, if the full brood counts should be included in the supplemental data.

Re: Sperm from matings rescues pezo-1 low brood size

The experiments here show the result that pezo-1 does not appear to be required in sperm and sperm defects are not responsible for pezo-1 reproductive phenotypes.

-pezo-1 males are fully fertile in crosses to fem-1 females, indicating their sperm are functional for migration and fertilization. This is convincing.

-Crossing males to sperm-depleted pezo-1 hermaphrodites induces resumption of offspring production, indicating pezo-1 is not required for the sperm-to-ovulation signal. This is also convincing.

The authors show that signaling from oocyte to sperm, needed for navigation, is disrupted; both wild-type and pezo-1 sperm have localization defects within pezo-1 hermaphrodites. However, there do not appear to be defects in the signaling from sperm to oocytes/sheath cells that increases ovulation rate. When sperm are depleted, ovulation rate is low, but re-introduction of sperm is sufficient to induce ovulation. Furthermore, pezo-1 sperm introduced into females do fertilize oocytes, implying they are functional for migration, fertilization, and induction of ovulation.

*The way experiments in this section are presented is misleading. Based on the title, I expected to see results that pezo-1 reproductive defects are due to their sperm. The presentation of the spe-9 experiment, as a test of "whether sperm signaling was defective" as well as the description of the result, further imply a sperm-based defect.

Ultimately, the spe-9 result is not surprising. spe-9 sperm are known to signal ovulation in wild type, and it is expected that re-introduction of sperm into a depleted hermaphrodite would increase ovulation rate if oocytes can respond to MSP. The data here are fine but the text should be revised for clarity and accessibility. This also applies in the Abstract and spe-9 experiments done with disease alleles.

The authors do not comment on quantitative differences between crosses into wild-type hermaphrodites and into pezo-1 hermaphrodites, and statistics are only presented for non-mated herm vs various mated conditions. Have the authors considered these comparisons?

*To interpret 6E, additional controls are needed in which wild-type male sperm are supplied and ovulation rates are measured.

Direct measurement of ovulation rate – as shown in Figure 6E for spe-9 – would be a more direct assay for induction of ovulation by introduced sperm.

An n of 4-6 seems very low for these experiments.

*Re: Sperm navigation is disrupted

– Does zone 3 include only the spermatheca, as described in the text, or the spermatheca and adjacent region of the uterus, as shown in Figure 7 (and as it is usually defined in publications from the Miller lab and others)? Please clarify the text.

– Were sperm counted in a single focal plane, or throughout the gonad?

– It is unclear why 72 hr adult hermaphrodites were used for these experiments; younger animals are more typically assayed. What is the rationale for this?

– The images in Figure 7 show 72 hr adults; the quantification is with 60 hr adults. While it might seem unlikely, this difference could matter. At 60 hours, there is likely to be some hermaphrodite sperm remaining, at least in wild type, while at 72 hr sperm are more likely to be depleted, which would presumably alter the signaling environment. Related to this concern, there appear to be quite a few sperm in zones 2 and 3 in panel G. The data in 7H suggests fewer sperm should be visible in zone 3.

– There is a mismatch between the callouts and labels for the image panels in Figure 7. According to the text, 7B,D,F should show wild-type hermaphrodites; according to labels, this is B,D,E.

– The order of image panels in Figure 7 is confusing, in part because some crosses are not shown. One could add the two "missing" combinations (pezo-1 x WT and WT x pezo, zone 1-2). Alternatively, 7B and 7F could be moved to supplementary data or not shown.

– In 7H: Are the data from one replicate, so that the error bars reflect worm-to-worm variability, or are the data from the 3 repeats, so the error bars reflect differences among the average distribution in each experiment?

– For indicating p values in 7H, brackets should be used to show what is being compared. Presumably. the current comparisons are 1 vs 2, 3 vs 4; comparing the same male sperm in 2 different hermaphrodites. It would be interesting to add statistical comparisons for 1 vs 3, 2 vs 4, i.e. comparing different male sperm in the same hermaphrodites.

Re: Auxin experiments

– The use of auxin induced degradation to disrupt function is a nice way to try to examine tissue-specific effects.

*– Data presented in 8E,F,G show the different degron strains either untreated or treated with auxin. A control is needed for treatment with auxin in the absence of the degron transgene – especially since all strains undergo a similar reduction in brood size in the presence of auxin (8E,F)

– Figure 8C,D – The sperm expression is described as faint, and it is indeed hard to see in the images. It is not unexpected that expression might be low, but are the authors confident that the putative sperm expression is not autofluorescence?

– It should be made clear in the text that germline expression includes (or is likely to include) both sperm and oocytes, so that either tissue could be the primary course of phenotypes observed with the germline AID strains. I do agree that it is more likely to be due to oocyte/ attractant signaling defects.

– The text states that Figure 8H, J show the somatic-specific (Peft-3) AID strain with auxin, but the figure is labeled as the Ppie-1 strain without auxin. Which is it?

– The age of the hermaphrodites used for the mitotracker assays needs to be stated. This is relevant to whether or not self sperm could be contribute to targeting defects.

Re: Multiple roles in inter-tissue signaling

– *The data in Figure S5 demonstrate enhancement of the brood size defects in inx; pezo as compared to inx(RNAi) or pezo- alone. However, this could be interpreted in many different ways, and does not necessarily mean that the same process is being affected, especially when a relatively non-specific phenotype is the assay. Thus, this experiment does not add insight.

– The images in Figure S6 do show excess extracellular yolk in pezo-1 that is not present in WT. However, YP170 levels in pezo-1 oocytes appear higher than in wild type, if anything. Therefore, I am not convinced that these data provide evidence for defects in YP170 endocytosis. Instead, is it possible that there are defects within oocytes, in conversion of yolk to downstream signaling molecules? Without additional experiments, this also seems to be dispensable.

Overall, while the experiments in this section do not contradict the model of pezo-1's being involved in inter-tissue signaling, they do little to support it.

https://doi.org/10.7554/eLife.53603.sa1

Author response

Essential revisions:

1) Because the overall set of data do not directly support that PIEZO in C. elegans is a calcium regulator, the authors should revise the manuscript, particularly many of the conclusions reached, to less strongly advocate that their data supports a role for this C. elegans homolog in calcium signaling. The reviewers agree this, in fact, does not detract from the interest of the paper but instead reveals important information about the potential function of these proteins in different developmental contexts.

Thank you for this feedback. We have revised the manuscript extensively to tone down our conclusions about calcium signaling. You will see evidence of this throughout the manuscript.

2) The experiments and explanations of roles in sperm signaling (in particular comments from reviewer 3 on spe-9 experiments) and experiments and conclusions about sperm navigation were either incomplete or confusing. It is not clear why the defects may not arise as secondary effects from the oocyte production defects. The authors should address all reviewer comments in order to re-evaluate the conclusions that can be reached regarding these experiments in order to make claims about such roles.

We have made extensive changes to these sections and have added better controls and even a few new experiments. We made pezo-1 females to determine if some of our phenotypes were dependent on the presence of self-sperm. We show in Figures 7 and Figure 6—figure supplement 1 (new figure) that hermaphrodites have a dramatic reduction in brood size with almost no self-sperm returning to the spermatheca, while cross-sperm are much more successful at siring progeny and navigating to the spermatheca where they can fertilize oocytes. We do still believe that there is also a signaling problem from the sheath cells to attract both self-sperm and cross-sperm to the spermatheca. We discuss these results in great detail in the text. All comments have been addressed.

3) There should be more controls (or better explanation that address the need for controls) as requested by reviewers for some of the experiments presented, particularly the AID, spe-9, and Yoda1 experiments.

We have addressed each of these concerns. The controls for the AID, spe-9, and Yoda1 experiments have been added to the appropriate sections of the manuscript. Please also check out Figures 2C, Figure 6, Figure 8E, and Figure 8—figure supplement 2 that were added.

4) Evidence for inter-tissue signaling is not well supported and thus, unless the authors have additional, stronger data, should be removed from the manuscript.

We have removed the discussion of yolk protein and have limited our discussion of inter-tissue signaling solely to the sperm migration defect. To address the apparent contradictory data that pezo-1 self-sperm are defective in navigating back to the spermatheca after being expelled by each ovulation compared to male sperm mated in from pezo-1 mutant males that navigate quite well, we have done the following:

We added more text to this section of the paper to explain these experiments.

In Figure 6—figure supplement 1, you will also notice that we are careful to distinguish between self-sperm and cross-sperm from male matings. We believe there may be a difference between the two populations of sperm. The data show that male sperm were also stuck in the uteri in pezo-1 CΔ; fem-1(hc17) after mating, however, 40-50% of the stained sperm able to navigate to the spermatheca. Therefore, we believe there may be a difference between the two populations of sperm. These are observations we plan to pursue in the future.

Overall, we would like authors to 1) revise the manuscript to be careful about claims that PEZO-1 functions as a calcium regulator and to consider other roles or functions that may be revealed by their data , 2) revise the presentation and provide controls (or potentially add new data if available to strengthen their points) about claims for PEZO-1 function in sperm signaling or navigation. 3) provide controls for other experiments requested in individual reviewer comments. Reviewers felt that these issues should not warrant significant new experimental analysis.

Thank you for this feedback. We have addressed all of these concerns as can be seen in the main text and figures.

Reviewer #1:

The manuscript describes the characterization of the function of PEZO-1 in C. elegans. PEZO-1 is the homolog of PIEZO1 and PIEZO2 in humans, which are mechano-sensitive channel proteins. The authors generate GFP-tagged versions of PEZO-1 to show that it is expressed broadly in many cell types, including reproductive tissues. They examine knock-out mutants of pezo-1 and find severe defects in fertility. They find that loss of pezo-1 causes oocytes to be crushed during the processes of ovulation, fertilization, and expulsion to the uterus. They further show that defective sperm navigation may also contribute to fertility defects. The authors have evidence that PEZO-1 works through calcium signaling – mutation in pezo-1 shows synergistic defects when combined with reduction of calcium signaling regulators, but calcium signaling itself was not different in their assays. Both tissue-specific knock-down of C. elegans pezo-1 and introduction of PIEZO patient-specific alleles in C. elegans also lead to fertility defects.

The work is interesting and novel. This is the first characterization of PIEZO function in C. elegans, where it is possible to use a variety of approaches to assess PIEZO function in a model organism. The high-quality data obtained through a combination of genetic knock-downs and AID degradation, in vivo imaging of tagged proteins, fertility assays, and calcium imaging is a strength of the work. Though PIEZO proteins are known to be important for mechanosensory transduction in several contexts in other systems, including humans and Drosophila, this is also the first demonstration that PEZO-1 is important for fertility, in particular, the production of germ cells that requires an orchestration of movements. In particular, the 'crushed oocyte' phenotype is quite striking. Their demonstration that PIEZO patient-specific alleles also result in fertility defects links the C. elegans work to understanding human disease and show that there is potential to use this system in the future to further dissect PIEZO function in developmental contexts in a tractable system. Because of these numerous strengths, I would recommend publication in eLife.

There are a few revisions that are required. One modest concern which is that the role of PEZO-1 in mechanical signal transduction is still not described in a concrete way. Of course, this is partially due to the obviously complicated nature of the fertility process that is affected. There are multiple points at which the mechano-sensation and transduction may be affected that result in the major phenotype of oocyte crushing. This could be improved by revising Figure 10. Instead of highlighting 'PEZO-1 Dysfunction' it would be clearer for the authors to highlight where they think PEZO-1 IS functioning. This could be done by either by adding a clear point at each step that describes that function or retitling each step to better highlight PEZO-1. The model as is now (in the text and figure) is more a reiteration of results and not so much a model for how and where PEZO-1 may be 'sensing' or 'responding' to mechanical stress. It is actually interesting that the phenotype is complicated because PIEZO proteins in other organisms may also have likewise complex roles.

This is a great suggestion and we have totally revised this Figure to emphasize the many processes we think PEZO-1 may influence during fertilization. We no longer reiterate the defects we already described throughout the paper. We believe our discussion of our data and our working hypothesis is better articulated.

Reviewer #2:

This paper explores for the first time the role of the piezo-1/2 ortholog in C. elegans, pezo-1, and it identifies a critical function in retaining sperm in the spermatheca. In the absence of pezo-1 sperm are quickly depleted from the spermatheca and as a consequence embryo production is halted and oocyte crushing begins on both ends of the spermatheca. The quality of the work is high and its results are novel and of broad interest. However, the paper suffers from several problems that must be rectified before publication. Likely because piezo-1/2 are known to be mechanosensing calcium channels, the authors probably started this project with the hypothesis that pezo-1 functions as a mechanosensitive calcium channel. However, nature being as it is, in the end they don't have any evidence for such a function. That in itself is not a problem. What is problematic in my view is that in writing the paper they nevertheless continue to push a narrative of pezo-1 regulating calcium in the reproductive system, despite there not being any evidence for this. The second problem I have as a reviewer with the current paper is that the interpretation of many of the experiments is taken too far and it is done in the Results section, which could lead a reader to confuse speculations (or wishful thinking) for actual results. The defect in pezo-1 mutants that can explain all of the observed phenotypes is the rapid depletion of sperm from the spermatheca because they fail to return after being washed out with embryos exiting into the uterus. The mating experiments and somatic or germline specific AID experiments were supposed to clarify whether the sperm navigation defect is due to lack of pezo-1 activity in the sperm or in the somatic gonad. Unfortunately, the data presented is contradictory (or perhaps only not explained well) because after reading and rereading the paper I still can't figure out if pezo-1 is required in the sperm or in the gonad or both. Once the authors clarify this point, remove experiments that don't lead to a conclusion (inx-14/22, YP170::tdimer2), remove overinterpretation statements from the restuls section, and add missing controls for some experiments (Yoda1, AID) as detailed in my comments below, I believe the paper will be worthy of publication in eLife.

Thank you for these comments. We have addressed the problematic parts of this manuscript, toned down our narrative about calcium signaling, and removed a number of uninformative experiments that do not add to the general observations of ovulation and sperm navigation. Below we address each concern.

1) In multiple places the authors jump to conclusions based on associative evidence such as localization or genetic interaction. For example: "Notably, PEZO-1 is strongly expressed in several tubular tissues, including the pharyngeal-intestinal and spermathecal-uterine valves, which is consistent with our hypothesis that pezo-1 may be responsible for mechanoperception in these tissues." And: "Consistent with the hypothesis that reproductive tissues are regulated by mechanosensitive stimuli in C. elegans, expression of PEZO-1 likely functions to sense physical strain or contractility during ovulation and fertilization." – such sentences push a narrative of pezo-1 function in mechanoperception without any support in the data. Speculations and interpretations belong in the discussion. The result section should present the results without biasing the reader to a single interpretation.

2) "Partial co-localization of PEZO-1 with the ER marker SP12::GFP suggested that PEZO-1 may be processed in the ER and transported to the plasma membrane (Figure 1E)." – based on the image in Figure 1E the localization of SP12 and PEZO-1 is complementary and primarily non-overlapping. If the authors have reason to believe there is substantial co-localization they need to show and quantify it. In any case, it isn't clear why this is an important point to focus on. If the authors think the location of function of PEZO-1 is the plasma membrane then why not just focus on that localization?

We have omitted Figure 1E; it is not an important point at all. We agree that our focus should be on the plasma membrane.

3) "The genome-edited animals behaved normally, suggesting no functional disruption of tagging PEZO-1 with these fluorescent reporter genes." – This statement is questionable in light of what is visible in Figure 1F, where there is an accumulation of small oocyte pieces or vesicles or something else that looks abnormal between the -1 oocyte and spermatheca.

Thanks so much for pointing that out. What an oversight on our end not to have been more specific in the figure legend. Those “pieces” are only observed in adults just before the first ovulation event and are the few remaining spermatids that have not migrated into the spermatheca yet. The larger pieces are residual bodies that have yet to be engulfed by the sheath cells. We have added this to the legend and also cited the paper that originally made these observations. This figure actually highlights quite well that PEZO-1 is on sperm membranes.

4) "The fluorescent signal of GFP::PEZO-1 is observed in both spermathecal valves until the valves open, suggesting that PEZO-1 may function to sense the mechanical stimuli at the valves during ovulation" – since the fluorescent protein is at the membrane it is expected to give a higher signal when the tissue is contracted compared to when it is dilated. The change in fluorescence intensity observed in the GFP::PEZO-1 movie on its own is not an indication of any mechanosensing. If the authors wish to claim enrichment in the valve at a certain time point they would need to do a ratiometric comparison with a membrane marker such as PH::mCherry.

This is an excellent point and we have removed all comments suggesting quantitative differences in expression in the spermatheca.

5) "To mimic a gain-of-function phenotype in pezo-1, we fed wildtype animals with Yoda1, a PIEZO1 specific chemical agonist, which keeps the channel open" – No control was performed to show that Yoda1 doesn't have side effects in worms. There are plenty of chemicals that are supposedly specific but actually are not. A simple experiment that could at least show Yoda1's phenotype is PEZO-1-dependent is to perform the treatment on pezo-1KO, which we expect to be refractory to the drug and display the same brood size as pezo-1KO on its own.

We agreed with the reviewer’s comments and added the control experiments with the treatment of Yoda-1 on pezo-1 CΔ in Figure 2C.

6) "The defective ovulation is likely due to incomplete constriction of the sheath cells and improper gating of the distal spermathecal valve." – Incomplete constriction of the sheath is sufficient to explain the entry phenotype and it is not necessary to invoke improper gating of the distal spermathecal valve, which was not specifically tested. Moreover, improper sheath contraction is consistent with the absence of sperm, while distal valve defects are not.

We revised the sentence to “The defective ovulation is likely due to incomplete constriction of the sheath cells”. Thanks for that suggestion.

7) "Of the oocytes that did successfully enter the spermatheca, many were frequently crushed when they exited through the sp-ut valve (Figure 3A'-E', Video 2-3). We observed that the sp-ut valve, labeled by DLG-1::GFP, did not completely open when the oocyte attempted to exit the spermatheca, which may lead to crushing the oocyte" – again, a defect in the sp-ut valve is not necessary to explain the phenotype because oocytes are not normally meant to pass through the sp-ut valve and the egg shell normally protects the exiting embryo.

Though it is true that oocytes do not normally pass through the sp-ut valve in wild-type animals, oocytes from spe mutants, which are not fertilized, do survive their transit through the sp-ut valve and the vulva without being crushed. Many spe mutants are readily identifiable because of the number of undamaged oocytes on the plate.

8) Knocking down the positive calcium regulators itr-1, sca-1, and orai-1 by RNAi enhanced the pezo-1 null phenotype and knocking down the negative calcium regulator lfe-1 partially rescued the null phenotype. Based on these findings the authors write: "Therefore, these observations are consistent with the hypothesis that pezo-1 may regulate cytosolic and ER Ca²⁺ homeostasis, which is crucial for proper spermathecal contractility and dilation." – However, there is no direct evidence in the paper to support the hypothesis that pezo-1 is controlling calcium levels in the reproductive system. Furthermore, in the following section the authors observe and measure directly calcium signaling in the spermatheca and observe no defects. It appears that the authors approached this project with a strong preconception of what pezo-1 is doing (based on literature in other systems) and do not allow the observations to lead to the most plausible explanations.

Guilty as charged. We have toned down the entire emphasis on calcium signaling throughout the manuscript.

9) "Surprisingly, GCaMP3 fluorescence in pezo-1 was not significantly different than wildtype" – to me this is not surprising, since the phenotype looks like a problem with sheath contraction due to absence of sperm. Perhaps if the authors imaged GCaMP3 in the sheath they would see a lower signal in the mutant, but that could also be because of the absence of sperm and not a direct role of pezo-1 in calcium release.

We agree and hope to pursue calcium signaling in specific tissues involved in this process in the future. Sheath-specific imaging of calcium is definitely on our list for the future.

10) "It should be noted that we only imaged the GCaMP3 reporter during the very first three ovulations in young adult animals to avoid Ca²⁺ signaling interference from a distorted gonad morphology and mechanical pressure from a gravid uterus… our data does not exclude the possibility that Ca²⁺ signaling may be more severely disrupted as the animal goes through more ovulation cycles.” – despite the technical difficulties, the authors could image older worms in order to rule out or prove that Ca²⁺ signaling may be disrupted in the spermatheca.

We actually tried this and because of the broken oocytes both in the uterus and some in the oviduct, these images were far too confusing to make sound conclusions. Furthermore, the bigger problem that we have yet to resolve is that older animals do not ovulate under our imaging conditions, making it impossible to image calcium dynamics even if the animals did not have crushed oocytes in their uteri. The process of squeezing the animals between a coverslip and an agarose pad often pops older and larger wild-type animals, making movies of later embryo transits harder to image.

11) I'm confused about the data regarding sperm navigation to the spermatheca. In subsection Sperm from matings rescues low brood size phenotype in pezo-1 mutants it is shown that pezo-1 mutant hermaphrodites resumed ovulation and fertilization upon mating once the male's sperm (from either wildtype, spe-9(hc52ts), or pezo-1 males) reached the spermatheca. From this we can conclude that pezo-1 spermatheca have no problem to attract sperm. (the same conclusion is also drawn from the AID experiment in which pezo-1 is degraded in the somatic tissues and rescued by mating with wt male sperm). However, in subsection Sperm guidance and navigation is disrupted in pezo-1 mutants it is shown that in pezo-1 hermaphrodites few sperm reach the spermatheca after mating and most sperm remained in zones furthest from the spermatheca. This was observed for both wildtype and pezo-1 mutant male sperm in mating with pezo-1 hermaphrodites. To me, these two results are contradictory, and the authors must clarify this point. Are pezo-1 hermaphrodites defective in attracting sperm to the spermatheca? And if so, how can mating rescue their phenotype?

Our data is contradictory. We do show that mating into pezo-1 hermaphrodites does rescue the ovulation and brood size. So mated sperm, whether from wild-type males or from pezo-1 males, can navigate to the spermatheca to fertilize oocytes. We now suspect that there is a defect in hermaphrodite self-sperm and their ability to navigate back to the spermatheca after being expelled during ovulation. This remains an interesting contradiction and one that we are currently pursuing. We had hoped to report it as one of the complexities of the pezo-1 phenotype. We have added a few sentences to this section of the Discussion to be open about this apparent contradiction in sperm phenotypes. We address this concern above with reviewer #1’s comment 2. Please refer to Figure 6—figure supplement 1. The sperm distribution was affected in pezo-1 CΔ; fem-1(hc17) after mating, however, there are still 40-50% stained sperm able to navigate to the spermatheca (Figure 6—figure supplement 1E). Additionally, the fertilization rate of the laid embryos (we used the total sperm number here since the sperm in the uteri are still able to crawl back to spermatheca) is lower in pezo-1 CΔ; fem-1(hc17) at permissive temperature (15° C) after mating with both wild type and pezo-1 CΔ when compared to fem-1(hc17) only.

12) Auxin Induced Degradation is performed by tagging pezo-1 with the degron sequence and crossing with tir-1::mRuby expressing worms. However, the authors don't show any data regarding the efficacy of the degradation. Since the protein is membranal, it is expected that ubiquitination of the degron might not lead immediately to degradation. If the authors labelled the fluorescently-tagged versions of pezo-1 they could quantify the degradation by measuring fluorescence. Another option would be to perform a Western blot, if they have an antibody that recognizes pezo-1. Without such controls it is hard to draw a conclusion from the AID experiments because we don't know how much of the protein was actually degraded in either the germline or somatic tissues. Is the reason for the weaker phenotype compared to the KO the tissue specificity or residual protein?

Thank you for this criticism. We have repeated these experiments with our GFP-tagged PEZO-1 to address the level of knockdown and have observed that at least 2-3 fold of fluorescent intensity of GFP::PEZO-1::Degron was reduced when the animal treated with auxin compared to non-auxin control. These results are now shown in the Figure 8—figure supplement 2.

13) Figure 8 panels H-L – the text describing these results is not clear and the labeling of two of the images must be wrong because they are all labelled with Ppie-1::tir-1::mRuby but in the graph two bars are labelled with Peft-3. In the text it is hard to follow in which case auxin was added, what the promoter was and what the result was. From the text I understood that there was a sperm navigation defect when pezo-1 was degraded in the somatic tissues, but from the graph it appears the sperm navigation defect was only observed when pezo-1 was degraded in the germline.

We have addressed these errors in the text and Figure 8. Panels H-L are now G-J and should be much easier to follow now. We do not show DIC with MitoTracker images for the Peft-3 strain because there was no significant difference from controls. We only show the bar graph for Peft-3 in panel 8K to demonstrate that it is not significantly different with or without auxin.

14) The rationale behind the experiments with inx-14 and inx-22 is not clear and I disagree with the authors conclusion that "the enhancement of phenotypes with these innexins suggests that PEZO-1 may be involved in regulating inter-tissue signaling.". In my view this is a sick + sick = sicker scenario and without further experiments to directly tie pezo-1 to inter-tissue signaling the authors cannot make such claims.

We agree with the reviewer’s comment and removed the data for future study.

15) Similarly, the observation of yolk accumulation in the pseudocoelomic cavity surrounding the gonad of the pezo-1 mutants is an intriguing observation that could be developed with further experiments (in a future manuscript), but on its own does not warrant a place in this paper. The suggesting that yolk endocytosis into the oocytes is defective and that the reduced endocytosis of yolk may disrupt prostaglandin synthesis in the oocyte, which may lead to a defect in the oocytes' ability to attract sperm towards the spermatheca is super speculative and does not belong in the Results section.

Thank you for this feedback. We agree that this was highly speculative and have omitted the figure. We do speculate in the Discussion that prostaglandin synthesis could be perturbed since that is a known attractant for sperm to migrate to the spermatheca, but we keep that short and make it clear that this is pure speculation.

Reviewer #3:

General assessment: This paper describes a functional analysis of pezo-1, the sole PIEZO channel ortholog in C. elegans. PIEZO channels are involved in mechanotransduction in a variety of systems and contexts. Here, several mutations are created and analyzed including deletions, an early stop, and gain-of-function mutations associated with human disease. pezo-1 is widely expressed in different worm tissues, notably reproductive tissues including both somatic and germline, and disruption of pezo-1 leads to fecundity defects. Assays for reproductive processes implicate defects in ovulation and sperm targeting that likely lead to this decreased fertility. While calcium signaling appears normal, mutations in genes involved in calcium signaling enhance pezo-1 as does certain disruptions of gonadal signaling. Tissue-specific rescue experiments and auxin-induced degradation are used to analyze the focus of action of pezo-1 in different reproductive processes. This paper covers a lot of ground: analysis of several distinct phenotypes in pezo-1 mutants, calcium imaging, genetic interactions, interrogation of disease alleles, and use of the relatively new auxin-induced degradation system to assess tissue specific effects. Overall, the experiments fit together well and make a coherent story.

While I have extensive comments, my major specific questions and concerns are about the following, described in more detail below (*):

1) Description and interpretation of experiments involving spe-9

We revised the text and carefully interpret the spe-9 data in the manuscript.

2) Controls for the experiment shown in Figure 6E

We added new control data and revised the figure.

3) Compared to other experiments, the inx genetic interaction experiments are relatively uninformative, and I suggest toning down the interpretation of the results. I agree that pezo-1 appears to be required for "inter-tissue signaling" but it is not clear how many cases are direct.

We agree with the reviewer’s comment and remove the inx genetic interaction data for future study.

4) Auxin experiment controls

We added the AID control data in the Figure 8 and Figure 8—figure supplement 2.

5) Details of sperm navigation experiments

We revised the figure and text and added a few new experiments to clarify the experiment.

Comments:

Re: Widespread expression of PEZO-1:

Multiple reporter knock-ins are used to examine where PEZO-1 is expressed. Images in Figures 1 and Figure 1—figure supplement 1 clearly show that PEZO-1 is expressed in several tissues including germ line. However, whether different transgenes showed consistent expression patterns should be stated. A schematic of the C. elegans gonad would help non-experts interpret the images and some added labeling would be useful.

We appreciate the reviewer’s comment regarding the expression pattern of PEZO-1. Dr. Paul Sternberg’s lab reported the expression patterns of PEZO-1, consistent with our data. They had expressed GFP driven by the pezo-1 promoter (Abstract 739C at 22^nd International C. elegans conference). We have added a schematic of the C. elegans gonad in Figure 1 F and better labeling throughout our figures.

In particular:

In Figure 1B, label intestine

Done

For Figure 1F, additional description and labeling is needed for context. Does the lower right of the panel show developing sperm, developing oocytes, or something else?

We have clarified what these cells are in the legend.

For 1G, label both oocytes and the central structure (intestine?).

Done.

For 1J, indicate the sheath cells with an arrow.

Done.

Re Figure 1—figure supplement 1D: Why are both "GFP" and mScarlet shown in this image; and what structures is GFP associated with?

We have added more detail to the legend as to what structures are GFP+. It turns out that our GFP fusion lights up the male tail fan, a sensory structure needed for mating. Anterior to that is the cloaca/spicules also lighting up green. We made these trans-heterozygotes to show that the two fusion proteins overlap but also have some distinct localizations. Given that 8 of the 14 isoforms would contain the N-terminal GFP fusion, this image suggests that only the full length forms are expressed in the male tail fan.

Subsection “PEZO-1 is expressed in multiple tissues throughout development”. This section, especially the statement "GFP::PEZO-1 is expressed in both spermathecal valves until the valves open" might be read to indicate that PEZO-1 localization changes during valve opening or other events of ovulation. Was this observed? This should be clarified, and any data indicating change in localization would need to be pointed out.

We corrected the language here as not to suggest any change in localization.

Re: Deletion of pezo-1 reduces brood size

These data show several different deletion/ putative loss of function alleles of pezo-1 were generated and give similar – though different strength – phenotypes of reduced fecundity and embryonic inviability. The fecundity defect worsens with age of the hermaphrodite. Treatment with a PIEZO agonist causes a phenotype similar to that of deletion alleles. It is notable that both lof and gof cause similar phenotypes. How do the authors interpret this effect? Is it consistent with other studies of PIEZO activity in other systems and the known mechanisms of action of these channels?

We thank the reviewer for this comment. Dysfunctions of PIEZO1 and PIEZO2 caused a variety of physiological disorders, which were caused by both gain-of-function and loss-of-function. A dogmatic model is that osmoregulation is disturbed in either gof or lof mutants, which interfered with downstream cellular signaling pathways. However, the cellular and molecular mechanisms of PIEZO gain-of-function vs. PIEZO loss-of-function in these diseases are not well understood. The ovulation and fertility process are complicated and are regulated by a sophisticated signaling network. In our study, there are a few speculations about the role of PEZO-1 in reproductive signal transduction. We speculate that either loss-of-function or gain-of-function may spatiotemporally disturb the reproductive signaling pathways, which lead to a common read-out as reduced fecundity and embryonic inviability. We revised and highlighted our working model in Figure 10.

Since treatment with either of two different concentrations of the agonist yields similar effects, it does not seem necessary to show both concentrations. If a wider range of concentrations was tested and gave dose-dependent effects, this could be informative. Some deletion mutants might have a different dose-response curve than the wild type.

It seems like more could be done to take advantage of this pharmacological tool, though this is not necessary.

These are good points and since we did not test a variety of doses, we now just show one dose of Yoda.

Re: severe ovulation defects

Live observations of ovulation reveal defects in sheath contractions and valve opening that move the oocyte/embryo forward through the gonad.

These data are convincing, though it would make sense to group the observations about oocyte crushing, oocytic masses, etc. from the previous section of the results with this section – or to simply combine the two sections into one.

This is a good suggestion and we merged these two sections since they both highlight our studies of the ovulation defects.

Re: PEZO-1 mutants genetically interact with cytosolic Ca++ regulators/ show normal calcium signaling during ovulation

While most of the ms is nicely written, this section is hard to follow.

*In this reviewer's opinion, the term "genetically interact" can be problematic since it is neither precise for geneticists nor very accessible to non-geneticists. Even though calcium imaging appears normal in the pezo mutant, these experiments establish a potential link between the mechanisms of PEZO-1 and canonical PIEZO channels. It would be clearer for most readers to frame them in terms of manipulating Ca and avoid terms like positive or negative genetic interactions or phrases like "enhancing the reduction of brood size". This is especially important because these are such interesting experiments.

We did try to alter our language here to make it easier to read and omitted positive and negative genetic interactions. However, these genetic arguments do usually use such language as enhance or suppress when discussing phenotypes of double mutants. Since we were not directly measuring calcium, it is safer to conclude that the depletion of a given gene enhanced or suppressed the phenotypes of pezo-1 alone.

Brood size data are presented as scatterplots with separate counts of early progeny and later progeny. For most of the analysis, it is unclear why splitting the data in this manner is necessary. In many cases, it makes it more difficult for a reader to compare the phenotypes of different strains, e.g. for comparing pezo-1 alleles and in the genetic interaction experiments.

In addition, the wild-type brood sizes are surprisingly variable. Does the variability decrease if full brood sizes are considered? One explanation for this could be variability in staging L4s. In turn, this raises the question of whether splitting the data is the most accurate way to show brood sizes (at least in cases where progeny are abundant at both time points – when essentially all offspring are produced early, splitting the data is indeed helpful).

Overall, it seems worth considering 1- if the data could be presented in a simpler format for some experiments and 2- if the format is not revised, if the full brood counts should be included in the supplemental data.

We thank reviewer’s comments and adjusted a few figures (Figure 2A, 2C 8E, 8F) to show the total brood for the full time period. However, we did split the brood sizes into two time periods for some experiments (like Figure 4) to emphasize that the onset of the phenotypes was late. We had considered only showing brood sizes of Day2 and later adults to highlight the decrease in brood size, but thought it best to show that Day1 adults were not as affected.

Re: Sperm from matings rescues pezo-1 low brood size

The experiments here show the result that pezo-1 does not appear to be required in sperm and sperm defects are not responsible for pezo-1 reproductive phenotypes.

-pezo-1 males are fully fertile in crosses to fem-1 females, indicating their sperm are functional for migration and fertilization. This is convincing.

-Crossing males to sperm-depleted pezo-1 hermaphrodites induces resumption of offspring production, indicating pezo-1 is not required for the sperm-to-ovulation signal. This is also convincing.

Agree. Our data suggests that mutant male sperm are fully able to induce ovulation, to navigate to the spermatheca upon mating, and to fertilize oocytes.

The authors show that signaling from oocyte to sperm, needed for navigation, is disrupted; both wild-type and pezo-1 sperm have localization defects within pezo-1 hermaphrodites. However, there do not appear to be defects in the signaling from sperm to oocytes/sheath cells that increases ovulation rate. When sperm are depleted, ovulation rate is low, but re-introduction of sperm is sufficient to induce ovulation. Furthermore, pezo-1 sperm introduced into females do fertilize oocytes, implying they are functional for migration, fertilization, and induction of ovulation.

Also agree.

*The way experiments in this section are presented is misleading. Based on the title, I expected to see results that pezo-1 reproductive defects are due to their sperm. The presentation of the spe-9 experiment, as a test of "whether sperm signaling was defective" as well as the description of the result, further imply a sperm-based defect.

Ultimately, the spe-9 result is not surprising. spe-9 sperm are known to signal ovulation in wild type, and it is expected that re-introduction of sperm into a depleted hermaphrodite would increase ovulation rate if oocytes can respond to MSP. The data here are fine but the text should be revised for clarity and accessibility. This also applies in the Abstract and spe-9 experiments done with disease alleles.

Thank you for these comments. We have altered the writing to make it clear that we think sperm navigation is disrupted but not because the sperm are defective but rather the attractant signal for the sperm to migrate from the uterus to the spermatheca is disrupted. By “sperm-signaling”, we were thinking the signals to the sperm, but now see how this phrase sounds like the sperm is defective in signaling. We modified the Abstract and spe-9 discussion as well. Our data however is consistent with the conclusion that the attractive signal for sperm to migrate back to the spermatheca is defective and that the mutant sperm themselves are fully capable of sensing the signal, crawling, repopulating the spermatheca, and in fem-1 females, even fertilizing oocytes. However, the feedback from the three reviewers has prompted us to ask whether there might be a defect in self-sperm versus cross sperm. Even though male cross sperm don’t navigate as well as WT, they do still crawl towards the spermatheca, whereas mutant self-sperm get washed out of the spermatheca and never make it back. We have addressed these issues by the new experiments with pezo-1 females in Figure 6—figure supplement 1.

The authors do not comment on quantitative differences between crosses into wild-type hermaphrodites and into pezo-1 hermaphrodites, and statistics are only presented for non-mated herm vs various mated conditions. Have the authors considered these comparisons?

This too is a good suggestion. The data in Figure 6B suggests that mutant sperm when mated with WT can migrate to the spermatheca and fertilize a large number of oocytes. However, when mated into the C∆ hermaphrodites, they do sire cross progeny but at greatly reduced levels. This we believe is further support that the attractive signal from the oocytes or sheath cells are somewhat defective and not that there is a problem with the sperm crawling and fertilizing oocytes. This data is also consistent with Figure 7J where we do quantitate where these cross sperm are located 60 minutes after removing the males. We have reworked this entire section to make it clearer that the signal of pezo-1 mutants to attract sperm to the spermatheca is what appears to be dysfunctional.

We have carried out an additional experiment to test whether one possible defect was in the ability of the sheath to respond to the sperm signal to trigger ovulation. Even though our data in Figure 6E suggests that just the presence of sperm can trigger ovulation, we went on to show that purified MSP can also trigger ovulation in older pezo-1 ∆ hermaphrodites that are depleted of sperm and are no longer ovulating. We added this data in Figure 6F, G, and H.

*To interpret 6E, additional controls are needed in which wild-type male sperm are supplied and ovulation rates are measured.

We added the control in Figure 6E.

Direct measurement of ovulation rate – as shown in Figure 6E for spe-9 – would be a more direct assay for induction of ovulation by introduced sperm.

An n of 4-6 seems very low for these experiments.

We increased number of tested gonad arms to >10 in Figure 6E and other ovulation assays.

*Re: Sperm navigation is disrupted

– Does zone 3 include only the spermatheca, as described in the text, or the spermatheca and adjacent region of the uterus, as shown in Figure 7 (and as it is usually defined in publications from the Miller lab and others)? Please clarify the text.

We defined the zone 3 as the region including the entire spermatheca and an adjacent embryo.

– Were sperm counted in a single focal plane, or throughout the gonad?

We quantified sperm throughout the gonad.

– It is unclear why 72 hr adult hermaphrodites were used for these experiments; younger animals are more typically assayed. What is the rationale for this?

We intentionally used older animals to make sure the animal was totally depleted of self-sperm.

– The images in Figure 7 show 72 hr adults; the quantification is with 60 hr adults. While it might seem unlikely, this difference could matter. At 60 hours, there is likely to be some hermaphrodite sperm remaining, at least in wild type, while at 72 hr sperm are more likely to be depleted, which would presumably alter the signaling environment. Related to this concern, there appear to be quite a few sperm in zones 2 and 3 in panel G. The data in 7H suggests fewer sperm should be visible in zone 3.

Figure 7J quantifies all of the data (n=8) that is represented by Figure 7H and 7I. Since 7J is the average of 8 animals, we had shown an animal with the most sperm in the zone 3. We have replaced 7H and 7I with an animal that more typical reflects 7J.

– There is a mismatch between the callouts and labels for the image panels in Figure 7. According to the text, 7B,D,F should show wild-type hermaphrodites; according to labels, this is B,D,E.

– The order of image panels in Figure 7 is confusing, in part because some crosses are not shown. One could add the two "missing" combinations (pezo-1 x WT and WT x pezo, zone 1-2). Alternatively, 7B and 7F could be moved to supplementary data or not shown.

We also revised much of Figure 7 for clarifying the comments above. We think this figure is much easier to follow now.

– In 7H: Are the data from one replicate, so that the error bars reflect worm-to-worm variability, or are the data from the 3 repeats, so the error bars reflect differences among the average distribution in each experiment?

We repeated the experiments at least three times with 3-5 worms each to precisely control the mating time windows, and error bars reflect worm-to-worm variability.

– For indicating p values in 7H, brackets should be used to show what is being compared. Presumably. the current comparisons are 1 vs 2, 3 vs 4; comparing the same male sperm in 2 different hermaphrodites. It would be interesting to add statistical comparisons for 1 vs 3, 2 vs 4, i.e. comparing different male sperm in the same hermaphrodites.

These are all very good suggestions and we totally rearranged the data in Figure 7 and cleaned up the callouts, labels, and figure legend. We now show representative images of at least one zone for each mating combination, and quantified all in Figure 7J.

Re: Auxin experiments

– The use of auxin induced degradation to disrupt function is a nice way to try to examine tissue-specific effects.

*– Data presented in 8E,F,G show the different degron strains either untreated or treated with auxin. A control is needed for treatment with auxin in the absence of the degron transgene – especially since all strains undergo a similar reduction in brood size in the presence of auxin (8E,F)

This is a very good point and we have added such a control shown in Figure 8E in which the strains, including wild type (Bristol N₂), PEZO-1::degron and each tir-1::mRuby transgenes alone driven by different promoters, were treated with and without auxin. Auxin alone did not reduce the brood size of these strains.

– Figure 8C,D – The sperm expression is described as faint, and it is indeed hard to see in the images. It is not unexpected that expression might be low, but are the authors confident that the putative sperm expression is not autofluorescence?

We added new data of the sperm autofluorescence in the Figure 8—figure supplement 1, with same imaging acquisition and exposure conditions. We were unable to detect sperm autofluorescence with wavelength of 561 nm, but we did observe that sperm cytosol has high autofluorescence with wavelength of 488 nm. Only germline specific tir-1::mRuby strains display red fluorescence in the sperm.

– It should be made clear in the text that germline expression includes (or is likely to include) both sperm and oocytes, so that either tissue could be the primary course of phenotypes observed with the germline AID strains. I do agree that it is more likely to be due to oocyte/ attractant signaling defects.

We revised the text to make the point clearer.

– The text states that Figure 8H, J show the somatic-specific (Peft-3) AID strain with auxin, but the figure is labeled as the Ppie-1 strain without auxin. Which is it?

We rearranged this whole figure to make it cleaner and corrected all the labels and callouts in the text and legend.

– The age of the hermaphrodites used for the mitotracker assays needs to be stated. This is relevant to whether or not self sperm could be contribute to targeting defects.

We state the stage of worms in the Figure 8K, and we added new data to address whether our phenotype is self-sperm dependent in Figure 6—figure supplement 1.

Re: Multiple roles in inter-tissue signaling

– *The data in Figure S5 demonstrate enhancement of the brood size defects in inx; pezo as compared to inx(RNAi) or pezo- alone. However, this could be interpreted in many different ways, and does not necessarily mean that the same process is being affected, especially when a relatively non-specific phenotype is the assay. Thus, this experiment does not add insight.

We see your point since inx RNAi does significantly reduce the brood size in wild-type animals, such RNAi may further reduce the brood size in other genetic backgrounds whether in the same pathway or not. So, we have omitted this figure and the relevant text that accompanied it.

– The images in Figure S6 do show excess extracellular yolk in pezo-1 that is not present in WT. However, YP170 levels in pezo-1 oocytes appear higher than in wild type, if anything. Therefore, I am not convinced that these data provide evidence for defects in YP170 endocytosis. Instead, is it possible that there are defects within oocytes, in conversion of yolk to downstream signaling molecules? Without additional experiments, this also seems to be dispensable.

Overall, while the experiments in this section do not contradict the model of pezo-1's being involved in inter-tissue signaling, they do little to support it.

Given the comments of all three reviewers, we agree that this figure can also be removed. This is an observation we are pursuing but agree that much more work would be required to make this an important part of the story.

https://doi.org/10.7554/eLife.53603.sa2

Article and author information

Author details

Xiaofei Bai

National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, United States

Contribution
Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing - original draft

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0001-8179-8162
Jeff Bouffard

Department of Bioengineering, Northeastern University, Boston, United States

Contribution
Data curation, Formal analysis, Investigation, Methodology

Competing interests
No competing interests declared
Avery Lord

Department of Biology, Northeastern University, Boston, United States

Contribution
Data curation, Investigation

Competing interests
No competing interests declared
Katherine Brugman

Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, United States

Contribution
Formal analysis, Methodology

Competing interests
No competing interests declared
Paul W Sternberg

Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, United States

Contribution
Conceptualization, Supervision, Funding acquisition

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-7699-0173
Erin J Cram

Department of Biology, Northeastern University, Boston, United States

Contribution
Conceptualization, Resources, Supervision, Funding acquisition, Investigation, Methodology, Writing - review and editing

Competing interests
No competing interests declared
Andy Golden

National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, United States

Contribution
Conceptualization, Supervision, Methodology, Writing - review and editing

For correspondence
andyg@nih.gov

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-8599-2031

Funding

National Institute of General Medical Sciences (GM110268)

Erin J Cram

National Institute of Neurological Disorders and Stroke (R01 NS113119)

Paul W Sternberg

NIH Clinical Center (R24 0D023041)

Paul W Sternberg

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank the Caenorhabditis Genetics Center, which is funded by the National Institutes of Health Office of Research Infrastructure Programs (P40OD010440), for providing strains for this study. We thank Dr Orna Cohen-Fix for generously sharing the SP-12::GFP strain, and Dr Harold Smith for sharing the BA17 fem-1(hc17ts) strain. We also thank Dr David Greenstein for sharing fluorescein-tagged MSP and discussion about mating assays. We are grateful to the members of the Golden laboratory, Dr Peter Kropp, Dr Tao Cai, Rosie Bauer, Isabella Zafra, and Carina Graham for productive discussions and preparing reagents. We thank our summer intern Kyle Wilson for manuscript editing. We especially thank Dr Harold Smith, Dr Orna Cohen-Fix, Dr Kevin O’Connell, Dr Katherine McJunkin and Dan Konzman for critical inputs on the project and feedback on the manuscript. We thank all members of the Baltimore Worm Club for providing feedback and suggestions to our investigations.

Senior Editor

Didier YR Stainier, Max Planck Institute for Heart and Lung Research, Germany

Reviewing Editor

Diana S Chu, San Francisco State University, United States

Reviewer

Diana S Chu, San Francisco State University, United States

Version history

Received: November 14, 2019
Accepted: June 2, 2020
Accepted Manuscript published: June 3, 2020 (version 1)
Accepted Manuscript updated: June 4, 2020 (version 2)
Version of Record published: July 7, 2020 (version 3)

Copyright

This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.