Human DECR1 is an androgen-repressed survival factor that regulates PUFA oxidation to protect prostate tumor cells from ferroptosis
- University of Adelaide Medical School and Freemasons Foundation Centre for Men’s Health, University of Adelaide, Australia
- South Australian Health and Medical Research Institute, Australia
- KU Leuven- University of Leuven, LKI- Leuven Cancer Institute, Department of Oncology, Laboratory of Lipid Metabolism and Cancer, Belgium
- Tumour Targeting Laboratory, Olivia Newton-John Cancer Research Institute, and School of Cancer Medicine, La Trobe University, Australia
- Dame Roma Mitchell Cancer Research Laboratories, University of Adelaide, Australia
- NHMRC Clinical Trials Centre, and Centenary Institute, The University of Sydney, Australia
- Translational Cancer Metabolism Laboratory, School of Medical Sciences and Prince of Wales Clinical School, UNSW Sydney, Australia
- Garvan Institute of Medical Research, NSW 2010; University of Sydney, NSW 2006; and University of New South Wales, Australia
- College of Medicine and Public Health, Flinders University, Australia
- Discipline of Physiology, School of Medical Sciences, Charles Perkins Centre, Faculty of Medicine and Health, The University of Sydney, Australia
Figures
Figure 1 with 1 supplement
Fatty acid β-oxidation genes are overexpressed in prostate cancer and targeting this process is effective in patient-derived human prostatic ex vivo tumor explants.
(A) Etomoxir reduced cell proliferation in patient-derived human prostatic ex vivo tumor explants. Tissues were treated with 100 µM etomoxir for 72 hr, sections were fixed in formalin, paraffin …
Figure 1—figure supplement 1
Fatty acid metabolism is consistently altered in clinical prostate tumors.
(A) Cell viability of LNCaP cells treated with indicated concentrations of etomoxir for 72 hr. Cell viability was determined using CyQUANT Cell Assay. (B) A meta-analysis of 735 lipid metabolism …
Figure 2
DECR1 protein in overexpressed in malignant prostate cells/tissues.
(A) Violin plots of DECR1 protein overexpression in primary PCa tissues compared to benign prostate tissues in two independent datasets. (B) Representative DECR1 IHC staining of benign prostate …
Figure 3 with 1 supplement
DECR1 is an androgen-repressed gene.
(A) DECR1 mRNA and protein was measured by qRT-PCR and western blot analysis after PCa cell treatment with dihydrotestosterone (DHT), or (B) enzalutamide (ENZ). Relative mRNA expression of DECR1 was …
Figure 3—figure supplement 1
Androgenic regulation of DECR1 expression.
(A) Bar graphs of DECR1 mRNA expression in two publically available datasets shows DECR1 mRNA expression decreased after LNCaP treatment with DHT (GSE7868) or R1881 (GSE22606). (B) DECR1 expression …
Figure 4 with 1 supplement
DECR1 knockdown interrupts PUFA β-oxidation in PCa cells.
(A) Schematic of DECR1 function in fatty acid (FA) β-oxidation. In order to translocate FAs into the mitochondria, CPT1 converts long-chain acyl-CoA species to their corresponding long-chain …
Figure 4—figure supplement 1
Effects of DECR1 on prostate cancer cellular metabolism.
(A) Oxygen consumption rate (OCR) was assessed in LNCaP cells supplemented with the PUFA linoleic acid (LA). Each data point represents an OCR measurement. ATP production, maximal mitochondrial …
Figure 5 with 3 supplements
DECR1 knockdown suppresses oncogenic phenotypes of PCa cells.
(A) Cell viability after DECR1 knockdown in non-malignant PNT1 prostate cells; hormone-responsive PCa cell lines (LNCaP and VCaP); castrate-resistant V16D and 22RV1 cell lines and …
Figure 5—figure supplement 1
Depletion of extracellular lipids prevents antiproliferative effects of DECR1 in prostate cancer cells.
(A) Cell viability and cell death after DECR1 knockdown in LNCaP and 22RV1 cultured in full serum media.
Cell viability and cell death were measured using trypan blue exclusion following 96 hr DECR1 knockdown. Percentages are represented relative to the control siRNA; n = 3 independent experiments per cell line.
Figure 5—figure supplement 2
DECR1 suppresses growth of prostate tumor xenografts in mice.
(A) Individual tumor growth of shControl and shDECR1 cells in LNCaP-xenograft tumors. (B) Violin plots of mKi67 and DECR1 mRNA expression in LNCaP tumors (n = 5 mice, shControl; n = 4 mice, …
Figure 5—figure supplement 3
The sequence of the DECR1 shRNA and hDECR1 vectors.
Figure 6 with 2 supplements
DECR1 knockdown induces PUFA accumulation, lipid peroxidation and ferroptosis.
(A) Abundance of total PUFAs and (B) total abundance of lipid species in phospholipids from control and DECR1 knockdown cells supplemented with linoleic acid (LA). (C) Malondialdehyde (MDA), an …
Figure 6—figure supplement 1
Depletion of DECR1 sensitizes prostate cancer cells to ferroptosis inducing agents.
(A) Abundance of total SFA and (B) MUFA species in phospholipids from control and DECR1 knockdown cells supplemented with linoleic acid (LA). (C) Abundance of total SFAs (left) and MUFAs (right) in …
Figure 6—figure supplement 2
Targeting DECR1 does not induce apoptosis of prostate cancer cells.
(A) LNCaP cells were stained with AnnexinV-Phycoerythrin (PE)/7-Aminoactinomycin D (7-AAD) followed by flow cytometry analysis after 96 hr DECR1 knockdown to detect apoptotic cells. (B) Cell death …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus, male) | NOD scid Gamma (M. musculus, male,) Mice | The Jackson Laboratory/Interbred at SAHMRI Bioresources | NOD.Cg-Prkdcscid/J RRID:IMSR_JAX:001303 | |
| Cell line (Homo-sapiens) | LNCaP | ATCC | ATCC CRL-1740 RRID:CVCL_1379 | |
| Cell line (Homo-sapiens) | VCaP | ATCC | ATCC CRL-2876 RRID:CVCL_2235 | |
| Cell line (Homo-sapiens) | 22RV1 | ATCC | ATCC CRL-2505 RRID:CVCL_1045 | |
| Cell line (Homo-sapiens) | PNT1A | The European Collection of Authenticated Cell Cultures (ECACC) | Cat# 95012614 RRID:CVCL_2163 | |
| Cell line (Homo-sapiens) | PNT2 | The European Collection of Authenticated Cell Cultures (ECACC) | Cat# 95012613 RRID:CVCL_2164 | |
| Cell line (Homo-sapiens) | V16D | PMID:27046225 | Kind gift from Prof. Amina Zoubeidi | |
| Cell line (Homo-sapiens) | MR49F | PMID:27046225 | Kind gift from Prof. Amina Zoubeidi | |
| Transfected construct (Homo sapiens) | control siRNA | Dharmacon | D-001810-01-20 ON-TARGET plus Non-targeting siRNA #1 | transfected construct (human) |
| Transfected construct (Homo sapiens) | siDECR1-1 | Dharmacon | J-009642-05-0002 | transfected construct (human) |
| Transfected construct (Homo sapiens) | siDECR1-2 | Dharmacon | J-009642-06-0002 | transfected construct (human) |
| Transfected construct (Homo sapiens) | DECR1 shRNA lentivector | GenTargrt | LVS-1002 | Lentiviral construct to transfect and express the shRNA. |
| Transfected construct (Homo sapiens) | hDECR1 Overexpressing Lentivector | GenTargrt | LVS-2002 | Lentiviral construct to transfect and overexpress DECR1. |
| Transfected construct (Homo sapiens) | Negative control shRNA lentivector | GenTargrt | LVS-1002 | Lentiviral construct to transfect and express the shRNA. |
| Antibody | Anti-human β-Actin (Mouse monoclonal) | Sigma-Aldrich | Cat#: A5441 RRID:AB_476744 | (WB 1:2000) |
| Antibody | Anti-human-HSP90 (Rabbit Polyclonal) | Cell Signalling Technology | Cat#: 48745 RRID:CVCL_E547 | (WB 1:1000) |
| Antibody | Anti-human DECR1 (Rabbit Polyclonal) | Prestige Antibodies (Sigma-Aldrich) | Cat#: HPA023238 RRID:AB_1847587 | (WB 1:1000) (IHC: 1:500) |
| Antibody | Anti-human Malondialdehyde (Rabbit Polyclonal) | Abcam | Cat#: ab6463 RRID:AB_305484 | (WB 1:1000) |
| Antibody | Anti- human Androgen receptor (Rabbit Polyclonal) | Santa Cruz Biotechnology | Cat#: sc-816 RRID:AB_1563391 | (WB 1:1000) |
| Antibody | Anti-human PARP (Rabbit Polyclonal) | Cell Signalling Technology | Cat#: 9542 RRID:AB_592473 | (WB 1:1000) |
| Antibody | Anti-human Cytochrome C (Rabbit Polyclonal) | Abcam | Cat#: ab90529 RRID:AB_10673869 | (WB 1:2000) |
| Other | MitoTracker Red CMXRos | Thermo Fisher Scientific | Cat#: M7512 | ICC 1:1000 |
| Other | MitoSOX Red Mitochondrial Superoxide Indicator | Thermo Fisher Scientific | Cat#: M36008 | Flow Cytometry: 2.5 µM |
| Other | 3,3′-Diaminobenzidine (DAB) Enhanced Liquid Substrate System tetrahydrochloride | Sigma Aldrich | Cat#: D3939 | |
| Other | BODIPY-C11 | Thermo Fisher Scientific | Cat#: D3861 | Imaging: 5 µM |
| Antibody | Anti-human KI67 (Mouse monoclonal) | DAKO | Cat#: M7240 RRID:AB_2142367 | (IHC 1:200) |
| Antibody | Anti-human AR (Rabbit polyclonal) | Santa Cruz | Cat#: sc-816 RRID:AB_1563391 | (WB 1:1000) |
| Sequence-based reagent | DECR1_F | This paper | PCR primers | CTAAATGGCACAGCCTTCGT |
| Sequenced-based reagent | DECR1_R | This paper | PCR primers | AACCTGAACCAGTCTCAGCA |
| Sequence-based reagent | GAPDH_F | This paper | PCR primers | TGCACCACCAACTGCTTAGC |
| Sequenced-based reagent | GAPDH_R | This paper | PCR primers | GGCATGGACTGTGGTCATGAG |
| Sequence-based reagent | PPIA_F | This paper | PCR primers | GCATACGGGTCCTGGCAT |
| Sequence-based reagent | PPIA_R | This paper | PCR primers | ACATGCTTGCCATCCAACC |
| Sequence-based reagent | TUBA1B _F | This paper | PCR primers | CCTTCGCCTCCTAATCCCTA |
| Sequence-based reagent | TUBA1B _R | This paper | PCR primers | CCGTGTTCCAGGCAGTAGA |
| Sequence-based reagent | MKI67_F | This paper | PCR primers | GCCTGCTCGACCCTACAGA |
| Sequence-based reagent | MIK67_R | This paper | PCR primers | GCTTGTCAACTGCGGTTGC |
| Sequence-based reagent | L19_F | This paper | PCR primers | TGCCAGTGGAAAAATCAGCCA |
| Sequence-based reagent | L19_R | This paper | PCR primers | CAAAGCAAATCTCGACACCTTG |
| Sequence-based reagent | GUSB_F | This paper | PCR primers | CGTCCCACCTAGAATCTGCT |
| Sequence-based reagent | GUSB_R | This paper | PCR primers | TTGCTCACAAAGGTCACAGG |
| Sequence-based reagent | DECR1_F | This paper | ChIP-qPCR | TTCTGGAGCGCTAAGAGAGC |
| Sequence-based reagent | DECR1_R | This paper | ChIP-qPCR | AGGGCTTCATCTGACAGTGG |
| Sequence-based reagent | KLK3_F | This paper | ChIP-qPCR | GCCTGGATCTGAGAGAGATATCATC |
| Sequence-based reagent | KLK3_R | This paper | ChIP-qPCR | ACACCTTTTTTTTTCTGGATTGTTG |
| Sequence-based reagent | NC2_F | This paper | ChIP-qPCR | GTGAGTGCCCAGTTAGAGCATCTA |
| Sequence-based reagent | NC2_R | This paper | ChIP-qPCR | GGAACCAGTGGGTCTTGAAGTG |
| Chemical compound, drug | Etomoxir | Sigma Aldrich | Cat#: E1905 | |
| Chemical compound, drug | Dihydrotestosterone | Sigma Aldrich | Cas#: 521-18-6 | |
| Chemical compound, drug | Enzalutamide | Sapphire Bioscience | Cat#: S1250 | |
| Chemical compound, drug | Bovine-serum albumin | Bovostar | Cat#: BSAS-AU | |
| Chemical compound, drug | Linoleic acid | Sigma Aldrich | Cat#: L1376 | |
| Chemical compound, drug | Palmitic acid | Sigma Aldrich | Cat#: P0500 | |
| Chemical compound, drug | D-Luciferin | PerkinElmer | Cat#: 122799 | 3 mg/20 g |
| Chemical compound, drug | Deferoxamine | Sigma Aldrich | Cat#: D9533 | |
| Chemical compound, drug | Ferrostatin | Sigma Aldrich | Cat#: SML0583 | |
| Chemical compound, drug | Erastian | Sigma Aldrich | Cat#: E7781 | |
| Chemical compound, drug | ML210 | Tocris Bioscience | Cat#: 6429 | |
| Chemical compound, drug | FIN56 | Tocris Bioscience | Cat#: 6280 | |
| Chemical compound, drug | cell fractionation kit | Abcam | Cat#: ab109719 | |
| Chemical compound, drug | RNeasy RNA extraction kit | Qiagen | Cat#: 74136 | |
| Chemical compound, drug | iScript cDNA Synthesis kit | Bio-Rad | Cat#: 1708890 | |
| Chemical compound, drug | Seahorse XF Cell Mitochondrial Stress Test kit | Agilent | Cat#: 103015–100 | |
| Software, algorithm | GraphPad Prism | GraphPad Software, Inc | Prism V7 RRID:SCR_002798 | |
| Software, algorithm | R | R Development Core Team, 2019 | R version 3.6.2 RRID:SCR_001905 | |
| Software, algorithm | ReViSP | PMID:25561413 | ReViSP | Volume assessment of cancer spheroids |
| Software, algorithm | IVIS Spectrum In Vivo Imaging System | PerkinElmer | IVIS Spectrum In Vivo Imaging System RRID:SCR_018621 | Tumor volume analysis |
| Other | Lipofectamine RNAiMAX transfection reagent | Thermo Fisher Scientific | 13778075 | |
| Software, algorithm | ImageJ analysis software | NIH | ImageJ RRID:SCR_003070 | |
| Software, algorithm | TraceFinder v5.0 | Thermo Fisher Scientific | OPTON-30688 |
