NuRD subunit CHD4 regulates super-enhancer accessibility in rhabdomyosarcoma and represents a general tumor dependency
- Department of Oncology and Children’s Research Center, University Children’s Hospital, Switzerland
- Oncogenomics Section, Genetics Branch, National Cancer Institute, National Institutes of Health, United States
- Department of Biology, Institute of Molecular Systems Biology, ETH Zurich, Switzerland
Figures
Figure 1 with 2 supplements
CHD4, unlike RBBP4, causes FP-RMS tumor cell death.
(A) Illustrative scheme of the NuRD centered CRISPR/Cas9-based screen. Briefly, RH4 cells stably expressing Cas9 were transduced with lentiviral expression vectors containing either a BFP-labelled …
-
Figure 1—source data 1
Raw data and statistics related to Figure 1 and its supplements.
- https://cdn.elifesciences.org/articles/54993/elife-54993-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
The NuRD complex expression and function in FP-RMS.
(A) Representation of NuRD complex according to Bornelöv et al., 2018 and Torrado et al., 2017 (B) Expression levels, as normalized counts, of the displayed NuRD subunits (CHD4 in orange, HDAC2 in …
Figure 1—figure supplement 2
RBBP4 silencing reduces FP-RMS cell proliferation.
(A) Immunoblot confirms the knockdown of RBBP4 in RH4 cells by two shRNAs after 72hrs of shRNA expression induction by doxycycline (Dox). RH4 cells expressing a scramble shRNA (shScr) served as …
Figure 2 with 1 supplement
Mass spectrometry analysis of CHD4 interactome exposes interaction with the gene expression activator BRD4.
(A) Illustrative scheme of the affinity purification-mass spectrometry (AP-MS) studies performed to identify CHD4 interactors. CRISPR/Cas9-mediated repair was used to endogenously Flag tag CHD4 on …
-
Figure 2—source data 1
List of CHD4 candidate interactors.
- https://cdn.elifesciences.org/articles/54993/elife-54993-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
CRISPR/Cas9-mediated repair efficiently inserts a 3xFlag tag to endogenous CHD4 and BRD4.
(A, D and E) Immunoblot confirms the insertion of the 3xFlag tag at endogenous CHD4 (both N- and C-terminus) and BRD4 (N-terminus) in RH4 cells (Ab=antibody). GAPDH was used as a loading control and …
Figure 3 with 2 supplements
NuRD localizes to active chromatin with distinct compositions at enhancers and promoters.
(A) Pearson correlation heatmap of DNase I hypersensitivity (DNase) and ChIP-seq signal of the indicated epigenetic factors and histone marks in RH4 cells. Datasets are ordered by unsupervised …
-
Figure 3—source data 1
NuRD ChIP-seq locations.
- https://cdn.elifesciences.org/articles/54993/elife-54993-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
The NuRD complex localizes to similar enhancer locations in RH5 and SCMC cells as in RH4.
(A) Density plots and heatmaps depicting the ChIP-seq signal of the indicated NuRD subunits at CHD4/NuRD locations defined in RH4 cells (n=4,599). The rows show 8kb regions and color shading …
Figure 3—figure supplement 2
The NuRD complex regulates distinct processes according to the presence or absence of CHD4.
(A) GREAT gene ontology analysis of the CHD4/NuRD and NuRD-only locations. Displayed are pie charts depicting the categories of biological processes (left) and the top 15 biological processes …
Figure 4 with 3 supplements
CHD4 influences chromatin accessibility and allows P3F binding to SEs.
(A) Overlap between P3F and CHD4/NuRD ChIP-seq peaks. (B) Density plots depicting the average H3K27ac and BRD4 ChIP-seq as well as DNase I hypersensitivity (DNase) signal in RH4 cells at …
-
Figure 4—source data 1
PAX3-FOXO1 and CHD4/NuRD co-occupancy at enhancers and SEs.
- https://cdn.elifesciences.org/articles/54993/elife-54993-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
PAX3-FOXO1 regulates muscle-related processes with CHD4/NuRD.
GREAT gene ontology analysis of the P3F-only, P3F+CHD4/NuRD, and CHD4/NuRD-only regions defined in RH4 cells. Displayed are pie charts depicting the categories of biological processes (left) and the …
Figure 4—figure supplement 2
CHD4/NuRD is present at SEs and co-localizes with a subset of P3F locations in RH5 and SCMC cells.
(A) Overlap between P3F and CHD4/NuRD ChIP-seq peaks found in at least 2 out of the 3 FP-RMS cell lines analyzed (RH4, RH5, and SCMC). (B) Heatmap depicting the ChIP-seq signal of P3F and the …
Figure 4—figure supplement 3
CHD4 depletion impairs P3F binding to enhancers and SEs.
(A) Density plots depicting the average DNase I hypersensitivity signal in RH4 cells at P3F+CHD4/NuRD and CHD4/NuRD-only locations upon 48hrs of CHD4 knockdown (orange). (B) Density plot depicting …
Figure 5 with 1 supplement
CHD4 regulates P3F- and SE-mediated gene expression as well as RNA Pol 2 binding to promoters.
(A) Volcano plot depicting changes in gene expression upon 48hrs of CHD4 silencing in RH4 cells (fold change≥ 25%, false discovery rate of 1%). (B) Changes in expression, as log2 fold change, of the …
-
Figure 5—source data 1
CHD4 and PAX3-FOXO1 co-regulated target genes.
- https://cdn.elifesciences.org/articles/54993/elife-54993-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
RNA Pol 2 positioning is affected by CHD4 silencing.
(A) Volcano plot depicting changes in gene expression after 48hrs of P3F silencing in RH4 cells (fold change≥ 25%, false discovery rate of 1%). (B) Density plots depicting the average RNA Pol 2 …
Figure 6 with 1 supplement
CHD4 is essential for a broad range of tumors.
(A and B) Violin and boxplots depicting CHD4 expression levels (data: r2.aml.nl) in normal (grey) and tumor tissue (orange). (C) Databases used to evaluate tumor sensitivities to CHD4 silencing or …
Figure 6—figure supplement 1
CHD4 depletion affects the viability of a variety of tumor types.
(A and B) Boxplots demonstrate the sensitivity, displayed as dependency scores D2 or CERES, of the indicated tumor types to CHD4 knockdown (Combined RNAi) or knockout (CRISPR). (C and D) Violin …
Figure 7
Proposed model of CHD4-dependent and P3F-driven gene expression regulation.
In FP-RMS, CHD4/NuRD co-localizes with P3F and BRD4 at enhancers and super-enhancers enabling the expression of a subset of the fusion protein target genes and allowing tumor maintenance and …
Author response image 1
Benzonase digestion of RH4 nuclear extracts used for AP-MS.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo-sapiens) | RH4 (fusion-positive rhabdomyosarcoma) | Other | RRID:CVCL_5916 | See Materials and methods |
| Cell line (Homo-sapiens) | RH5 (fusion-positive rhabdomyosarcoma) | Other | RRID:CVCL_5917 | See Materials and methods |
| Cell line (Homo-sapiens) | SCMC (fusion-positive rhabdomyosarcoma) | Other | See Materials and methods | |
| Recombinant DNA reagent | lentiCRISPRv2 puro (plasmid) | Addgene | #98290; RRID:Addgene_98290 | Cas9 lentiviral expression construct |
| Recombinant DNA reagent | pU6-gRNA-EF1a-RFP657/BFP/EGFP (plasmid) | Other | See Materials and methods | |
| Recombinant DNA reagent | pRSIT-U6Tet-shRNA-PGKTetRep-2A-GFP-2A-puro (plasmid) | Cellecta Inc | Custom made | shRNA lentiviral expression construct, |
| Recombinant DNA reagent | PX459; pSpCas9(BB)−2A-Puro (plasmid) | Addgene | #62988; RRID:Addgene_ 62988 | Cas9 and sgRNA expression construct |
| Antibody | Recombinant Anti-Brd4 (rabbit monoclonal) | Abcam | #ab128874; RRID:AB_11145462 | WB (1:1000) |
| Antibody | BRD4 (rabbit polyclonal) | Bethyl Laboratories | #A301-985A100; RRID:AB_2620184 | ChIP (10 µg) |
| Antibody | Cas9 (mouse monoclonal) | Cell Signaling Technologies | CST:7A9-3A3; #14697; RRID:AB_2750916 | WB (1:1000) |
| Antibody | CHD4 (rabbit polyclonal) | Bethyl Laboratories | #A301-082A; RRID:AB_873002 | WB (1:1000) |
| Antibody | CHD4 (rabbit polyclonal) | Invitrogen | #PA5-27472; RRID:AB_2544948 | ChIP (10 µg) |
| Antibody | Anti-Flag (mouse monoclonal) | Sigma Aldrich | Sigma:M2; #F1804; RRID:AB_262044 | WB (1:1000), ChIP (10 µg), IF (1:250), IP (8 µg) |
| Antibody | FKHR/FOXO1 (rabbit polyclonal) | Santa Cruz Biotechnology | St.Cruz:H-128; #sc-11350; RRID:AB_640607 | WB (1:1000) |
| Antibody | GAPDH (rabbit monoclonal) | Cell Signaling Technologies | CST:14C10; #2118L;RRID:AB_561053 | WB (1:1000) |
| Antibody | HDAC1 (mouse monoclonal) | Cell Signaling Technologies | CST:10E2; #5356; RRID:AB_10612242 | WB (1:1000) |
| Antibody | HDAC2 (mouse monoclonal) | Cell Signaling Technologies | CST:3F3; #5113S; RRID:AB_10624871 | WB (1:1000) |
| Antibody | HDAC2 (rabbit polyclonal) | Abcam | #Ab7029; RRID:AB_305706 | ChIP (14.6 µg) |
| Antibody | Histone H3K9ac (rat monoclonal) | Active Motif | #61663; RRID:AB_2793725 | ChIP (10 µg) |
| Antibody | Histone H3K9me1 (rabbit polyclonal) | Active Motif | #39887; RRID:AB_2793381 | ChIP (10 µg) |
| Antibody | Histone H3K9me3 (rabbit polyclonal) | Active Motif | #39765; RRID:AB_2793334 | ChIP (10 µg) |
| Antibody | Histone H3K27ac (rabbit polyclonal) | Active Motif | #39133; RRID:AB_2561016 | ChIP (7 µg) |
| Antibody | Anti-MTA2 (mouse monoclonal) | Sigma Aldrich | #M7569; RRID:AB_477237 | WB (1:1000) |
| Antibody | MTA2/PID (rabbit polyclonal) | Abcam | #ab8106; RRID:AB_306276 | ChIP (5 µg) |
| Antibody | PAX3-FOXO1 breakpoint specific (mouse monoclonal) | doi:10.1158/0008–5472.CAN-10–0582 | ChIP (10 µg) | |
| Antibody | RBBP4 (rabbit polyclonal) | Bethyl Laboratories | #A301-206A; RRID:AB_890631 | WB (1:1000) |
| Antibody | RBBP4 (rabbit polyclonal) | EpiGentek | #A-2703–050 | ChIP (10 µg) |
| Antibody | RNA Pol II (rat monoclonal) | Active Motif | #61667; RRID:AB_2687513 | ChIP (15 µg) |
| Antibody | Alexa Fluor 594 anti-mouse (goat polyclonal) | Thermo Fisher Scientific | #A11032; RRID:AB_2534091 | IF (1:200) |
| Antibody | Spike-in Antibody (rabbit, clonality not specified) | Active Motif | #61686 | ChIP (2 µl) |
| Sequence-based reagent | Guide RNAs used in CRISPR/Cas9 screen | Microsynth | sgRNAs | See Supplementary file 1 |
| Sequence-based reagent | sg_NCHD4 | Microsynth | sgRNA | 5’GAGCGGAAGG GGATGGCGTC 3’ |
| Sequence-based reagent | sg_CCHD4 | Microsynth | sgRNA | 5’TCTGCATCTTCACTGCTGCT 3’ |
| Sequence-based reagent | sg_NBRD4 | Microsynth | sgRNA | 5’ATGTCTGCGGAGAGCGGCCCTGG 3’ |
| Sequence-based reagent | Donor DNA | IDT | cDNA | See Supplementary file 1 |
| Sequence-based reagent | Primers for ChIP-qPCR | Microsynth | See Materials and methods | |
| Peptide, recombinant protein | 3xFlag peptide | Sigma-Aldrich | #F4799 | IP elution (200 µg/ml) |
| Commercial assay or kit | Cell Proliferation ELISA, BrdU kit | Roche | #11647229001 | |
| Commercial assay or kit | Pierce BCA Protein Assay Kit | Thermo Fisher Scientific | #23227 | |
| Commercial assay or kit | RNeasy mini Kit | Qiagen | #74106 | |
| Commercial assay or kit | ChIP-IT High Sensitivity kit | Active Motif | #53040 | |
| Commercial assay or kit | iDeal ChIP-seq kit for Transcription Factors | Diagenode | #C01010055 | |
| Commercial assay or kit | TruSeq ChIP Library Preparation Kit | Illumina | #IP-202–1012 | |
| Commercial assay or kit | NextSeq500 High Output Kit v2 | Illumina | #FC-404–2005 | |
| Commercial assay or kit | TruSeq Stranded Total RNA Sample Preparation Kit | Illumina | #20020596 | |
| Chemical compound, drug | DNase I recombinant, RNase-free | Roche | #04716728001 | |
| Chemical compound, drug | 7-amino-actinomycinD | Invitrogen | #A1310 | |
| Chemical compound, drug | Cell Proliferation Reagent WST-1 | Roche | #5015944001 | |
| Chemical compound, drug | Crystal Violet | Sigma-Aldrich | #V5265 | |
| Chemical compound, drug | ChIP Cross-link Gold | Diagenode | #C01019027 | |
| Software, algorithm | ProteoWizard (version 3.0.7494) | http://proteowizard.sourceforge.net/projects.html | RRID:SCR_012056 | |
| Software, algorithm | Trans-Proteomic Pipeline | doi:10.1002/pmic.200900375 | ||
| Software, algorithm | CRAPome 2.0 | doi:10.1038/nmeth.2557 | ||
| Software, algorithm | SAINTexpress | doi:10.1016/j.jprot.2013.10.023 | RRID:SCR_018562 | |
| Software, algorithm | BioGRID 3.5 | doi:10.1093/nar/gky1079 | RRID:SCR_007393 | |
| Software, algorithm | BWA | doi:10.1186/gb-2009-10-3-r25 | RRID:SCR_005476 | |
| Software, algorithm | igvtools | doi:10.1038/nbt.1754 | ||
| Software, algorithm | MACS2 | doi:10.1186/gb-2008-9-9-r137 | RRID:SCR_013291 | |
| Software, algorithm | BEDTools | doi:10.1093/bioinformatics/btq033 | RRID:SCR_006646 | |
| Software, algorithm | HOMER | doi:10.1016/j.molcel.2010.05.004 | RRID:SCR_010881 | |
| Software, algorithm | NGSplot | doi:10.1186/1471-2164-15-284 | RRID:SCR_011795 | |
| Software, algorithm | FastQC v0.11.7 | http://www.bioinformatics.babraham.ac.uk/projects/fastqc | RRID:SCR_014583 | |
| Software, algorithm | Hisat2 v2.1.0 | doi:10.1038/nmeth.3317 | RRID:SCR_015530 | |
| Software, algorithm | Samtools v1.7 | doi:10.1093/bioinformatics/btp352 | RRID:SCR_002105 | |
| Software, algorithm | QualiMap | doi:10.1093/bioinformatics/bts503 | RRID:SCR_001209 | |
| Software, algorithm | featureCounts v1.6.0 | doi:10.1093/bioinformatics/btt656 | RRID:SCR_012919 | |
| Software, algorithm | DESeq2 v3.7 | doi:10.1186/s13059-014-0550-8 | RRID:SCR_015687 | |
| Software, algorithm | GSEA 3.0 | doi:10.1073/pnas.050658010 | RRID:SCR_003199 | |
| Other | Spike-in Chromatin | Active Motif | #53083 |
Additional files
-
Supplementary file 1
Sequence of guide RNAs used for the NuRD-centered CRISPR screen and donor DNA sequences used in the CRISPR/Cas9-mediated Flag knockins.
- https://cdn.elifesciences.org/articles/54993/elife-54993-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/54993/elife-54993-transrepform-v2.docx
