CSF1R blockade induces macrophage ablation and results in mouse choroidal vascular atrophy and RPE disorganization
- Section on Neuron-Glia Interactions in Retinal Disease, National Eye Institute, National Institutes of Health, United States
- Section on Histopathology, National Eye Institute, National Institutes of Health, United States
- Section on Ocular and Stem Cell Translational Research, National Eye Institute, National Institutes of Health, United States
Figures
Figure 1
Age-related progressive choroidal thinning and vascular atrophy are associated with alterations in choroidal macrophages.
(A) Young adult (3 month old) and aged (24 month-old) wild type BALB/cJ mice were imaged with enhanced depth imaging optical coherence tomography (EDI OCT) imaging; measurements made of choroidal …
Figure 2
CSF1R inhibition via PLX5622 administration induces a rapid and sustained depletion of resident macrophages in the adult mouse choroid.
(A) Three-month old wild type Balb/cJ mice were administered diet containing PLX5622 (at 1200 parts per million) continuously for up to 7 weeks. Controls consisted of age-matched animals maintained …
Figure 3 with 1 supplement
Long-term depletion of resident choroidal macrophages is accompanied by progressive choroidal thinning and vascular atrophy.
(A) Animals administered PLX5622-containing diet continuously over 7 weeks were followed with longitudinal in vivo enhanced depth imaging optical coherence tomography (EDI OCT) imaging; I-bars show …
Figure 3—figure supplement 1
Long-term depletion of resident choroidal macrophages does not result in marked depletion or disorganization of smooth muscle actin (SMA)-expressing perivascular smooth muscle cells or choriocapillaris pericytes.
Albino transgenic mice possessing a transgene containing an α-SMA promoter driving the expression of green fluorescent protein (GFP) were used to visualize perivascular cells of the choroidal …
Figure 4 with 1 supplement
Long-term depletion of choroidal macrophages is associated with alterations in RPE structure and function.
(A) Immunohistochemical analyses of the RPE monolayer in sclerochoroidal flatmounts in control and PLX5622-treated animals (for 7 weeks) were performed with RPE65 (green), conjugated phalloidin to …
Figure 4—figure supplement 1
mRNA expression levels of genes related to RPE function are altered following transient and sustained depletion of choroidal macrophages.
Changes in mRNA expression of RPE-specific genes in sclerochoroidal tissue following 1 and 7 weeks of continuous PLX5622 administration were evaluated with RT-PCR. Age-matched untreated animals …
Figure 5 with 2 supplements
Expression levels of angiogenic growth factors in the RPE-choroid complex are altered with long-term choroidal macrophage depletion.
Total mRNA and protein were isolated from RPE-choroid complexes of animals treated with PLX5622-containing diet for 1 or 7 weeks and untreated control animals. mRNA levels of Vegfa and Vegfc (A), …
Figure 5—figure supplement 1
mRNA expression levels of Tgfb1 were altered following sustained depletion of choroidal macrophages.
Changes in mRNA expression of Tgfb1 in sclerochoroidal tissue were evaluated with RT-PCR following 7 weeks of continuous PLX5622 administration. Age-matched untreated animals served as controls. …
Figure 5—figure supplement 2
Secondary antibody staining control.
Choroidal sections were labeled with primary antibodies to VEGF, PEDF, TGFβ1. Negative controls constituted sections labeled with the secondary antibody only, in the absence of primary antibodies. n …
Figure 6 with 1 supplement
Choroidal macrophages demonstrate spontaneous repopulation and recovery of constitutive numbers following depletion.
(A) Adult 3 month old mice were administered a diet containing PLX5622 for 3 weeks to achieve depletion of choroidal macrophages (depletion phase), and then returned to a standard diet for another 4 …
Figure 6—figure supplement 1
Repopulating choroidal macrophages demonstrate proliferation in situ and progressive morphological maturation.
(A, B) Ki67 immunopositivity was absent in MHCII+ repopulating macrophages in undepleted control animals but was prominent at 1 week of repopulation. The proportion of Ki67+ in MHCII+ cells declined …
Figure 7
Choroidal macrophage repopulation following depletion is accompanied by an arrest in depletion-associated choroidal vascular atrophy.
(A) Experimental plan for the assessment of vascular changes in the choroid during macrophage depletion and repopulation. Age-matched 3 month-old adult BALB/cJ animals were divided into two groups: …
Figure 8 with 2 supplements
Choroidal macrophage repopulation following depletion is accompanied by an arrest in depletion-associated alterations in RPE structure and gene expression.
(A) Immunohistochemical analyses of the RPE-sclerochoroidal flatmounts from (1) untreated control animals (white bars), (2) animals continuously treated for 3 weeks of PLX5622-containing diet (pink …
Figure 8—figure supplement 1
Macrophage depletion-associated changes in RPE genes expression are ameliorated with macrophage repopulation.
Changes in mRNA expression of RPE-specific genes in sclerochoroidal tissue from the following experimental groups were evaluated with RT-PCR: (1) untreated age-matched controls, (2) …
Figure 8—figure supplement 2
Changes in ERG amplitudes during macrophage depletion and subsequent macrophage repopulation.
The scotopic electroretinographic responses showed significantly decreased a- and b-wave amplitudes at 3 weeks of depletion in both continuous depletion and depletion-repopulation groups. Slight …
Figure 9 with 1 supplement
Choroidal macrophage repopulation following depletion is accompanied by a reversal in angiogenic factor expression.
mRNA and total protein were isolated from the RPE-choroid complex of (1) control animals maintained on a standard diet (white bars), (2) depleted animals treated continuously with a …
Figure 9—figure supplement 1
Schematic showing putative signaling between choroidal macrophages, vasculature, and the RPE layer in the outer retina under normal conditions and with choroidal macrophage depletion.
(Left) In the normal adult choroid, angiogenic signals (VEGF, PEDF) secreted from the RPE cell layer regulate local choroidal vascular structure. Choroidal macrophages produce potential trophic …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | anti-Iba1 Rabit polyclonal | Wako | Cat# 019–19741 RRID:AB_839504 | Dilution 1:200 |
| Antibody | anti-MHC-II Rat monoclonal | BD Pharmingen | Cat# 556999 RRID:AB_396545 | Dilution 1:200 |
| Antibody | anti-RPE65 Mouse monoclonal | Millipore | Cat# MAB5428 RRID:AB_571111 | Dilution 1:200 |
| Antibody | anti-VEGFa Rabit polyclonal | Abcam | Cat# ab46154 RRID:AB_2212642 | Dilution 1:200 |
| Antibody | anti-PEDF Rabit polyclonal | Abcam | Cat# ab180711 RRID:AB_2827998 | Dilution 1:200 |
| Commercial assay or kit | Mouse SERPINF1/PEDF ELISA kit | LifeSpan BioSciences | LS-F36110 | |
| Commercial assay or kit | Magnetic Luminex Assay kit for VEGF, PDGF-AA and PDGF-BB | R and D Systems | LXSAMSM-11 | |
| Sequence-based reagent | Vegfa_F | IDT | PCR primers | TGTGCGCAGACAGTGCTCCA |
| Sequence-based reagent | Vegfa_R | IDT | PCR primers | CCTGGGACCACTTGGCATGG |
| Sequence-based reagent | Vegfc_F | IDT | PCR primers | GGGAAATGTGCCTGTGAATG |
| Sequence-based reagent | Vegfc_R | IDT | PCR primers | GTTCAGATGTGGCCTTTTCC |
| Sequence-based reagent | Serpinf1_F | IDT | PCR primers | CACCCAAGTGGAACACAGG |
| Sequence-based reagent | Serpinf_R | IDT | PCR primers | TTAAGTACTACTGGGGTCCA |
| Sequence-based reagent | Rpe65_F | IDT | PCR primers | GCCAATTTACGTGAGAATTGGG |
| Sequence-based reagent | Rpe65_R | IDT | PCR primers | CAGTCCATGGAAGGTCACAG |
| Sequence-based reagent | Lrat_F | IDT | PCR primers | CCGTCCCTATGAAATCAGCTC |
| Sequence-based reagent | Lrat_R | IDT | PCR primers | ATGGGCGACACGGTTTTCC |
| Sequence-based reagent | Rlbp1_F | IDT | PCR primers | GGCACTTTCCGCATGGTT C |
| Sequence-based reagent | Rlbp1_R | IDT | PCR primers | CCGGGTCTCCTCCTTTTCAT |
| Sequence-based reagent | Mitf_F | IDT | PCR primers | CAGCCATAAACGTCAGTGTGC |
| Sequence-based reagent | Mitf_R | IDT | PCR primers | GAGTGAGCATAGCCATAGGGC |
| Sequence-based reagent | Tjp1_F | IDT | PCR primers | GAGAAAGGTGAAACTCTGCTG |
| Sequence-based reagent | Tjp1_R | IDT | PCR primers | GTGGTCAATCAGGACAGAAAC |
| Sequence-based reagent | Pdgfa_F | IDT | PCR primers | GCCAGCCTTCACGGGTCC |
| Sequence-based reagent | Pdgfa_R | IDT | PCR primers | CCTCACATCTGTCTCCTCCT |
| Sequence-based reagent | Pdgfb_F | IDT | PCR primers | CTGCAAGTGTGAGACAGTAG |
| Sequence-based reagent | Pdgfb_R | IDT | PCR primers | CTAGGCTCCGAGGGTCTC |
| Sequence-based reagent | Gapdh_F | IDT | PCR primers | GCCGCCTGGAGAAACCTGCCAA |
| Sequence-based reagent | Gapdh_R | IDT | PCR primers | GGGGTGGGTGGTCCAGGGTTT |
