1. Structural Biology and Molecular Biophysics

Multi-state recognition pathway of the intrinsically disordered protein kinase inhibitor by protein kinase A

  1. Cristina Olivieri
  2. Yingjie Wang
  3. Geoffrey C Li
  4. Manu V S
  5. Jonggul Kim
  6. Benjamin R Stultz
  7. Matthew Neibergall
  8. Fernando Porcelli
  9. Joseph M Muretta
  10. David DT Thomas
  11. Jiali Gao
  12. Donald K Blumenthal
  13. Susan S Taylor
  14. Gianluigi Veglia  Is a corresponding author
  1. Department of Biochemistry, Molecular Biology, and Biophysics, University of Minnesota, United States
  2. Department of Chemistry and Supercomputing Institute, University of Minnesota, United States
  3. Shenzhen Bay Laboratory, China
  4. Department of Chemistry, Bethel University, United States
  5. DIBAF, University of Tuscia, Largo dell' Università, Italy
  6. Laboratory of Computational Chemistry and Drug Design, Peking University Shenzhen Graduate School, China
  7. Department of Pharmacology and Toxicology, University of Utah, United States
  8. Department of Chemistry and Biochemistry and Pharmacology, University of California, San Diego, United States
https://doi.org/10.7554/eLife.55607
Share this article
Cite this article
  1. Cristina Olivieri
  2. Yingjie Wang
  3. Geoffrey C Li
  4. Manu V S
  5. Jonggul Kim
  6. Benjamin R Stultz
  7. Matthew Neibergall
  8. Fernando Porcelli
  9. Joseph M Muretta
  10. David DT Thomas
  11. Jiali Gao
  12. Donald K Blumenthal
  13. Susan S Taylor
  14. Gianluigi Veglia
(2020)
Multi-state recognition pathway of the intrinsically disordered protein kinase inhibitor by protein kinase A
eLife 9:e55607.
https://doi.org/10.7554/eLife.55607
  2. Download BibTeX
  3. Download .RIS
10 figures, 2 tables and 1 additional file

Figures

Figure 1
Download asset Open asset
PKIα primary sequence, homology, and complex with PKA-C.

(A) Primary sequence of PKIα, featuring the high affinity region (HAR), the pseudo-substrate region (PSS), and the nuclear export signal (NES). (B) X-ray structure of the PKA-C/ATP/PKI5-24 ternary …

Figure 2 with 1 supplement
Download asset Open asset
PKIα is an intrinsically disordered protein with transient tertiary contacts.

(A) Far-UV circular dichroism (CD) spectrum of PKIα acquired at 25°C in native condition showing the typical CD profile for IDPs, with a minimum around 208 nm (Wicky et al., 2017; Chemes et al., 2012…

Figure 2—figure supplement 1
Download asset Open asset
PKIα is an intrinsically disordered protein.

(A) [1H,15N]-Heteronuclear single quantum correlation (HSQC) spectrum of PKIα free form with resonance assignment. The protein fingerprint features a poor resonance dispersion clustered around eight …

Figure 3 with 2 supplements
Download asset Open asset
PKIα adopts partial secondary structure upon interaction with PKA-C.

(A) Chemical shift perturbation (CSP) of the amide fingerprint of PKIα upon binding PKA-C/ATPγN binary complex calculated using equation 1 (Williamson, 2013). The residues of PKIα that undergo …

Figure 3—figure supplement 1
Download asset Open asset
Mapping PKA-C/PKIα interactions using [1H,15N] CCLS-HSQC experiments.

(A) reference spectrum of the PKA-C/ATPγN/PKIα complex with overlaid fingerprints of U-15N PKA-C and U-13C/15N PKIα. (B) Suppression spectrum showing only the PKA-C fingerprint. The suppression …

Figure 3—figure supplement 2
Download asset Open asset
NMR dynamic parameters for free and bound PKIα.

(A) Secondary structure content for PKIα in complex with PKA-C/ATPγN calculated from the NMR chemical shifts using the δ2D program (Camilloni et al., 2012). (B) [1H-15N] ΔHX-NOE values for PKIα in …

Figure 4
Download asset Open asset
Changes in the NMR dynamic parameters of PKIα upon formation of the ternary complex with PKA-C and ATPγN.

(A) Histogram of the changes in heteronuclear NOE (ΔHX-NOE) values of PKIα free and bound and map of the ΔHX-NOE values onto a selected conformer from the ensemble of the PKA-C/ATP/PKIα structures …

Figure 5
Download asset Open asset
The C-terminal tail of PKIα interacts transiently with PKA-C.

(A) Intermolecular 1HN PRE measurements between U-2H/13C/15N PKIαS59C and U-2H/15N PKA-C/ATPγN. (B) Intermolecular PRE effects detected on PKA-C. (C) Intra- and inter-molecular PRE effects mapped …

Figure 6 with 1 supplement
Download asset Open asset
Multi-pathway mechanism of PKIα binding to PKA-C revealed by stopped-flow FRET experiments.

(A) Total fluorescence of Alexa-488 labeled PKA-CC199A,S325C (100 nM) monitored at 520 ± 10 nm, mixed with varied concentrations of TMR labeled PKIαV3C, ranging from 0 to 400 times the concentration …

Figure 6—figure supplement 1
Download asset Open asset
Time-resolved FRET data.

(A) Total fluorescence of Alexa-488 labeled PKA-CC199A, S325C (100 nM) monitored at 520 ± 10 nm, mixed with varied concentrations of TMR labeled PKIαV3C, PKIαS28C or PKIαS59C, from 0 to 800 times …

Figure 7
Download asset Open asset
Conformational ensembles free and bound of PKIα by SAXS and metadynamics.

(A-B) Distribution of helical populations for the HAR and NES regions in the free (A) and bound (B) PKIα ensembles. (C) SAXS data obtained with PKIα free and the PKA-C/PKIα complex in the presence …

Figure 8 with 1 supplement
Download asset Open asset
Multi-state binding kinetics of PKI α to PKA-C from Markov model.

(A) Schematic illustration of the transition kinetics between different conformational ensembles of PKIα in the free form. (B) Corresponding scheme for the bound ensembles. The population of each …

Figure 8—figure supplement 1
Download asset Open asset
Scatter plot from MD simulations showing the conformational ensembles of PKIα in the free and bound forms projected along the first two tICs.

(A) Helical content of the HAR motif. (B) Helical content of the NES motif. (C) The radius of gyration (Rg). The conformational space can be divided into four major ensembles based on the secondary …

Scheme 1
Download asset Open asset
The proposed Kinetic Model of PKA-C/PKIα binding.

Highlighted pathway is used in the numerical fitting of Stopped Flow rapid mixing FRET data using MATLAB.

Scheme 2
Download asset Open asset
FRET Profiles of (A) double labeled PKI, (B) PKIACCEPTOR-3, (C) PKIACCEPTOR-59 and (D) PKIACCEPTOR-28 fitted with kinetic model in Scheme 1.

Tables

Table 1
Rate constants obtained from the fluorescence decay of PKIACCEPTOR-3, PKIACCEPTOR-28, and PKIACCEPTOR-59upon mixing with Alexa-labeled PKA-CC199A,S325C or the fluorescence buildup of PKIDONOR-ACCEPTOR upon mixing with unlabeled PKA-CC199A,S325C at 25°C.
PKIACCEPTOR3PKIACCEPTOR28PKIACCEPTOR59PKIDONOR-ACCEPTOR
Fast phase
 kon (M−1 s−1)1.88 ± 0.03×1071.40 ± 0.02×1071.62 ± 0.11×1070.85 ± 0.04×107
 koff (s−1)13 ± 35 ± 12 ± 106 ± 7
 Kdapp (nM)700 ± 170390 ± 110150 ± 620700 ± 800
 Slow phase
 kslow (s−1)24 ± 2NDND37 ± 2
 K0.5 (µM)2.4 ± 0.43.0 ± 0.43.8 ± 0.517 ± 3

  1. ND: Non determined.

Key resources table
Reagent type (species)
or resource		DesignationSource or referenceIdentifiersAdditional information
Gene (Oryctolagus cuniculus )PKIA or PKIαUniprot ID
P61926
Gene (Mus musculus)PKA-CA or PKA-CUniprot ID:
Q9DBC7
Strain, strain background (Escherichia coli)BL21(DE3)New England Biotech (NEB)C2527IChemically competent cells
Recombinant DNA reagentpT7-7 PKIαDr. Herberg (Universität Kassel, Germany)DOI: 10.1042/BJ20071665
Recombinant DNA reagentPKIαV3CThis studySingle Cys mutant of PKIα
Recombinant DNA reagentPKIαS28CThis studySingle Cys mutant of PKIα
Recombinant DNA reagentPKIαS59CThis studySingle Cys mutant of PKIα
Recombinant DNA reagentPKIαV3C, S59CThis studyDouble Cys mutant of PKIα
Recombinant DNA reagentPKA-CαProf. Taylor S.S.
(USCD, CA, USA)		(Hemmer et al., 1997)
DOI: 10.1006/abio.1996.9952
Recombinant DNA reagent(His6X)-PKA-RIIαR213KProf. Taylor S.S.
(USCD, CA, USA)		(Hemmer et al., 1997)
DOI: 10.1006/abio.1996.9952
Sequence-based reagentPKIαV3CThis studyPCR primer(Forward): aaggagatatacatatgggaactgattgcgaaactacttatgccgatttta
Sequence-based reagentPKIαS28CThis studyPCR primer (Forward): ccatccacgatatcctggtctgcagtgcttccgg
Sequence-based reagentPKIαS59CThis studyPCR primer (Forward): aggaagatgctcaaagatcttgcactgaacaatccggagaag
Sequence-based reagentPKIαV3C, S59CThis studyPCR primer (Forward):
1)aaggagatatacatatgggaactgattgcgaaactacttatgccgatttta
2)aggaagatgctcaaagatcttgcactgaacaatccggagaag
Chemical compound, drugMTSLToronto Research ChemicalO875000Spin label
Chemical compound, drugdMTSLToronto Research ChemicalA188600Spin label
Chemical compound, drugAlexa Fluor 488 C5 MeleimideThermo Fisher ScientificA10254FRET acceptor
Chemical compound, drugTetramethylrhodamine-5-maleimide (TMR)Life TechnologiesT6027FRET donor
Chemical compound, drugAMP-PNP or ATPγNRoche Applied Science10102547001ATP analogous
Commercial assay or kitQuikChange Lightning Multi Mutagenesis KitAgilent genomics210519Commercial mutagenesis kit
Commercial assay or kitPepTag Assay, Non-Radioactive Detection of PKAPromegaV5340Commercial assay kit
Software, algorithmTopSpin 3.0Bruker Inchttps://www.bruker.com/
Software, algorithmNMRFAM-SparkyNMRFamhttps://nmrfam.wisc.edu/nmrfam-sparky-distribution/
Software, algorithmNMRPipeDelaglio F, NIH (Delaglio et al., 1995)https://www.ibbr.umd.edu/nmrpipe/install.html
Software, algorithmPyMolSchrödinger, LLChttps://pymol.org
Software, algorithmMatLab2019bMathWorkshttps://www.mathworks.com/products/matlab.html
Software, algorithmGraphPad Prism 8GraphPad Software Inchttps://www.graphpad.com/
Software, algorithmOrigin 8OriginLabhttps://www.originlab.com/
Software, algorithmSAXSQuant software suitAnton PaarN/A
Software, algorithmPrimusATSAS 2.8.3 softwarehttps://www.embl-hamburg.de/biosaxs/download.html
Software, algorithmMultiFoXS server(Schneidman-Duhovny et al., 2013).https://modbase.compbio.ucsf.edu/multifoxs/
DOI: 10.1016/j.bpj.2013.07.020
Software, algorithmGROMACS 4.6(Hess et al., 2008)http://www.gromacs.org/
Software, algorithmPLUMED 2.1(Bonomi et al., 2009)https://www.plumed.org/doc-v2.5/user-doc/html/_c_h_a_n_g_e_s-2-1.html
Software, algorithmALMOST 2.1(Fu et al., 2014)https://sourceforge.net/projects/almost/
Software, algorithmMSMBuilder 3.5(Harrigan et al., 2017)http://msmbuilder.org/3.5.0/index.html
Software, algorithmδ2D(Camilloni et al., 2012)http://www-mvsoftware.ch.cam.ac.uk/index.php/d2D

Additional files

Transparent reporting form
https://cdn.elifesciences.org/articles/55607/elife-55607-transrepform-v3.pdf

Download links