Evolutionary expansion of apical extracellular matrix is required for the elongation of cells in a novel structure
- Department of Biological Sciences, University of Pittsburgh, United States
- Department of Bioengineering, University of Pittsburgh, United States
Figures
Figure 1 with 2 supplements
The posterior lobe protrudes from the lateral plate.
(A) Phylogenetic tree with bright-field images of adult lateral plate cuticles from which the posterior lobe projects (arrow). (B–E) Illustration, (B’–E’) maximum projection, and (B’’–E’’) …
Figure 1—figure supplement 1
Developmental timing of lobed vs non-lobed genitalia.
Developmental time course of the lobed species D. melanogaster (A–D) and the non-lobed species D. biarmipes (E–H) with E-cadherin (Ecad) label. Location of respective cross sections indicated in …
Figure 1—video 1
The posterior lobe protrudes from the lateral plate.
Three-dimensional projections of D. biarmipes (left) and D. melanogaster (right) samples at 52 hr APF labeled with E-cadherin.
Figure 2 with 3 supplements
Posterior lobe cells increase in height to project out from the lateral plate.
(A) A single cell in the posterior lobe labeled with Raeppli-mTFP1 (green) spans the height of the tissue labeled with lateral membrane marker Fasciclin III (Fas3; magenta). Apical side of posterior …
-
Figure 2—source data 1
Individual measurements of tissue thickness over time.
- https://cdn.elifesciences.org/articles/55965/elife-55965-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Cell division dynamics do not differ between lobed and non-lobed species.
Developmental time course with Phospho-Histone H3 (Ser 10) (PH3; green) labeling actively dividing cells and E-cadherin (Ecad; magenta) labeling the apical membrane of the tissue. Only superficial …
Figure 2—figure supplement 2
Extended time course of tissue thickness in lobed and non-lobed species.
Extended time course for samples quantified in Figure 2F–G. (A–C) Max and cross-section view of 44 hr APF (A and C) and 48 hr APF (B) genital samples with lateral membrane labeled with Fasciclin III …
Figure 2—video 1
Cell rearrangement during posterior lobe development.
Live imaging of posterior lobe development with GFP tagged armadillo (apical membrane marker) illustrating a cell dropping from the apical surface and a neighboring cell filling in the gap. Imaging …
Figure 3 with 1 supplement
Cytoskeletal components are increased in posterior lobe cells.
(A–D) Maximum projection, and respective cross-sections of late (48 hr APF) genital samples of the lobed species D. melanogaster labeled with F-actin/phalloidin (actin; green) and E-cadherin (Ecad; …
Figure 3—figure supplement 1
Uniform level of cytoskeletal components in non-lobed species.
(A–D) Max projections of late (48 hr APF) genital samples of non-lobed species D. biarmipes labeled with F-actin/phalloidin (green) and E-cadherin (Ecad; magenta) (A), acetylated tubulin (green) (B,C…
Figure 4 with 6 supplements
Dumpy deposition is correlated with posterior lobe development.
(A–D) Maximum projection and (A’–B’’) respective zoom, indicated with pink box, labeled with Dumpy:YFP (green) and E-cadherin (Ecad; magenta) for each time point. Location of respective cross …
Figure 4—figure supplement 1
Limited basal ECM present during posterior lobe morphogenesis.
Basal ECM markers Collagen IV (Viking:GFP; green)(A and C) and Perlecan (Perlecan:GFP; green) (B and D) in L3 larval genital disc (A and B) and 44 hr APF genitalia (C and D). Apical membrane labeled …
Figure 4—figure supplement 2
Dumpy extends above the apical surface of the phallus.
(A) Projection of Dumpy:YFP (green) and E-cadherin:mCherry (Ecad:mCherry; magenta) imaged live at 48 hr APF. Location of respective cross sections indicated in orange. (A1) Cross section showing …
Figure 4—figure supplement 3
A bundle of Dumpy connects the genitalia to the pupal cuticle membrane that encases the developing pupa.
(A–B) Live imaging of Dumpy:YFP (green) and Ecadherin:mCherry (Ecad:mCherry; magenta) at respective time points. Location of respective cross sections indicated in orange. (A1–B1) Cross-sections are …
Figure 4—figure supplement 4
Weak aECM connections extend to the lateral plate.
(A–D) Brightened images of respective cross sections from Figure 2 of lateral plate (A1–D1) in yellow and posterior lobe in blue (A2–D2). Cross-sections are oriented with apical side at the top and …
Figure 4—video 1
Three-dimensional structure of Dumpy on developing genitalia.
Part 1 of the movie shows 3D rotation of 52 hr APF genital sample with Dumpy:YFP (green) and E-cadherin (magenta) labels. Part 2 of the movie shows a cross-sectional view starting at the ventral …
Figure 4—video 2
A bundle of Dumpy connects the genitalia to the surrounding cuticle.
3D rotation of Dumpy:YFP (green) and Ecadherin:mCherry (magenta) imaged live at 44 hr APF. Relevant structures labeled: Posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), phallus (P), …
Figure 5 with 3 supplements
aECM is spatially expanded in lobed species compared to non-lobed species.
(A–B) in situ hybridization for dumpy mRNA in the lobed species D. melanogaster (A) and the non-lobed species D. biarmipes (B). Pink box outlines location of zoomed in images presented in A1 and B1. …
Figure 5—figure supplement 1
aECM spatially expanded in lobed species compared to non-lobed species.
(A–B) Additional in situ hybridization samples for dumpy mRNA in lobed species D. melanogaster (A) and non-lobed species D. biarmipes (B) to show full range of expression observed in experiment. …
Figure 5—figure supplement 2
VVA staining mimics Dumpy:YFP localization.
(A) Dumpy:YFP (green) or (B) VVA (green) localization with apical membrane labeled with E-cadherin (Ecad; magenta) at 44 hr APF in D. melanogaster. Gross similarities in the structure of Dumpy:YFP …
Figure 5—figure supplement 3
aECM is expanded in the lobed D. sechellia but not in the non-lobed species D. ananassae.
(A–B) aECM labeled with VVA (green) and apical membrane labeled with E-cadherin (Ecad; magenta) at 40 hr APF in the lobed species D. sechellia (A) and the non-lobed species D. ananassae (B). …
Figure 6 with 1 supplement
Dumpy is required for proper posterior lobe formation.
(A) Range of adult posterior lobe phenotypes produced by control (mCherry RNAi) and dumpy RNAi animals. Phenotypic classes defined from wild type (I) to most severe (V). Scale bar, 20 μm. (B) …
-
Figure 6—source data 1
Individual measurements of dumpy-RNAi adult cuticle phenotypes.
- https://cdn.elifesciences.org/articles/55965/elife-55965-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Increased left-right variability of posterior lobe phenotype upon dumpy knockdown.
(A) Comparison of dumpy knockdown (purple circles) and control knockdown (green squares) of left and right adult posterior lobes in single individuals grown at 29°C measuring height at the ventral …
Figure 7 with 3 supplements
Correlation between the deposition of Dumpy and knockdown phenotype.
(A–B) Comparison of mCherry RNAi (control) and dumpy RNAi at 44 hr APF (A) and 52 hr APF (B). Images are rotated in 3D to visualize the full shape of the posterior lobe labeled with E-cadherin …
-
Figure 7—source data 1
Individual measurements of dumpy-RNAi effects on the posterior lobe during its development.
- https://cdn.elifesciences.org/articles/55965/elife-55965-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Variability in height of adult posterior lobe in dumpy knockdown.
Comparison of mCherry RNAi (control) and dumpy RNAi adults. Quantification of height of cuticle at the ventral side of the posterior lobe. (unpaired t-test; ***p≤0.001; ****p≤0.0001; n ≥ 28).
Figure 7—figure supplement 2
Remaining strands of Dumpy in dumpy knockdown.
(A and B) dumpy RNAi at 44 hr APF with Dumpy:YFP (green) and apical membrane labeled with E-cadherin (Ecad; magenta) showing strands of Dumpy connecting to the crevice between the lateral plate and …
Figure 7—figure supplement 3
Correlation between VVA signal and dumpy knockdown phenotype.
Comparison of mCherry RNAi (control) (A) and dumpy RNAi (B and C) at 44 hr APF with VVA (Green) and E-cadherin (Ecad; Magenta). All cross-sections are oriented with apical side at the top and basal …
Figure 8 with 1 supplement
Expansion of aECM associated with the evolution of a morphological novelty.
(Top) Illustration of non-lobed species, D. biarmipes, with ancestral aECM network covering central genital structures (2B) including the clasper (C), sheath, and phallus. Weak connections of aECM …
Figure 8—figure supplement 1
Dumpy anchors posterior spiracles to surrounding cuticle.
Live imaging of Dumpy:YFP (green) and Armadillo:GFP (ARM:GFP; magenta) in the embryonic posterior spiracles. Posterior spiracle (dotted line) is connected to the cuticle (arrowhead) via a tether of …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Monoclonal rat anti-alpha tubulin (tyrosinated) | MilliporeSigma | Millipore Cat# MAB1864, RRID:AB_2210391 | IHC (1:500) |
| Antibody | Monoclonal mouse anti-alpha tubulin (acetylated) | Sigma-Aldrich | Sigma-Aldrich Cat# T6793, RRID:AB_477585 | IHC (1:500) |
| Antibody | Monoclonal rat anti-Ecadherin | DSHB | DSHB Cat# DCAD2, RRID:AB_528120 | IHC (1:500) |
| Antibody | Monoclonal mouse anti-Fasciclin III | DSHB | DSHB Cat# 7G10 anti-Fasciclin III, RRID:AB_528238 | IHC (1:500) |
| Antibody | Polyclonal rabbit anti-histone H3 (phospho S10) | Abcam | Abcam Cat# ab5176, RRID:AB_304763 | IHC (1:50) |
| Antibody | Polyclonal goat anti-GFP | Abcam | Abcam Cat# ab6662, RRID:AB_305635 | IHC (1:300) |
| Lectin | fluoresceinVicia Villosa Lectin (VVA) | Vector Laboratories | Vector Laboratories Cat# FL-1231, RRID:AB_2336856 | IHC (1:200) |
| Chemical compound, drug | rhodamine phalloidin | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# R415, RRID:AB_2572408 | IHC (1:200) |
| Strain, strain background (Drosophila melanogaster) | y1w1Drosophila melanogaster | BloomingtonDrosophilaStock Center | BDSC Cat# 1495, RRID:BDSC_1495 | |
| Strain, strain background (Drosophila biarmipes) | wild type | NationalDrosophilaSpecies Stock Center (NDSSC) | NDSSC Stock #:14023–0361.10 RRID:FlyBase_FBst0203870 | |
| Strain, strain background (Drosophila ananassae) | wild type | NationalDrosophilaSpecies Stock Center (NDSSC) | NDSSC Stock #:14024–0371.13 RRID:FlyBase_FBst0201380 | No longer available |
| Strain, strain background (Drosophila pseudoobscura) | wild type | NationalDrosophilaSpecies Stock Center (NDSSC) | NDSSC Stock #:14011–0121.87 RRID:FlyBase_FBst0200074 | No longer available |
| Strain, strain background (Drosophila sechellia) | Wild type | NationalDrosophilaSpecies Stock Center (NDSSC) | NDSSC Stock #: #14021–0248.03 RRID:FlyBase_FBst0201190 | No longer available |
| Genetic reagent (Drosophila melanogaster) | UAS-Raeppli-CAAX | Bloomington Drosophila Stock Center (BDSC) | BDSC Cat# 55084, RRID:BDSC_55084 | |
| Genetic reagent (Drosophila melanogaster) | Pox neuro-Gal4 | (Boll and Noll, 2002) | Construct #13 | |
| Genetic reagent (Drosophila melanogaster) | D. simulans Pox neuro-Gal4 | This paper | Can be obtained from Mark Rebeiz,rebeiz@pitt.edu | |
| Genetic reagent (Drosophila melanogaster) | hs – flippase122 | Gift from Erika A. Bach | Flybase: FBtp0001101 | |
| Genetic reagent (Drosophila melanogaster) | armadillo-GFP | (Huang et al., 2012) | ||
| Genetic reagent (Drosophila melanogaster) | Dumpy:YFP | Drosophila Genomics and Genetic Resources | DGGR Cat# 115238, RRID:DGGR_115238 | |
| Genetic reagent (Drosophila melanogaster) | Viking:GFP | Drosophila Genomics and Genetic Resources | DGGR Cat# 110626, RRID:DGGR_110626 | |
| Genetic reagent (Drosophila melanogaster) | Perlecan:GFP | Drosophila Genomics and Genetic Resources | DGGR Cat# 110807, RRID:DGGR_ 110807 | |
| Genetic reagent (Drosophila melanogaster) | E-cadherin:mCherry | Bloomington Drosophila stock center | BDSC Cat# 59014, RRID:BDSC_59014 | |
| Genetic reagent (Drosophila melanogaster) | UAS-dumpyRNAi | ViennaDrosophilaResource Center | VDRC Cat#44029, RRID:FlyBase_FBst0465370 | |
| Genetic reagent (Drosophila melanogaster) | UAS-mCherryRNAi | Bloomington Drosophila stock center | BDSC Cat# 35785, RRID:BDSC_35785 | |
| Recombinant DNA reagent | pS3aG4 | Gift from Benjamin Prud'homme | Gal4 vector used to make D. simulans Pox neuro gal4 line | |
| Sequence-based reagent | GCCACTAACAATCCATGCGGTT | This paper | dumpy probe forward primer. Obtained from Integrated DNA Technologies. | |
| Sequence-based reagent | TAATACGACTCACTATAGGGAGAAATAGCCCTGTCCTTGGAATCC | This paper | dumpy probe reverse primer with T7 primer. Obtained from Integrated DNA Technologies. | |
| Sequence-based reagent | TTCCGGGCGCGCCTCGGTGGCTTAACACGCGCATT | This paper | D. simulans Pox neuro forward primer for gal four line. Obtained from Integrated DNA Technologies. | |
| Sequence-based reagent | TTGCCCCTGCAGGATCGCTGATTCCATGGCCCAGT | This paper | D. simulans Pox neuro reverse primer for gal four line. Obtained from Integrated DNA Technologies. | |
| Software algorithm | Fiji (ImageJ v2.0) | (Schindelin et al., 2012) | RRID:SCR_002285 | |
| Software algorithm | GenePalette | (Rebeiz and Posakony, 2004; Smith et al., 2017) | ||
| Software algorithm | Leica Application Suite X | Leica | RRID:SCR_013673 | |
| Software algorithm | Microsoft Excel | Microsoft | RRID:SCR_016137 | |
| Software algorithm | MorphoGraphX | (Barbier de Reuille et al., 2015) | ||
| Software algorithm | Prism 8 | GraphPad | RRID:SCR_002798 |
