(A) A diagram of the type II neuroblast lineage showing the expression patterns of genes and Gal4 drivers used throughout this study. (B) Gene transcription profiles of brat-null brains transiently …
(A) Quantification of total type II neuroblasts (top) or INPs (bottom) per brat-null brain lobe that transiently overexpressed Insb driven by a type II neuroblast Gal4. Insb overexpression led to …
Quantification of total type II neuroblasts or INPs per brat-null brain lobe that transiently overexpressed Insb.
(A) A diagram showing the expression patterns of genes in the type I and II neuroblast lineages. (B) Quantification of total type II neuroblasts per brain lobe that overexpressed a UAS-tllRNAi …
Quantification of total type II neuroblasts per brain lobe that overexpressed a UAS-tllRNAi transgene.
Quantification of total type II neuroblasts per brain that overexpressed a UAS-tll transgene.
Quantification of total ventral type I neuroblasts per brain lobe that overexpressed a UAS-tll transgene.
(A) Quantification of total type II neuroblasts per ermhypo brain lobe that overexpressed a UAS-RNAi transgene driven by a type II neuroblast Gal4. Knocking-down ham function consistently enhanced …
Quantification of total type II neuroblasts per ermhypo brain lobe that overexpressed a UAS-RNAi transgene.
Quantification of total type II neuroblasts per ham-mutant brain lobe.
Quantification of total type II neuroblasts per brain lobe of the indicated genotypes.
Quantification of total type II neuroblasts per erm,ham double heterozygous brain lobe that overexpressed a UAS-ham transgene.
(A) Quantification of total type II neuroblasts per brain lobe of the indicated genotypes. erm,ham double heterozygous brains displayed the supernumerary type II neuroblast phenotype. (B) …
Quantification of total type II neuroblasts per brain lobe that overexpressed a UAS-hamRNAi transgene.
(A–B) Images of wild-type or hamSK1 homozygous type II neuroblast mosaic clones. Supernumerary neuroblasts (−15 μm) in hamSK1 homozygous clones were always located far from the parental neuroblast …
Quantification of total neuroblasts per ham1 or hamSK1 homozygous type II neuroblast clone.
Quantification of total type II neuroblasts per brain lobe that overexpressed a UAS-ham transgene.
Quantification of total type II neuroblasts per hamSK1 homozygous brain lobe that overexpressed various UAS-ham transgenes.
Quantification of total type II neuroblasts per brain lobe that overexpressed a UAS-VP16::hamN-ZF transgene.
(A) A diagram depicting our hypothesis that ectopic activation of tll in INPs leads to supernumerary type II neuroblasts in erm,ham double heterozygous brains. (B) Quantification of total type II …
Quantification of total type II neuroblasts per brain lobe that was erm,ham double heterozygous or erm,ham,tll triple heterozygous.
Quantification of total type II neuroblasts erm,ham double heterozygous brain lobe that carried one copy of the tll::GFP(BAC) transgene.
Quantification of Tll::GFP expression relative to Dpn expression in type II neuroblasts that mis-expressed a UAS-erm or UAS-ham transgene.
Quantification of total type II neuroblasts per wild-type or hamSK1 homozygous brain lobe that overexpressed a UAS-NRNAi transgene.
Quantification of total type II neuroblasts per erm or ham heterozygous brain lobe that overexpressed a UAS-Nintra transgene.
(A) Quantification of total type II neuroblasts per brain lobe that overexpressed a UAS-ham transgene driven by an INP Gal4. Overexpressing full-length Ham or HamΔC-ZF in INPs suppressed the …
Quantification of total type II neuroblasts per brain lobe that overexpressed a UAS-ham transgene.
Quantification of total type II neuroblasts per ham heterozygous brain lobe that overexpressed various UAS transgenes.
Quantification of total type II neuroblasts per erm heterozygous brain lobe that overexpressed a UAS-hdac3RNAi transgene.
Quantification of Tll::GFP expression relative to Dpn expression in INPs derived from type II neuroblasts that overexpressed a UAS-hdac3RNAi transgene.
(A–B) Images of erm-null brains that overexpressed a UAS-ham transgene driven by an INP Gal4. Ham overexpression in INPs suppressed the supernumerary type II neuroblast phenotype in erm-null brains. …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Antibody | anti-GFP (Chicken polyclonal) | Aves Labs, INC. | Cat#GFP-1020, RRID:AB_2307313 | IF(1:2000) |
Antibody | anti-V5 (Mouse monoclonal) | ThermoFisher Scientific | Cat#R960-25, RRID:AB_2556564 | IF(1:500) |
Antibody | anti-Ase (Rabbit polyclonal) | Weng et al., 2010 doi: 10.1016/j.devcel.2009.12.007. | IF(1:400) | |
Antibody | anti-Hamlet (Rabbit polyclonal) | Eroglu et al., 2014 doi: 10.1016/j.cell.2014.01.053. | IF(1:50) | |
Antibody | anti-Dpn (Rat monoclonal) | Lee et al., 2006a doi: 10.1038/nature04299. | clone 11D1BC7.14 | IF(1:2) |
Antibody | Alexa Fluor 488 AffiniPure Anti-Chicken IgY (IgG) (H+L) (Donkey polyclonal) | Jackson Immuno Research Laboratories, INC. | Cat#703-545-155, RRID:AB_2340375 | IF(1:500) |
Antibody | Alexa Fluor 647 AffiniPure anti-Rat IgG (H+L) (Goat polyclonal) | Jackson Immuno Research Laboratories, INC. | Cat#112-605-167 RRID:AB_2338404 | IF(1:500) |
Antibody | anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Goat polyclonal) | ThermoFisher Scientific | Cat#A-11029, RRID:AB_2534088 | IF(1:500) |
Antibody | anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Goat polyclonal) | ThermoFisher Scientific | Cat#A-11034, RRID:AB_2576217 | IF(1:500) |
Antibody | anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 (Goat polyclonal) | ThermoFisher Scientific | Cat#A-11035, RRID:AB_2534093 | IF(1:500) |
Other | Rhodamine Phalloidin | ThermoFisher Scientific | Cat#R415 | IF(1:100) |
Genetic reagent (D. melanogaster) | brat11/CyO, Actin-GFP | Lee et al., 2006b doi: 10.1016/j.devcel.2006.01.017. | ||
Genetic reagent (D. melanogaster) | w1118; Df(2L)Exel8040/CyO | Bloomington Drosophila Stock Center | BDSC: 7847 FlyBase: FBst0007847; RRID:BDSC_7847 | FlyBase symbol: Df(2L)Exel8040/CyO |
Genetic reagent (D. melanogaster) | y1, M{vas-int.Dm}ZH-2A w*; M{UAS-insbFL-myc}ZH-86Fb | Komori et al., 2018 doi: 10.1101/gad.320333.118. | ||
Genetic reagent (D. melanogaster) | Wor-Gal4(II) | Lee et al., 2006a doi: 10.1038/nature04299. | ||
Genetic reagent (D. melanogaster) | Wor-Gal4(III) | Weng et al., 2010 doi: 10.1016/j.devcel.2009.12.007. | ||
Genetic reagent (D. melanogaster) | y1, w*; P{tubPGAL80} LL10, P{neoFRT}40A/CyO | Bloomington Drosophila Stock Center | BDSC: 5192 FlyBase: FBst0005192; RRID:BDSC_5192 | FlyBase symbol: y1, w*; P{tubPGAL80} LL10, P{neoFRT}40A/CyO |
Genetic reagent (D. melanogaster) | P{hsFLP}1, P{tubP-GAL80}LL1, w*, P{neoFRT}19A; P{UAS-mCD8::GFP.L}LL5 | Bloomington Drosophila Stock Center | BDSC: 5134 FlyBase: FBst0005134; RRID:BDSC_5134_ | FlyBase symbol: P{hsFLP}1, P{tubP-GAL80}LL1, w*, P{neoFRT}19A; P{UAS-mCD8::GFP.L}LL5 |
Genetic reagent (D. melanogaster) | y1 w*; PBac{y[+mDint2] w[+mC]=tll EGFP.S}VK00037 | Bloomington Drosophila Stock Center | BDSC: 30874 FlyBase: FBst0030874; RRID:BDSC_30874 | FlyBase symbol: y1 w*; PBac{y[+mDint2] w[+mC]=tll EGFP.S}VK00037 |
Genetic reagent (D. melanogaster) | Erm-Gal4 (II) | Pfeiffer et al., 2008 doi: 10.1073/pnas.0803697105. | ||
Genetic reagent (D. melanogaster) | Erm-Gal4 (III) | Pfeiffer et al., 2008 doi: 10.1073/pnas.0803697105. | ||
Genetic reagent (D. melanogaster) | tllRNAi: y1 sc* v1 sev21; P{TRiP.HMS01316}attP2 | Bloomington Drosophila Stock Center | BDSC: 34329 FlyBase: FBst0034329; RRID:BDSC_34329 | FlyBase symbol: y1 sc* v1 sev21; P{TRiP.HMS01316}attP2 |
Genetic reagent (D. melanogaster) | M{UAS-tll.ORF-VN}ZH-86Fb | FlyORF | F004752 FBst0502964; RRID:FlyORF_ F004752 | FlyBase symbol: M{UAS-tll.ORF-VN}ZH-86Fb |
Genetic reagent (D. melanogaster) | Ase-Gal80 (II) | Neumüller et al., 2011 doi: 10.1016/j.stem.2011.02.022. | ||
Genetic reagent (D. melanogaster) | erm1/CyO, Act-GFP | Weng et al., 2010 doi: 10.1016/j.devcel.2009.12.007. | ||
Genetic reagent (D. melanogaster) | erm2/CyO, Act-GFP | Weng et al., 2010 doi: 10.1016/j.devcel.2009.12.007. | ||
Genetic reagent (D. melanogaster) | UAS-erm | Weng et al., 2010 doi: 10.1016/j.devcel.2009.12.007. | ||
Genetic reagent (D. melanogaster) | PBac{erm-flag4C(g)}VK33 | Janssens and Lee, 2014 doi: 10.1242/dev.106534. | ||
Genetic reagent (D. melanogaster) | DRNAi: y1 v1; P{TRiP.JF02115}attP2 | Bloomington Drosophila Stock Center | BDSC: 26217 FlyBase: FBst0026217; RRID:BDSC_26217 | FlyBase symbol: y1 v1; P{TRiP.JF02115}attP2 |
Genetic reagent (D. melanogaster) | AseRNAi: y1 sc* v1 sev21; P{TRiP.HMS02847}attP2 | Bloomington Drosophila Stock Center | BDSC: 44552 FlyBase: FBst0044552; RRID:BDSC_44552 | FlyBase symbol: y1 sc* v1 sev21; P{TRiP.HMS02847}attP2 |
Genetic reagent (D. melanogaster) | hamRNAi: y1 v1; P{TRiP.JF02270}attP2 | Bloomington Drosophila Stock Center | BDSC: 26728 FlyBase: FBst0026728; RRID:BDSC_26728 | FlyBase symbol: y1 v1; P{TRiP.JF02270}attP2 |
Genetic reagent (D. melanogaster) | hamRNAi: y1 sc* v1 sev21; P{y[+t7.7] v[+t1.8]=TRiP.HMS00470}attP2 | Bloomington Drosophila Stock Center | BDSC: 32470 FlyBase: FBst0032470; RRID:BDSC_32470 | FlyBase symbol: y1 sc* v1 sev21; P{y[+t7.7] v[+t1.8]=TRiP.HMS00470}attP2 |
Genetic reagent (D. melanogaster) | OpaRNAi: y1 sc* v1 sev21; P{TRiP.HMS01185}attP2/TM3, Sb1 | Bloomington Drosophila Stock Center | BDSC: 34706 FlyBase: FBst0034706; RRID:BDSC_34706 | FlyBase symbol: y1 sc* v1 sev21; P{TRiP.HMS01185}attP2/TM3, Sb1 |
Genetic reagent (D. melanogaster) | w1118; Df(2L)Exel7071/CyO | Bloomington Drosophila Stock Center | BDSC: 7843 FlyBase: FBst0007843; RRID:BDSC_7843 | FlyBase symbol: w1118; Df(2L)Exel7071/CyO |
Genetic reagent (D. melanogaster) | hamSKI, FRT40A/CyO | This paper | A new hamlet mutant fly line | |
Genetic reagent (D. melanogaster) | P{w[+mW.hs]=GawB}elav[C155], P{w[+mC]=UAS-mCD8::GFP.L}Ptp4E[LL4], P{ry[+t7.2]=hsFLP}1, w[*] | Bloomington Drosophila Stock Center | BDSC: 5146 FlyBase: FBst0005146; RRID:BDSC_5146 | FlyBase symbol: P{w[+mW.hs]=GawB}elav[C155], P{w[+mC]=UAS-mCD8::GFP.L}Ptp4E[LL4], P{ry[+t7.2]=hsFLP}1, w[*] |
Genetic reagent (D. melanogaster) | w1118; P{w[+mC]=UAS-Dcr-2.D}2 | Bloomington Drosophila Stock Center | BDSC: 24650 FlyBase: FBst00024650; RRID:BDSC_24650 | FlyBase symbol: w1118; P{w[+mC]=UAS-Dcr-2.D}2 |
Genetic reagent (D. melanogaster) | w*; P{w[+mC]=tubP- GAL8ts}2/TM2 | Bloomington Drosophila Stock Center | BDSC: 7017 FlyBase: FBst00024650; RRID:BDSC_7017 | FlyBase symbol: w*; P{w[+mC]=tubP- GAL8ts}2/TM2 |
Genetic reagent (D. melanogaster) | ham1,FRT40A/Cyo | Moore et al., 2002 doi: 10.1126/science.1072387. | ||
Genetic reagent (D. melanogaster) | UAS-ham | Moore et al., 2002 doi: 10.1126/science.1072387. | ||
Genetic reagent (D. melanogaster) | RNAi of Notch: y1, v1; P{y+t7.7v+t1.8=TRiP.HMS00001}attP2 | Bloomington Drosophila Stock Center | BDSC: 33611 FlyBase: FBst0033611; RRID:BDSC_33611 | FlyBase symbol: y1, v1; P{y+t7.7v+t1.8=TRiP.HMS00001}attP2 |
Genetic reagent (D. melanogaster) | Oregon-R-C | Bloomington Drosophila Stock Center | BDSC: 5 FlyBase: FBst0000005; RRID:BDSC_5 | FlyBase symbol: Oregon-R-C |
Genetic reagent (D. melanogaster) | P{hsFLP}1, y1 w*; P{UAS- N.intra.GS}2/CyO; MKRS/TM2 | Bloomington Drosophila Stock Center | BDSC: 52008 FlyBase: FBst0052008; RRID:BDSC_52008 | FlyBase symbol: P{hsFLP}1, y1 w*; P{UAS- N.intra.GS}2/CyO; MKRS/TM2 |
Genetic reagent (D. melanogaster) | y1; M{vas-int.Dm}ZH-2A w*; M{UAS-ham∆C-ZF-myc}ZH-86Fb | This paper | Transgene expressing Hamlet mutant form of the C-terminal zinc finger deletion version | |
Genetic reagent (D. melanogaster) | y1; M{vas-int.Dm}ZH-2A w*; M{UAS-ERD::hamN-ZF-myc}ZH-86Fb | This paper | Transgene expressing Hamlet the N-terminal zinc finger fused with ERD transcriptional repression domain | |
Genetic reagent (D. melanogaster) | y1; M{vas-int.Dm}ZH-2A w*; M{UAS-VP-16::hamN-ZF-myc}ZH-86Fb | This paper | Transgene expressing Hamlet the N-terminal zinc finger fused with VP16 transcriptional activatoin domain | |
Genetic reagent (D. melanogaster) | cu1, tll49/TM3, P{ftz/lacC}SC1, Sb1, Ser1 | Bloomington Drosophila Stock Center | BDSC: 7093 FlyBase: FBst007093; RRID:BDSC_7093 | FlyBase symbol: cu1, tll49/TM3, P{ftz/lacC}SC1, Sb1, Ser1 |
Genetic reagent (D. melanogaster) | st1 e1 tll1/TM3, Sb1 | Bloomington Drosophila Stock Center | BDSC: 2729 FlyBase: FBst002729; RRID:BDSC_2729 | FlyBase symbol: st1 e1 tll1/TM3, Sb1 |
Genetic reagent (D. melanogaster) | hamSK4, FRT40A/CyO | Bloomington Drosophila Stock Center | BDSC: 34329FlyBase: FBst0034329;RRID:BDSC_34329 | FlyBase symbol: y1 sc* v1 sev21; P{TRiP.HMS01316}attP2 |
Genetic reagent (D. melanogaster) | hdac3RNAi: y1 sc* v1 sev21; P{TRiP.HMS00087}attP2 | Bloomington Drosophila Stock Center | BDSC: 34778 FlyBase: FBst0034778; RRID:BDSC_34778 | FlyBase symbol: hdac3RNAi: y1 sc* v1sev21; P{TRiP.HMS00087}attP2 |
Genetic reagent (D. melanogaster) | Su(z)12RNAi: y1 sc* v1 sev21; P{TRiP.HMS00280}attP2/TM3, Sb1 | Bloomington Drosophila Stock Center | BDSC: 33402 FlyBase: FBst0033402; RRID:BDSC_33402 | FlyBase symbol: y1 sc* v1 sev21; P{TRiP.HMS00280}attP2/TM3, Sb1 |
Genetic reagent (D. melanogaster) | Su(var)3-3RNAi: y1 sc* v1 sev21; P{TRiP.HMS00638}attP2 | Bloomington Drosophila Stock Center | BDSC: 32853 FlyBase: FBst0032853; RRID:BDSC_32853 | FlyBase symbol: y1 sc* v1 sev21; P{TRiP.HMS00638}attP2 |
Genetic reagent (D. melanogaster) | Su(var)205RNAi: y1 sc* v1 sev21; P{TRiP.GL00531}attP40 | Bloomington Drosophila Stock Center | BDSC: 36792 FlyBase: FBti0146447; RRID:BDSC_36792 | FlyBase symbol: y1 sc* v1 sev21; P{TRiP.GL00531}attP40 |
Genetic reagent (D. melanogaster) | UAS-Mi-2DN | Kovač et al., 2018 doi: 10.1038/s41467-018-04503-2. | ||
Genetic reagent (D. melanogaster) | UAS-Mi-brmDN | Herr et al., 2010 doi: 10.1016/j.ydbio.2010.04.006. | ||
Genetic reagent (D. melanogaster) | In(1)wm4; Su(var)3–91/TM3, Sb1 Ser1 | Bloomington Drosophila Stock Center | BDSC: 6209 FlyBase: FBst0006209; RRID:BDSC_6209 | FlyBase symbol: In(1)wm4; Su(var)3–91/TM3, Sb1 Ser1 |
Genetic reagent (D. melanogaster) | w1118; PBac{Sp1- EGFP.S}VK00033 | Bloomington Drosophila Stock Center | BDSC: 38669 FlyBase: FBst0038669; RRID:BDSC_38669 | FlyBase symbol: w1118; PBac{Sp1- EGFP.S}VK00033 |
Sequenced-based reagent | Ham_F | Eroglu et al., 2014 doi: 10.1016/j.cell.2014.01.053. | PCR primers | atagatcctttggccagcagac |
Sequenced-based reagent | Ham_R | Eroglu et al., 2014 doi: 10.1016/j.cell.2014.01.053. | PCR primers | agtactcctccctttcggcaat |
Sequenced-based reagent | Ase_F | Komori et al., 2014b doi: 10.7554/eLife.03502. | PCR primers | agcccgtgagcttctacgac |
Sequenced-based reagent | Ase_R | Komori et al., 2014b doi: 10.7554/eLife.03502. | PCR primers | gcatcgatcatgctctcgtc |
Sequenced-based reagent | D_F | This paper | PCR primers | gcggcggcggtcaacaat |
Sequenced-based reagent | D_R | This paper | PCR primers | tgcggcgtacagcgaagggt |
Sequenced-based reagent | Erm_F | Eroglu et al., 2014 doi: 10.1016/j.cell.2014.01.053. | PCR primers | gttacggccaggcatcgggtcaa |
Sequenced-based reagent | Erm_R | Eroglu et al., 2014 doi: 10.1016/j.cell.2014.01.053. | PCR primers | gggccaggcgggattactcgtctc |
Sequenced-based reagent | PntP1_F | Komori et al., 2014b doi: 10.7554/eLife.03502. | PCR primers | ggcagtacgggcagcaccac |
Sequenced-based reagent | PntP1_R | Komori et al., 2014b doi: 10.7554/eLife.03502. | PCR primers | ctcaacgcccccaccagatt |
Sequenced-based reagent | Dpn_F | Komori et al., 2014b doi: 10.7554/eLife.03502.Komori et al., 2014b | PCR primers | catcatgccgaacacaggtt |
Sequenced-based reagent | Dpn_R | Komori et al., 2014b | PCR primers | gaagattggccggaactgag |
Recombinant DNA reagent | pUAST-ham∆C-ZF-myc-attB (plasmid) | This paper | Plasmid DNA of a transgene expressing Hamlet mutant form of the C-terminal zinc finger deletion version | |
Recombinant DNA reagent | pUAST-ERD::hamN-ZF-myc-attB (plasmid) | This paper | Plasmid DNA of a transgene expressing Hamlet the N-terminal zinc finger fused with ERD transcriptional repression domain | |
Recombinant DNA reagent | pUAST-VP16::hamN-ZF-myc-attB (plasmid) | This paper | Plasmid DNA of a transgene expressing Hamlet the N-terminal zinc finger fused with VP16 transcriptional activatoin domain | |
Software, algorithm | LAS AF | Leica Microsystems | RRID:SCR_013673 | |
Software, algorithm | ImageJ 1.50 g | National Institute of Health | RRID:SCR_003070 |