Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response

  1. Matthew D Keefe
  2. Haille E Soderholm
  3. Hung-Yu Shih
  4. Tamara J Stevenson
  5. Kathryn A Glaittli
  6. D Miranda Bowles
  7. Erika Scholl
  8. Samuel Colby
  9. Samer Merchant
  10. Edward W Hsu
  11. Joshua L Bonkowsky  Is a corresponding author
  1. Department of Pediatrics, University of Utah School of Medicine, United States
  2. Department of Bioengineering, University of Utah, United States
  3. Brain and Spine Center, Primary Children’s Hospital, United States


Vanishing white matter disease (VWM) is a severe leukodystrophy of the central nervous system caused by mutations in subunits of the eukaryotic initiation factor 2B complex (eIF2B). Current models only partially recapitulate key disease features, and pathophysiology is poorly understood. Through development and validation of zebrafish (Danio rerio) models of VWM, we demonstrate that zebrafish eif2b mutants phenocopy VWM, including impaired somatic growth, early lethality, effects on myelination, loss of oligodendrocyte precursor cells, increased apoptosis in the CNS, and impaired motor swimming behavior. Expression of human EIF2B2 in the zebrafish eif2b2 mutant rescues lethality and CNS apoptosis, demonstrating conservation of function between zebrafish and human. In the mutants, intron 12 retention leads to expression of a truncated eif2b5 transcript. Expression of the truncated eif2b5 in wild-type larva impairs motor behavior and activates the ISR, suggesting that a feed-forward mechanism in VWM is a significant component of disease pathophysiology.


Vanishing white matter (VWM) disease is a genetic leukodystrophy leading to severe neurological disease and early death (Fogli et al., 2004; van der Knaap et al., 2006; Labauge et al., 2009; Carra-Dalliere et al., 2011; VWM Research Group et al., 2018). VWM disease is caused by bi-allelic recessive variants in any of the five genes encoding subunits (1-5) of the eukaryotic translation initiation factor 2B (eIF2B) complex. Symptoms of VWM include ataxia, spasticity, seizures, cognitive impairment, and motor problems. While there are no sex differences seen in VWM patients, females can experience ovarian failure. In patients, autopsies have revealed affected oligodendrocytes and astrocytes, myelin loss, and cystic cavitations of white matter (van der Knaap et al., 1997; van der Knaap et al., 1998; Pronk et al., 2006). Genotype-phenotype correlations of mutation severity have been shown (VWM Research Group et al., 2018), and severe multi-organ involvement is characteristic of fetal and neonatal forms (van der Knaap et al., 2003b; Song et al., 2017). Disease onset <4 years of age is followed by a rapid deterioration of symptoms, while disease onset >4 years of age shows greater variability in disease course (VWM Research Group et al., 2018). There is no treatment for VWM disease, and current mouse models only partially recapitulate disease pathophysiology (Geva et al., 2010; Dooves et al., 2016).

The eIF2B complex is a heteropentameric guanine nucleotide exchange factor (GEF) for eukaryotic initiation factor 2 (eIF2), which governs the rate of global protein synthesis and cap-dependent translation initiation. The eIF2B complex also functions to displace eIF5 from inactive GDP-bound eIF2 to allow its recruitment to the ribosome (Jennings and Pavitt, 2014). Importantly, the eIF2B complex plays a central role in the cellular integrated stress response (ISR). Stress-dependent kinase activation leads to phosphorylation of eIF2, which binds eIF2B more tightly and reduces overall protein synthesis (Krishnamoorthy et al., 2001; Pakos-Zebrucka et al., 2016). In human cell lines, it has been shown that translation is suppressed to a greater degree after stress in VWM patients (Moon and Parker, 2018). This suppression of translation lasts for a longer period of time in VWM cells, and the protein responsible for de-phosphorylating eIF2 and allowing translation recovery, GADD34, was found in lower quantities.

Mouse lines with knock-in/knock-out mutations in Eif2b5R132H, a common allele of VWM patients, have impaired motor function, growth deficits, delayed development of white matter, and abnormal abundance of oligodendrocytes and astrocytes (Geva et al., 2010; Atzmon et al., 2018). This developmental role for eIF2B was further confirmed in a mouse model with developmental misexpression of pancreatic endoplasmic reticulum kinase (PERK) in oligodendrocytes. PERK is one of the stress-responsive kinases that activate the ISR via phosphorylation of eIF2. PERK misexpression caused hypomyelination, oligodendrocyte damage, and myelin loss (Lin et al., 2014). However, this result was only seen in young mice, and could not be induced in mature animals.

ISR activation has been identified in VWM patient brain autopsy samples (van Kollenburg et al., 2006) and in mouse VWM models (Wong et al., 2019; Abbink et al., 2019). A small molecule inhibitor of the ISR, ISRIB, has been shown to bind to and activate the decameric, functional eIF2B complex (Sidrauski et al., 2013; Sidrauski et al., 2015; Wong et al., 2018).

There are key aspects that remain unclear about eIF2B function and its involvement in VWM pathophysiology. eIF2B is expressed globally but VWM primarily affect the CNS, including differential effects in the CNS. For example, oligodendrocyte numbers are decreased in affected white matter, but they are increased in other areas (Van Haren et al., 2004; Bugiani et al., 2010). GEF activity of the eIF2B complex does not appear to correlate with VWM disease severity (Liu et al., 2011), suggesting that the overall protein translation is not the key component of VWM pathophysiology. Another unusual and poorly understood aspect of VWM is that rapid clinical deterioration and white matter loss can be provoked by a stressor, such as minor head trauma or mild illness (van der Knaap et al., 2006). This is consistent with models in which chronic ISR activation causes cellular apoptosis (Bond et al., 2020), but the mechanism by which VWM mutation affects ISR response is unclear. Further, there is some evidence that a de-regulated ISR is not alone sufficient to cause VWM pathology (Wisse et al., 2017), and in fact blocking the ISR worsens VWM pathology (Sekine et al., 2016). Thus, current models and approaches have left key questions unanswered.

We report the development and characterization of a small vertebrate (zebrafish – Danio rerio) model of VWM. We have generated and characterized mutant alleles in zebrafish eif2b subunits 1, 2, and 4, and an allelic series in subunit 5. We demonstrate that the eif2b mutants exhibit a range of phenotypic severity, including changes in growth, lethality, behavior, myelination, apoptosis, and proliferation in the CNS. We also show conservation of function of eif2b2 between zebrafish and humans, validating the zebrafish model for understanding human VWM. We find that the eif2b mutants at baseline have activated induced stress response (ISR). The zebrafish eif2b mutants have impaired swimming motor behavior, a phenotype that could be used in a phenotype-based screen. Finally, we found that in the zebrafish eif2b mutants, a truncated eif2b5 transcript is generated. The truncated eif2b5 is capable of activating the ISR, and can impair motor behavior, suggesting that a feedback loop with truncated eif2b5 may play an important role in disease pathology. Our work reveals a similar role for the eif2b complex in zebrafish and in humans, identifies a novel mechanism of VWM pathophysiology, and provides a useful model of VWM for future therapeutics screening.


Phylogenetic analysis of EIF2B sequence homology and expression in zebrafish development

We characterized the sequence and developmental expression of the five Eif2b subunit orthologs in zebrafish, eif2b1-5 (eif2b1, ENSDARG00000091402; eif2b2 ENSDARG00000041397; eif2b3, ENSDARG00000018106; eif2b4, ENSDARG00000014004; eif2b5, ENSDARG00000074995). Each human EIF2B subunit gene has a single zebrafish ortholog with a conserved amino acid sequence (Figure 1A). The Eif2b zebrafish and human protein structures also show conserved structural domains (Figure 1B). We evaluated eif2b gene expression during early development. Expression analysis of zebrafish eif2b genes at 24 hpf (hours post-fertilization) showed expression chiefly in the brain and eye (Figure 1C–G). By 72 hpf expression was clearly noted throughout the animal, with higher levels in the brain (Figure 1H–L). Quantitative RT-PCR analysis revealed subunit specific expression changes in the first 7 days of life, although only for eif2b4 were the changes significant (Figure 1M–Q).

Phylogenetic and expression analysis of Eif2b orthologs in zebrafish during development.

(A) A horizontal cladogram of eif2b1-5 gene sequences shows that zebrafish have a single ortholog of each human EIF2B gene, and a relative conservation of amino acid sequence between orthologs. Scale bar equals an evolutionary distance of 0.1 amino acid changes per position in the sequence (Phylodendron). (B) Comparison of zebrafish and human EIF2B protein sequences shows conserved domain architectures. (C–L) Whole-mount in situ expression analysis in zebrafish embryos and larvae, brightfield microscopy, rostral left, dorsal top. (C–E) eif2b subunit genes at 24 hpf shows predominantly brain and eye expression, with lower levels of expression throughout the embryo. (H–L) eif2b subunit genes at 72 hpf shows higher expression throughout the animal and in the brain compared to 24 hpf. (M–Q) qRT-PCR expression of eif2b subunit genes from 24 hpf through 7 dpf, normalized to 24 hpf expression demonstrates variable expression changes across development. Error bars, standard error of the mean.

Figure 1—source data 1

Quantification of qRT-PCR results of eif2b subunits.
Figure 1—source data 2

Statistical analysis of changes in subunit expression.

Zebrafish eif2b subunit mutant alleles generation and molecular characterization

We obtained zebrafish mutant alleles for three eif2b subunit genes from the Sanger Institute Zebrafish Mutation Project (eif2b1, ENSDARG00000091402; eif2b2 ENSDARG00000041397; eif2b4, ENSDARG00000014004) (Figure 2A–C) (15). eif2b1 (sa12357) harbors a T/A transversion resulting in an early stop in exon 8 (Figure 2A); eif2b2 (sa17223) has a G/A transition in exon 5, mutating an essential splice site (Figure 2B); and eif2b4 (sa17367) has a G/A transition in exon 12 mutating an essential splice site (Figure 2C). To mutagenize subunit eif2b5, we used the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system and created six different alleles by targeting exon 1 (Figure 2D). This created three alleles (zc101, zc103, and zc104) with in-frame deletions leading to loss of amino acids; two alleles with a combination of amino acid loss and missense mutations (zc105 and zc106); and one allele (zc102) with a nonsense mutation that caused a frame shift in exon one leading to a premature stop codon in exon 2. Following CRISPR mutagenesis, individual G0 fish were outcrossed to wild-type animals and offspring were screened by high-resolution melt analysis (HRMA) PCR (Xing et al., 2014). In addition to HRMA PCR genotyping, we confirmed genotypes by Sanger sequencing both in the G0 and subsequent generations. cDNA sequencing of eif2b2sa17223, eif2b5zc102 and eif2b5zc103 confirmed that the genomic mutations caused splicing failure or the nonsense mutation and frame shift (Figure 2E). We tried western blotting with several commercial antibodies against Eif2b2 and Eif2b5 (Eif2B2 Abcam 133848; Eif2B5 Abcam ab91563, GeneTex 30808, Santa Cruz 514056, ProSci 56–847, Bethyl A302-557A) but none gave a specific band.

Figure 2 with 1 supplement see all
Zebrafish eif2b allele generation and characterization.

(A-D) Depiction of zebrafish eif2b subunits exon structure and the location and nucleotide change for each mutant. (A) eif2b1 harbors a T/A transversion resulting in an early stop in exon 8. (B) eif2b2 has a G/A transition in exon 5, mutating an essential splice site. (C) eif2b4 has a G/A transition in exon 12 mutating an essential splice site. (D) eif2b5 exon one was targeted for mutagenesis using a gRNA (red). Six distinct alleles were recovered (described in text). (E) Chromatograms of cDNA confirm presence of predicted mutations for eif2b5zc103/zc103, eif2b5zc102/zc102, and eif2b2sa17223/sa17223. (F) eif2b5zc103/zc103 mutants survive until adulthood in Mendelian ratios, but show grow defects compared to their heterozygous and wild-type siblings. (G) Adult eif2b5zc103/zc103 lengths are significantly shorter compared to their wild-type and heterozygous siblings. (H) Bright-field (BF) images of 6 dpf eif2b5zc103/zc103, eif2b5zc102/zc102, and eif2b2sa17223/sa17223 larva. eif2b2sa17223/sa17223 and eif2b5zc102/zc102 have no swim bladder (arrowhead) and a small head. (I) Kaplan-Meyer survival curves from an eif2b2sa17223/+ heterozygous in-cross shows 1% (n = 3) homozygote survival at 10 dpf (total n = 302); however no homozygotes live past 2 weeks of age. (J) Kaplan-Meyer survival curves from an eif2b5zc102/+ heterozygous in-cross shows that all homozygotes were dead by 10 dpf (total n = 62). (K) Kaplan-Meyer survival curves from an eif2b5zc103/+ heterozygous in-cross show no mortality of homozygotes. (L) Motor swimming analysis shows impaired swimming behavior in mutants. Distance moved, time spent moving, and velocity, for wild-type controls, and eif2b5zc103/zc103, eif2b5zc102/zc102, and eif2b2sa17223/sa17223 mutants, at 5, 6, and 7 dpf. Mean shown with 95% confidence intervals.

Figure 2—source data 1

Quantification of lengths.
Figure 2—source data 2

Quantification of behavior results.
Figure 2—source data 3

Quantification of behavior results of eif2b4sa17367/sa17367 allele.
Figure 2—source data 4

qRT-PCR for ISR transcripts for eif2b4sa17367/sa17367 allele.
Figure 2—source data 5

Survival quantification for eif2b4sa17367/sa17367 allele.
Figure 2—source data 6

Survival quantification for eif2b5zc103/zc103allele.

Most of the alleles in the different subunits were homozygous viable, and survived to adulthood and were fertile. The eif2b5zc103/zc103 mutants showed a decrease in size compared to their wild type and heterozygous siblings (2.2 cm vs 1.8 cm, 0.3 and 0.2 s.D., and p<0.0001) (Figure 2F–G). Mutants of a more severe allele, eif2b5zc102/zc102, harboring an early stop codon, exhibited growth deficits such as failure to develop a swim bladder, and were smaller in size compared to their wild type and heterozygous siblings (Figure 2H, arrowhead). This phenotype was also present in the eif2b2sa17223/sa17223 allele (Figure 2H, arrowhead). Two alleles did not survive past 2 weeks of age: eif2b5zc102/zc102 and eif2b2sa17223/sa17223 (at 10 dpf, eif2b5+/+ WT n = 12; eif2b5zc102/+ heterozygous n = 26; eif2b5zc102/zc102 homozygous n = 0. eif2b2+/+ WT n = 68; eif2b2sa17223/+ heterozygous n = 118; eif2b2sa17223/sa17223 homozygous n = 2) (Figure 2I–J). By contrast, the milder phenotype eif2b5zc103 allele survives until adulthood (at 10 dpf, eif2b5+/+ WT n = 25; eif2b5zc103/+ heterozygous n = 41; eif2b5zc103/zc103 homozygous n = 22) (Figure 2K).

Since affected VWM patients often have motor impairment, we analyzed the functional effects of eif2b2, eif2b4, and eif2b5 mutants on motor behavior from 5 dpf to 7 dpf. The eif2b2sa17222sa172232 homozygous mutants showed reduction in distance moved, movement time, and velocity at 7dpf (Figure 2L). The eif2b4sa17367/sa17367 mutants also had impairments in growth, motor function, and survival (Figure 2—figure supplement 1A-C). The eif2b5 zc102/zc102 mutants had motor function impairments by 5 dpf (Figure 2L). On the other hand, the eif2b5zc103/zc103 mutants had no difference in distance moved, movement time, or velocity as compared to their wild-type siblings (Figure 2L). To exclude the possibility that the reduced motor function was due to the developmental delay, we compared the behavior of 7 dpf eif2b2sa17223 or eif2b5zc102 mutants, to 6dpf wild-type siblings, and still found abnormal motor function in mutants (Figure 2L). However, since some of the mutants (such as eif2b5zc102) had phenotypes including reduced viability, smaller body size, etc., it is possible that some of the behavioral deficits are not due to problems of the CNS. Since the eif2b2 and eif2b5 mutations are the most commonly reported in clinical patients (van der Knaap et al., 2003a), the eif2b2sa17223, eif2b5zc102, and eif2b5zc103 mutants were used for the remaining experiments in this manuscript. eif2b mutants had abnormal CNS development.

Because we observed that the eif2b mutants had early lethality and abnormal growth, we evaluated different CNS markers in early development. We compared three eif2b alleles: two alleles in two different subunits with early lethality, eif2b5zc102 and eif2b2sa17223; and a homozygous viable allele, eif2b5zc103. At 5 dpf, all three of these mutants showed an increase in cell death, quantified using terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) (eif2b5zc103: mean = 129.1, S.D. = 79.5, eif2b5+/+: mean = 12.2, S.D. = 9.8, p=0.001; eif2b5zc102: mean = 163.7, S.D. = 78.2 eif2b5+/+: mean = 18.7, S.D. = 10.6 p=2.03×10−5; eif2b2sa17223: mean = 202.8, S.D. = 60.8: eif2B2+/+: mean = 37.4, S.D. = 25.2, p=0.0005) (Figure 3A–E). We also compared counts of cells expressing phospho-histone H3 (pH3), an indicator of cell proliferation. eif2b5zc103 and eif2b5zc102 mutants showed no change in pH3 cell counts at 5 dpf compared to controls, but showed a noticeable change in proliferation pattern: a lack of proliferation in the outer perimeter of the eyes (arrow) and the tectum (arrowhead), but increased proliferation in the ventricular region (asterisk) (eif2b5zc103: mean = 247.2, S.D. = 44.5, eif2b5+/+: mean = 273.1, S.D. = 43.8, p=0.206; eif2b5zc102: mean = 243.3, S.D. = 40.0, eif2b5+/+: mean = 288.3, S.D. = 32.0, p=0.0238) (Figure 3F–H,J). eif2b2sa17223 mutants showed a decrease in pH3 cell counts at 5 dpf compared to controls as well as a change in proliferation pattern (eif2b2sa17223: mean = 185.3, S.D. = 37.8: eif2b2+/+: mean = 271.6, S.D. = 46.7, p=0.0004) (Figure 3I,J).

eif2b mutants demonstrate abnormal CNS development.

Confocal images, z-stack maximal projections. (A–I), dorsal views of the brain, rostral to the top, scale bar 50 μm; (K–N), lateral views of spinal cord, dorsal to the top, scale bar 50 um. (P–S), dorsal views of brain, rostral to top, scale bar 50 μm. *p<0.05. (A–D) TUNEL and DAPI staining shows increased apoptosis in homozygous mutant alleles compared to controls (wild-type and heterozygous siblings) in eif2b5zc103/zc103 eif2b5zc102/zc102 and eif2b2sa17223/sa17223 mutants. (E) Quantification of mean TUNEL+ cell counts in eif2b5zc103/zc103 eif2b5zc102/zc102 and eif2b2sa17223/sa17223 mutants compared to sibling controls. (F–I) Phospho-histone 3 and DAPI staining shows decreased cell proliferation in 5 dpf eif2b2sa17223/sa17223 mutants compared to controls, while eif2b5zc103/zc103 eif2b5zc102/zc102 mutants show a change in proliferation pattern, specifically in the optic tectum. (J) Quantification of mean number pH3+ cells counts in eif2b5zc103/zc103 eif2b5zc102/zc102 and eif2b2sa17223/sa17223 mutants compared to sibling controls. (K–N) Olig2dsRed and DAPI staining shows no change in OPC counts in the spinal cords of 5 dpf eif2b5zc103/zc103 eif2b5zc102/zc102 and eif2b2sa17223/sa17223 mutants compared to controls. (O) Quantification of mean number Olig2dsRed+ counts in eif2b5zc103/zc103 eif2b5zc102/zc102 or eif2b2sa17223/sa17223 mutants compared to sibling controls. (P–S) Co-labeled Olig2dsRed+/TUNEL+ cell counts staining shows increase in Olig2dsRed+ cells undergoing apoptosis in brains of 5 dpf eif2b5zc103/zc103, eif2b5zc102/zc102, or eif2b2sa17223/sa17223 mutants compared to sibling controls. (O) Quantification of mean number of co-labeled Olig2dsRed+/TUNEL+ cell counts in eif2b5zc103/zc103, eif2b5zc102/zc102, or eif2b2sa17223/sa17223 mutants compared to sibling controls.

Figure 3—source data 1

Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results.
Figure 3—source data 2

Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results.
Figure 3—source data 3

Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results.
Figure 3—source data 4

Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results.

In the spinal cord, we measured counts of oligodendrocyte precursor cells (OPCs), which give rise to myelin-producing oligodendroglia. We used the Tg(olig2:dsRed) line crossed into the eif2b5zc103/zc103, eif2b5zc102/zc102 or eif2b2sa17223/sa172233 background (Kucenas et al., 2008). The Tg(olig2:dsRed) line labels OPCs as well as motor neurons and neuronal precursors, but in the spinal cord is specific for OPCs in labeled cells that have migrated dorsally. We observed no change in the number of OPCs (measured in two somites directly above the caudal end of the yolk) (eif2b5zc103: mean = 26.6, S.D. = 7.55, eif2b5+/+: mean = 30.71, S.D.=,5.88 p=0.278; eif2b5zc102: mean = 30.6, S.D. = 11.0, eif2b5+/+: mean = 36.6, S.D. = 9.63, p=0.514; eif2b2sa17223: mean = 35.8, S.D. = 5.36, eif2b2+/+: mean = 39.2, S.D. = 4.66, p=0.163) (Figure 3K–O). We evaluated apoptotic OPCs in the brain by crossing the Tg(olig2:dsRed) line into the eif2b5zc103/zc103, eif2b5zc102/zc102 or the eif2b2sa17223/sa172233 background and staining with TUNEL. All three lines showed significant increases in the number of TUNEL-positive OPCs specifically in the hindbrain (eif2b5zc102: mean = 17.5, S.D. = 3.02, eif2b5+/+: mean = 1, S.D. = 1, p=0.00004; eif2b5zc103: mean = 3, S.D. = 2.26, eif2b5+/+: mean = 0.7, S.D. = 1.06, p=0.0144; eif2b2sa17223: mean = 3.5, S.D. = 1.05, eif2b2+/+: mean = 0.333, S.D. = 0.577, p=0.002) (Figure 3P–T).

To further quantify effects on oligodendrocytes, we analyzed the expression of myelin associated glycoprotein in differentiated oligodendrocytes by in situ hybridization, and showed no difference in numbers of those cells in the spinal cord of mutants compared with wild-type siblings (Figure 4). To confirm that the increased apoptosis was due to loss of OPCs, we counterstained for the OPC marker, olig1 along with the TUNEL assay in the eif2b5zc103/zc103, eif2b5zc102/zc102 or eif2b2sa17223/sa172233 mutants (Figure 4).

Figure 4 with 1 supplement see all
Top row (and quantification in lower left): increased apoptotic OPCs in the brain and spinal cord.

Confocal images of brain, z-stack, rostral to the top, double-labeling for TUNEL and olig1 (in situ probe), in WT, eif2b5zc103/zc103, eif2b5zc102/zc102 or eif2b2sa17223/sa172233 larvae. Region used for quantification shown by box. Inset in each panel shows example of double-labeled cell (TUNEL, olig1) for each genotype (except WT), single confocal slice image. Middle panels: no change in apoptosis of differentiated oligodendrocytes, co-labeled with myelin associated glycoprotein (mag) (in situ probe) and TUNEL. Confocal z-stack images of spinal cord, rostral to the left; quantified in lower right panel.

Figure 4—source data 1

Quantification of olig1, TUNEL and mag results.

The data above showed that proliferation patterns were altered in eif2b mutants, and in order to discover in which cell types this occurred, we counterstained with the radial glia marker (Zrf1), the pan-neuronal maker (HuC/D), and the microglial marker (apoeb) along with phospho-histone3 (pH3). The Zrf1 and pH3 double-positive cells showed no difference in either the tectum or the eye in eif2b mutants. In contrast, the midline of eif2b5zc102/zc102 contained significantly more Zrf1 and pH3 double-positive cells, while eif2b2sa17223/sa17223 and eif2b5zc103/zc103 tended towards increased numbers (Figure 5A,B). The HuC/D and pH3 double-positive cells were significantly decreased in the tectum and tended towards decreased numbers in the eye of eif2b5zc102/zc102 and eif2b2sa17223/sa17223 mutants. But there were no differences in either the tectum or eye of eif2b5zc103/zc103 compared to wild-type siblings (Figure 5A,B). The apoeb and pH3 double-positive cells were increased in the midline of eif2b5 mutants but not in the tectum and eye (Figure 5C,D). On the other hand, the eif2b2sa17223/sa17223 mutation had no impact on the apoeb and pH3 double-positive cells in the tectum, the midline, or the eye (Figure 5C,D). Thus, interestingly, the disordered proliferation was a widespread phenotype in different cell lineages, but did also show spatial specificity.

Determination of cell types affected in mutants by changes in proliferation or in apoptosis.

(A) Confocal images of brain, z-stack, rostral to the top, in WT, eif2b5zc103/zc103, eif2b5zc102/zc102 or eif2b2sa17223/sa172233 larvae. Confocal images of brain, z-stack, rostral to the top. Top row, labeling for Zrf1, DAPI, and pH3. Middle row, labeling for HuC/D, DAPI, and pH3. Bottom row, labeling for apoeb, DAPI, and pH3. (B) Quantification of cell counts in (A). (C) Confocal images of brain, z-stack, rostral to the top, in WT, eif2b5zc103/zc103, eif2b5zc102/zc102 or eif2b2sa17223/sa172233 larvae. Confocal images of brain, z-stack, rostral to the top. Top row, labeling for Zrf1, DAPI, and TUNEL. Middle row, labeling for HuC/D, DAPI, and TUNEL. Bottom row, labeling for apoeb, DAPI, and TUNEL. (D) Quantification of cell counts in (C).

Figure 5—source data 1

Quantification of Zrf1, HuC/D, and apoeb, double-labeling with pH3, results in tectum, midline, and eyes in eif2b5zc103/zc103, eif2b2zc102/zc102, and eif2b2sa17223/sa172233.
Figure 5—source data 2

Quantification of Zrf1, HuC/D, and apoeb, double-labeling with TUNEL, results in tectum, midline, and eyes in eif2b5zc103/zc103, eif2b2zc102/zc102, and eif2b2sa17223/sa172233.

In order to identify the cell type of apoptotic cells outside the hindbrain, we stained with Zrf1, HuC/D, and apoeb, and counterstained with TUNEL. This revealed that only eif2b5zc102/c102 mutants had a significant increase in Zrf1 and TUNEL double-positive cells in the midline (Figure 5).

Zebrafish adult eif2b5zc103/zc103 mutants show myelin defects

VWM patients have a loss of white matter and abnormal white matter signal quality on MRI (Leegwater et al., 2003; van der Knaap et al., 2006). We used transmission electron microscopy (TEM) to measure myelin content in the adult eif2b5zc103/zc103 mutants compared to age-matched controls. The adult mutants showed a decrease in the thickness of the myelin sheath as measured by estimation of the G-ratio, the perimeter of the axon to the perimeter of the myelin sheath (eif2b5zc103: mean = 0.690, S.D. = 0.076, eif2b5+/+: mean = 0.593, S.D. = 0.085, p=2.18E-22) (Figure 6A–E). We also performed Black Gold II staining to compare myelination patterns in the CNS. The adult mutants showed a disorganized pattern of myelinated axons in the optic tectum compared to age-matched wild-type adult controls (Figure 6F,G).

Figure 6 with 1 supplement see all
Adult eif2b5 zc103/zc103 mutants show myelin defects.

(A–C) Transmission electron microscopy (TEM) of adult eif2b5zc103/zc103 optic nerve compared to eif2b5+/+ adults. Scale bar 2 μm. (A) eif2b5+/+ adult TEM image. (B) eif2b5zc103/zc103 adult TEM image. (A’, B’) Higher magnification views of insets represented in (A) and (B), scale bar 0.5 μm. (C–E). Comparison of ratio between axon perimeter and myelin sheath perimeter, G-ratio, between eif2b5zc103/zc103 and eif2b5+/+; axon diameter and myelin thickness quantification shown. (F–G) Black Gold stain of adult eif2b5zc103/zc103 optic tectum compared to eif2b5+/+ adults. Scale bar 5 μm. (F) eif2b5+/+ adult Black Gold stained image. (G) eif2b5zc103/zc103 adult Black Gold stained image. (H–J) Magnetic Resonance Image (MRI) of adult eif2b5zc103/zc103 compared to eif2b5+/+. Scale bar 2 mm. Slice scheme of MRI images from the rhombencephalic ventricle (RV) at the end of the midbrain moving rostrally. (H) eif2b5+/+ adult T2 MRI image slice 1. (I) eif2b5zc103/zc103 adult T2 MRI of slice 1. (J) T2 intensity analysis. The normalized change in intensity from the from grey matter region of the optic tectum to the white matter region of the periventricular grey zone of the optic tectum, indicated by red boxes.

We performed magnetic resonance imaging (MRI) of adult eif2b5 mutants, and found a decrease in overall brain size in the adult eif2b5zc103/zc103 mutants compared to adult wild-type controls using the skull as a normalization factor to account for the decrease in overall size of the mutants (Figure 6H–J; Figure 6—figure supplement 1). These images showed a decrease in overall brain volume of the eif2b5zc103/zc103 mutants as measured by length, width and height of the brains compared to age-matched controls (eif2b5zc103/zc103 normalized length: mean = 0.933; S.D. = 0.041; eif2b5+/+ normalized length: mean = 1.11, S.D. = 0.091, p=0.001; eif2b5zc103/zc103 normalized width: mean = 0.836; S.D. = 0.034; eif2b5+/+ normalized width: mean = 0.958, S.D. = 0.023, p=0.00002; eif2b5zc103/zc103 normalized height: mean = 0.551; S.D. = 0.018; eif2b5+/+ normalized height: mean = 0.629, S.D. = 0.035, p=0.0006) (Figure 6—figure supplement 1). We also found a change in the intensity between the grey of the optic tectum and the white matter of the periventricular grey zone in the T2 MRI images from the rhombencephalic ventricle (RV) at the end of the midbrain moving rostrally (eif2b5zc103/zc103 normalized intensity: mean = 0.849; S.D. = 0.108; eif2b5+/+ normalized length: mean = 0.743, S.D. = 0.091, p=0.0005) (Figure 6J).

Human EIF2B genes rescue zebrafish eif2b mutant lethality and CNS apoptosis

Although the human and zebrafish eif2b subunit genes show significant conservation in protein sequence, an important question for modeling VWM is to demonstrate functional conservation. Zebrafish and human eif2b2 ortholog amino acids are highly conserved, and both orthologs have the same number of exons (Figure 7A–C). To test functional conservation, we created transgenic animals ubiquitously-expressing human EIF2B2. We created a Tol2 transposable vector in which the human EIF2B2 gene and enhanced green fluorescent protein (eGFP) was expressed under control of the ubiquitously-expressing promoter ß-actin (Figure 7D). We mated eif2b2sa17223/+ heterozygous adults, and injected their embryos at the one-cell stage with the human EIF2B2 vector to introduce the transgene (Tg) into the germline. Embryos were screened at 3 dpf, and those positive for GFP were grown up to adults and genotyped to identify and generate stable lines (Figure 7F). The transgenic mutant eif2b2sa17223/ sa17223;Tg(ß-actin:EIF2B2-2A-eGFP) larva developed a swim bladder and the growth deficits were rescued (Figure 7F, arrowhead). As adults, the GFP positive eif2b2sa17223/+;Tg(ß-actin:EIF2B2-2A-eGFP) were crossed with non-transgenic eif2b2sa17223/+. The offspring from this cross were genotyped and compared to a non-transgenic eif2b2sa17223/+ in-cross. Typically, eif2b2sa17223/ sa17223 have early lethality by 10 dpf. In contrast the transgenic homozygous mutant eif2b2sa17223/ sa17223;Tg(ß-actin:EIF2B2-2A-eGFP) animals showed 21% survival at 10 dpf (e.g. Mendelian ratios) (Figure 7E). This increase in transgenic homozygous mutant survival continued to adulthood, and the mutants were able to mate and were fertile. Further, the eif2b2sa17223/sa17223 increase in apoptosis (Figure 7G–H,K) was rescued and apoptosis in the eif2b2sa17223/sa17223;Tg(ß-actin:EIF2B2-2A-eGFP) was significantly reduced (TUNEL counts eif2b2sa17223/sa17223 transgenic: mean = 31.5, S.D. = 12.9; eif2b2sa17223/sa17223 non-transgenic: mean = 84.4, S.D. = 27.63, p=1.89E-05) (Figure 7I–K). eif2b mutants express a truncated eif2b5 transcript that causes ISR activation and defects in behavior.

Human EIF2B2 gene rescues zebrafish eif2b2sa17223/sa17223 mutants.

(A) 11.1 kb zebrafish eif2b2 gene structure. (B) 9.5 kb human EIF2B2 gene structure. (C) Conservation of amino acid sequence between zebrafish eif2b2 and human EIF2B2. (D) Schematic of rescue construct containing Tol2, β-actin, human EIF2B2, and eGFP. (E) Genotype results (at adult age), of an eif2b2sa17223/+ heterozygous incross, and an eif2b2sa17223/+ heterozygous zebrafish crossed with two different transgenic alleles (#3 and #4): eif2b2sa17223/+;Tg3(β-actin:EIF2B2:2A:eGFP) or eif2b2sa17223/+;Tg4(β-actin:EIF2B2:2A:eGFP) heterozygous zebrafish. (F) Bright-field and immunofluorescent images of eif2b2sa17223/sa17223;β-actin:EIF2B2:2A:eGFP mutant fish: showing a swim bladder and regular-sized head; or showing GFP expression in eif2b2sa17223/sa17223;β-actin:EIF2B2:2A:eGFP mutant fish. (G–J) TUNEL and DAPI antibody staining of wild-type control; eif2b2sa17223/sa17223 mutant; eif2b2+/+;β-actin:EIF2B2:2A:eGFP wild-type control; and eif2b2sa17223/sa17223;β-actin:EIF2B2:2A:eGFP mutant. (K) Quantification of TUNEL+ cells.

Work studying cancer cell lines has shown that during periods of hypoxia, ISR activation leads to retention of intron 12 in EIF2B5 by interfering with the exon 12 splice site (Brady et al., 2017Figure 8A). This retained intron contains a premature stop codon, resulting in a truncated 65 kDa EIF2B5 protein, and rendering the eIF2B complex unable to initiate translation. To test whether the ISR in VWM could similarly affect eif2b5 splicing, we tested intron 12 retention. We found an increase in retention of intron 12 associated with truncated eif2b5 in eif2b mutant alleles (eif2b5: zc102 and zc103; eif2b2: sa17223) (Figure 8B); and which was also observed in peripheral lymphocytes from a human VWM patient (Figure 8C).

Zebrafish eif2b5 mutant alleles show intron retention, activated ISR, and role of truncated Eif2b5 in worsening phenotype.

(A) Schematic showing integrated stress response activated intron 12 retention of eif2b5 resulting in premature stop codon and truncated form of EIF2B5. (B) Fold change of eif2b5 intron 12 expression with qRT-PCR in eif2b5zc103/zc103, eif2b5zc102/zc102, and eif2b2sa17223/sa17223 mutants relative to controls. (C) qRT-PCR for intron 12 expression in a VWM patient and their control unaffected father. (D) Control-injected larvae, compared to those injected with truncated eif2b5 construct, shows impaired swimming behavior; distance moved, time spent moving, and velocity, at 5 dpf. (E) qRT-PCR for atf4, bip, chopII, and perk ISR transcripts shows increased expression in eif2b5zc103/zc103, eif2b5zc102/zc102, and eif2b2sa17223/sa17223 mutants. (F) qRT-PCR for ISR transcripts (atf 4, bip, chop II, and perk) shows increased expression following injection of truncated eif2b5 construct.

Figure 8—source data 1

qRT-PCR for intron 12 expression changes (eif2b5, zebrafish).
Figure 8—source data 2

qRT-PCR for intron 12 expression changes (eif2b2, zebrafish).
Figure 8—source data 3

qRT-PCR for intron 12 expression changes (human).
Figure 8—source data 4

Behavior data for truncated eif2b5 effects.
Figure 8—source data 5

qRT-PCR for ISR transcript expression.
Figure 8—source data 6

qRT-PCR for ISR transcript expression changes following injection with truncated eif2b5.

To test the effects of the 65 kDa human EIF2B5 on behavior, we expressed truncated EIF2B5 in wild-type embryos. We injected one-cell stage WT embryos with transcribed RNA and evaluated behavior at 5 dpf. We observed impairment of motor behavior (Figure 8D), suggesting a dominant-negative effect, although we could not exclude that the effect was caused by over-expression. Since in VWM chronic activation of the ISR is believed to contribute to pathophysiology, we examined ISR activation in eif2b5 mutants by analyzing the expression of atf4, bip, chop II, and perk, which are critical regulators of the ISR. qRT-PCR analysis showed atf4, bip, and chop II expression were increased, but perk had variable expression in eif2b2 and eif2b5 homozygous mutants (Figure 8E), indicating that ISR activation is mainly triggered by atf4 up-regulation the in eif2b mutants. Next, we also examined ISR activation in wild-type embryos expressing truncated EIF2B5. qRT-PCR showed that ISR markers including atf4, chop II, bip and perk, were up-regulated (Figure 8F), indicating that truncated EIF2B5 was sufficient to activate the ISR.


We have generated and characterized a zebrafish model for VWM by analysis of alleles in eif2b1, 2, 4; and an allelic series in eif2b5. The zebrafish eif2b mutants phenocopy important aspects of human VWM, including increased morbidity and mortality, altered myelination, and impaired motor behavior. Further, using rescue with expression of the human EIF2B2 cDNA, we demonstrate functional conservation in the zebrafish eif2b2 mutant. The mutations we have generated are not specifically homologous to known human VWM patient disease alleles. For therapeutic tests and similar studies future work will benefit from having zebrafish mutants that are homologous to known disease alleles. However, the range of phenotypes in our zebrafish mutants, from lethality in the first several weeks of life, to viability and fecundity, provide an opportunity to further study genotype-phenotype relationships in VWM, which have been noted in patients (van der Lei et al., 2010).

Importantly, our data reveals a novel potential mechanism of VWM pathophysiology: ISR activation in the eif2b mutants causes abnormal splicing and generation of a truncated eif2b5 transcript, which is capable of further activating the ISR and impairing motor behavior. Thus, in healthy individuals, stress would activate the ISR but would appropriately be terminated through down-regulation of the ISR by dephosphorylation of eIF2 (Pakos-Zebrucka et al., 2016). But in VWM patients, stress would activate the ISR, and would also lead to expression of truncated EIF2B5 expression; which would cause a feed-forward mechanism of further and chronic ISR activation (Figure 9). This chronic activation of the ISR is observed in human autopsy samples and in a mouse VWM model (van der Voorn et al., 2005; van Kollenburg et al., 2006; Wong et al., 2019).

Feed-forward effect of truncated EIF2B5.

(A–C) Under normal conditions, stress leads to activation of the ISR, which is terminated by dephosphorylation of eIF2a by PP1 (protein phosphatase one complex) and resumption of normal cap-dependent translation. (A’–C’) In the presence of eif2b subunit mutations in VWM, normal translation is impaired, and there is activation of the ISR above baseline (A’). In response to stress, there is ISR activation and expression of truncated EIF2B5, which leads to chronic activation of the ISR and an inability to terminate the ISR.

The eIF2B complex is comprised of five subunits that together act as the guanine nucleotide exchange factor for eIF2, governing the rate of global protein synthesis and cap-dependent translation initiation. VWM can be caused by autosomal recessive mutations in any of the five subunits of eIF2B. Zebrafish show expression of the eif2b genes at 24 hpf through 7 dpf including in the CNS. Mutations in the most commonly affected patient subunits, eif2b2 and eif2b5, showed growth deficits and decreased survival, mimicking clinical features of VWM. Interestingly, we found that human EIF2B2 expression in zebrafish can rescue the increased apoptosis and early lethality phenotype of eif2b2 sa17223 homozygous mutants, but not human EIF2B5. The difference between the EIF2B2 and EIF2B5 rescues might be due to the fact that EIF2B5 is the key catalytic subunit of the eIF2B complex for the eIF2•GDP to eIF2•GTP transition, which enhances protein translation. In contrast, expression of human EIF2B5 in zebrafish was lethal, consistent with data showing that stoichiometry of the EIF2B5 subunit (ε) expression is critical (Wortham et al., 2016). Taken together, our work suggests conservation of eif2b expression and function.

Mutations in the zebrafish eIF2B complex were associated with multiple defects in development of the CNS. In the 5 dpf homozygous mutants of eif2b2sa17223, eif2b5zc102, and eif2b5zc103 alleles, there was an increase in apoptosis in the CNS. We also observed altered patterns of cell proliferation pattern in the CNS, and a decrease in overall CNS proliferation in the eif2b2sa17223 mutants. Although there was no change in total OPC numbers in the CNS, we found an increase in the number of OPCs undergoing apoptosis in the hindbrain. We also observed effects on myelination, marked by an apparent decrease in thickness of the myelin sheath, abnormal patterning of myelinated axon tracts in the optic tectum, and abnormal intensity of white matter regions on MRI. However, because mutants can have a decrease in axon diameter, we cannot conclude definitively that myelin sheath thickness is decreased (for example, see Klingseisen et al., 2019). To fully investigate whether the zebrafish VWM mutants have a decreased G-ratio (decreased myelin sheath thickness), future studies should analyze this by binning results by axon diameter.

Since a hallmark of VWM is that disease progression can be precipitated by stressors, we tested the ISR and the response to stress in the eif2b mutants. We noted that while stress of wild-type zebrafish caused motor deficits, stress in the mutant eif2b zebrafish (including heat shock, hypoxia, or thapsigargin) did not worsen further worsen their already impaired motor behavior (data not shown). This suggests that the eif2b mutant zebrafish are already ‘maximally’ stressed at baseline, consistent with the observed activation of the ISR at baseline, and the finding of increased intron 12 retention. ISR induces expression of transcription factors including ATF4 (Harding et al., 2000; Watatani et al., 2008). ATF4 and other components of the ISR trigger a stress-induced transcriptional program that promotes cell survival during mild or acute conditions, but which causes pathological changes under severe or chronic insults (Pakos-Zebrucka et al., 2016).

A poorly understood aspect of VWM is why a minor stressor can precipitate significant white matter loss and neurological deterioration. Our work suggests that this is caused by a feed-forward effect of chronic ISR that cannot be terminated. This occurs by alternative splicing and retention of intron 12 in EIF2B5 leading to a premature stop codon and expression of a truncated EIF2B5. This was first observed in cancer cell lines in response to hypoxia (Brady et al., 2017). The truncated EIF2B5 permits formation of the eIF2B complex and a partial catalytic domain, but is missing the eIF2α interaction domain. This would result in impaired translation mechanism and a decrease in protein synthesis (Adomavicius et al., 2019). We demonstrated the pathological role of truncated EIF2B5 in VWM disease by showing that truncated eif2b5 is expressed in VWM mutants, and that expression of the truncated EIF2B5 impairs motor function, and itself leads to further activation of the ISR.

Major advances in the past several years have shown that a small molecule stabilizing the decameric eIF2B complex (ISRIB - ISR InhiBitor) can boost the GEF activity of wild-type and VWM mutant eIF2B complexes (Tsai et al., 2018; Wong et al., 2018) and can inhibit the ISR in mice bearing an Eif2b5R132H/R132H VWM mutation (Wong et al., 2019). However, it is not clear whether ISRIB or other drugs targeting eIF2B complex stability will be sufficient to prevent stress-induced ISR chronic, feed-forward activation. Therapies for VWM may need a combinatorial approach incorporating eIF2B stabilization at baseline; and prevention of stress-induced truncated eIF2B5 expression.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
(Danio rerio)
eif2b1D. rerio genome resourceGRCz11: ENSDARG00000091402
(D. rerio)
eif2b2D. rerio genome resourceGRCz11: ENSDARG00000041397
(D. rerio)
eif2b3D. rerio genome resourceGRCz11: ENSDARG00000018106
(D. rerio)
eif2b4D. rerio genome resourceGRCz11: ENSDARG00000014004
(D. rerio)
eif2b5D. rerio genome resourceGRCz11: ENSDARG00000074995
(D. rerio)
apoebD. rerio genome resourceGRCz11: ENSDARG00000040295
(Homo sapiens)
EIF2B2H. sapiens genome resourceGRCh38.p13: ENSG00000119718
(H. sapiens)
EIF2B5H. sapiens genome resourceGRCh38.p13: ENSG00000145191
Genetic reagent (D. rerio)eif2b1sa12357Zebrafish International Resource Center (ZIRC)ZIRC Catalog ID: ZL8971.02; RRID:ZIRC_ZL8971.02
Genetic reagent (D. rerio)eif2b2sa17223Zebrafish International Resource Center (ZIRC)ZIRC Catalog ID: ZL10609.15;
Genetic reagent (D. rerio)eif2b4sa17367Zebrafish International Resource Center (ZIRC)ZIRC Catalog ID: ZL10621.10; RRID:ZIRC_ZL10621.10
Genetic reagent (D. rerio)eif2b5zc102This paper- generated and described in Materials and methods.
Genetic reagent (D. rerio)eif2b5zc103This paper- generated and described in Materials and methods.
Genetic reagent (D. rerio)Tg (ß-actin:EIF2B2-2A-eGFP)This paper- generated and described in Materials and methods.
Genetic reagent (D. rerio)Tg(olig2:dsRed)vu19It is available from EZRC and China ZRCZFIN ID:ZDB-ALT-080321–2
Antibodyanti-acetylated tubulin (mouse monoclonal)SigmaSigma:
AntibodyAnti-GFP (mouse monoclonal)MilliporeMillipore:
AntibodyAnti-GFP (mouse polyclonal)Aves LabsAves Labs : GFP-1020; RRID:AB_10000240(1:1000)
AntibodyAnti-HuC/D (mouse monoclonal)Thermo Fisher ScientificThermo Fisher Scientific: A-21271; RRID:AB_221448(1:400)
AntibodyAnti-dsRedTakaraClontech: 632496; RRID:AB_10013483(1:250)
AntibodyCy-3 anti-rabbit (goat polyclonal)MilliporeMillipore: AP132C; RRID:AB_92489(1:400)
AntibodyAlexa 488 donkey anti-mouse (donkey polyclonal)Thermo Fisher ScientificMolecular Probes: A-21202; RRID:AB_141607(1:400)
AntibodyAlexa 633 donkey anti-rabbit (donkey polyclonal)Thermo Fisher ScientificMolecular Probes: A-21070;
AntibodyAlexa 488 goat anti-chicken (goat polyclonal)Thermo Fisher ScientificMolecular Probes: A-11039;
AntibodyAlexa 555 rabbit anti-goat (rabbit polyclonal)Thermo Fisher ScientificMolecular Probes: A-21431; RRID:AB_2535852(1:400)
Peptide, recombinant proteinGateway BP Clonase II enzyme mixThermo Fisher ScientificThermo Fisher Scientific: 11789020
Peptide, recombinant proteinGateway LR Clonase II enzyme mixThermo Fisher ScientificThermo Fisher Scientific: 11701020
Strain, strain background (Escherichia coli)10-betaNew England BioLabsNEB: C3019H
Strain, strain background (Human cancer cell line)SH-SY5YGift from the Pulst labRRID:CVCL_0019
Recombinant DNA reagentpCR4.0-TOPOThermo Fisher ScientificThermo Fisher Scientific: 450030, cat #
Recombinant DNA reagentpDONR P4-P1RTol2
Recombinant DNA reagentpDONR 221Tol2
Recombinant DNA reagentpDONR P2R-P3Tol2
Recombinant DNA reagentTg (ß-actin:EIF2B2-2A-eGFP)This paper- generated and described in Materials and methods.
Recombinant DNA reagentTg (ß-actin:EIF2B5-2A-eGFP)This paper- generated and described in Materials and methods.
Recombinant DNA reagentpCS2+-TransposaseThis paper- generated and described in Materials and methods.
Transfected construct (Human)Tg (ß-actin:EIF2B2-2A-eGFP)This paper- generated and described in Materials and methods.
Biological sample (Human)Human patient sample (serum)This paper- generated and described in Materials and methods.
Commercial assay or kitDIG RNA Labeling Kit (SP6/T7)RocheRoche: 11175025910
Commercial assay or kitApopTag-fluoresceinMilliporeMillipore: S7111
Commercial assay or kitApopTag-RedMilliporeMillipore: S7165
Commercial assay or kitImmPACT (TM) VECTOR (R) RED AP SubstrateVector LaboratoriesVector Laboratories: SK-5105
Commercial assay or kitBlack Gold II kitMilliporeMillipore: AG105
Chemical compound, drugApplied Biosystems PowerUp SYBR Green Master MixThermo Fisher ScientificThermo Fisher Scientific: A25776
Software, algorithmMATLABMathworksVersion
Software, algorithmEthoVision-XT softwareNoldus
Software, algorithmGraphPad Prism softwareGraphPad Prism ( 8.4.3
Software, algorithmImageJ softwareImageJ (
OtherDAPI stainSigmaD9542(1 µg/mL)
OtherZEG and ZEG chipswFluidx, Inc

Fish stocks and embryo raising

Request a detailed protocol

Adult fish were bred according to standard methods. Embryos were raised at 28.5°C in E3 embryo medium and staged by time and morphology. For in situ staining and immunohistochemistry, embryos were fixed in 4% paraformaldehyde (PFA) in 1xPBS overnight (O/N) at 4°C, washed briefly in 1xPBS with 0.1% Tween-20, serially dehydrated, and stored in 100% MeOH at −20°C until use. Transgenic fish line and allele used in this paper was the following: Tg(olig2:dsRed)vu19 (Kucenas et al., 2008). eif2B Sequence Analysis.

Human and zebrafish eif2b1, eif2b2, eif2b3, eif2b4 and eif2b5 subunit genes amino acid sequences were compared using Clustal Omega (Sievers et al., 2011) and aligned using PRALINE (Simossis and Heringa, 2005); phylogenetic tree analysis was performed with Phylodendron.

Zebrafish eif2b mutant lines obtained from Sanger zebrafish mutation project

Request a detailed protocol

We obtained the eif2b1sa12357, eif2b2sa17223, and eif2b4sa17367 alleles generated by the Sanger Zebrafish Mutation Project per our request and established these lines as viable stock at our facility. The eif2b1sa12357 allele results in a T > A nonsense mutation resulting in an early stop in exon 8. The eif2b2sa17223 and eif2b4sa17367 alleles have mutations in an essential splice site predicted to interrupt splicing from exon 5 to 6 of eif2b2 by a G > A mutation at the end of exon 5 (744 nt), and from exon 12 to 13 in eif2b4 by a G > A mutation at the end of exon 12 (1404 nt).

eif2b5 CRISPR sgRNA construction and injection

Request a detailed protocol

Targeting the D. rerio eif2b5 gene (Ensembl Zv10: ENSDART00000110416.4) for CRISPR mutagenesis was performed by the University of Utah Mutation Generation and Detection Core. We designed sgRNA target sites by looking for sequences corresponding to N18GG on the sense or antisense strand of the DNA using the CRISPR design program at Off-target effects were checked through the use of NIH BLAST tool applied to the zebrafish genome (zv10). Off-target sequences that had significant matches of the final 23 nt of the target and NGG PAM sequence were discarded.

sgRNAs targeting exon 1 (eif2b5-ex1) were transcribed using DraI-digested gRNA expression vectors as templates, and the HiScribe T7 RNA Synthesis kit (New England BioLabs) followed by RNA purification with Micro Bio-spin six columns (BioRad).

To maximize mutagenesis and minimize lethality, an eif2b5-ex1 sgRNA dose curve was performed. A mix of eif2b5-ex1 sgRNA (between 250 pg-600 pg) and Cas9 protein (600 pg, Integrated DNA Technologies) were injected into one-cell stage embryos, as previously described. CRISPR efficiency was evaluated on individual 24 hpf injected embryos after DNA extraction, PCR amplification of the target locus, and HRMA analysis. An eif2b5-ex1 sgRNA dose of 450 pg resulted in >90% mutagenesis in 24 hpf embryos, assayed by HRMA, with no difference in survivability compared to uninjected controls. Embryos used for injection were derived from wild-type AB parents, previously confirmed at the eif2b5 locus to have exact homology for the sgRNA sequence.


Request a detailed protocol

DNA was extracted from embryos (24 hpf-72 hpf), or fin clips from adults, into 50 mM NaOH, and incubated at 95 °C for 20 min, followed by neutralization with 1M Tris pH 8.0 (1:10 by volume) as previously described (Xing et al., 2014). Oligonucleotides were designed using Primer3 to give 60–100 nucleotide products spanning the CRISPR cleavage site, and tested in silico using uMELT to determine PCR products with optimal thermodynamic profiles. PCR was performed using LightScanner Master Mix System (BioFire) in 10 μl reactions as previously described (Xing et al., 2014). Thermal melt profiles were collected on a LightScanner (Idaho Technology) (65–98°C, hold 62°C) and analyzed with LightScanner Software.

Genotyping was performed by PCR and high-resolution melt analysis (HRMA), using the LightScanner Master Mix system. For eif2b5 alleles with mutations in exon 1, we used the following primers and conditions: (eif2b5 forward primer) 5’- AAGCCGGTGTCGGATAAAGAT-3’ and (eif2b5 reverse primer) 5’- AAACCTGCGGTTGAAACTGTC-3’; 95 °C for 2 min, followed by 29 cycles of 94 °C for 30 s, and 60 °C for 30 s, followed by a final denaturation and annealing step of 95 °C for 30 s, and 25 °C for 30 s. For eif2b2sa17223 genotyping we did PCR with the following primers and conditions: (eif2b2 forward primer) 5’- TAATGTCACGAGTCAATAAG-3’ and (eif2b2 reverse primer) 5’-AGGATTAATCTTTTATTTCA-3’; 95 °C for 2 min, followed by 29 cycles of 94 °C for 30 s, and 60 °C for 30 s, followed by a final denaturation and annealing step of 95 °C for 30 s, and 25 °C for 30 s. For eif2b4sa17367 genotyping we did PCR with the following primers and conditions (eif2b4 forward primer) 5’-TTGAGCATCAAAAGGGTTATTG −3’ and (eif2b4 reverse primer) 5’-CGGACTCTTTTGTATCCAATG −3’; 95 °C for 2 min, followed by 29 cycles of 94 °C for 30 s, and 55 °C for 30 s, followed by a final denaturation and annealing step of 95 °C for 30 s, and 25 °C for 30 s. All PCR was run in an optically transparent plate with 25 μl mineral oil overlay. We then performed HRMA to differentiate the eif2b melt-curves from their corresponding controls.

For eif2b1sa12357 genotyping, HRMA analysis was not able to reliably identify mutant versus wild-type alleles. We therefore used the restriction endonuclease sequence Hpy188I (taTCAGAtg) present in the wild-type allele of eif2b1, but not in the eif2b1sa12357 mutant allele (taACAGAtg) to create a restriction fragment length polymorphism (RFLP) for genotyping. We first performed PCR of the target locus (667 bp) in a 10 μl reaction, with the following primers and conditions (eif2b1 forward primer) 5’- GGAGACGTAAAATGTACCTGCAAT-3’ and (eif2b1 reverse primer) 5’-CACCCCAACCATCACAGGAG-3’; 98 °C for 1 m, followed by 34 cycles of 98 °C for 10 s, 58 °C for 15 s, and 72 for 25 s, followed by a final extension step of 72 °C for 10 m. Following PCR, the entire 10 μl reaction was digested with Hpy188I in a 15 μl reaction for 2 hr at 37 °C. The digest was then run out on a 2.5% agarose gel. Animals homozygous for eif2b1sa12357/sa12357 produced a 623 bp mutant band, and a 44 bp band unrelated to the eif2b1sa12357 allele, used as an internal control for the restriction digest. Wild-type animals, harboring the non-mutated Hpy188I restriction site, generate a 404 bp and 219 bp band, specific to the wild-type allele, as well as the 44 bp internal control band; heterozygous animals generate all four bands after Hpy188I digestion: mutant 623 bp, wild-type 404 bp and 219 bp, and the internal digest control band 44 bp.

Chip genotyping

Request a detailed protocol

Survival genotyping of 72 hpf zebrafish was performed as previously described (Lambert et al., 2018). Briefly, embryos were loaded individually onto genotyping wells of a ZEG chip (wFluidx, Inc) in 12 μl of E3 with a wide bore pipette tip. Once embryos are loaded, the ZEG chip was placed on the vibration unit, covered with the lid and vibrated for 7.5 min at 1.4 volts, 0.026 amps and 0.03 watts. After the samples are vibrated, 10 μl of E3 is removed from the well into a PCR strip tube. The corresponding embryo is removed from the chip well with a transfer pipette and a small amount of E3, into a 96 square well plate (650 μl/well) until after genotyping. For genotyping PCR, 5 μl of E3 is removed from each well is used directly in the PCR without further cell lysis steps.

Cloning and characterization of zebrafish eif2b5 CRISPR mutants eif2b5-ex1 CRISPR injected F0 embryos were raised and crossed to non-mutagenized wild-type AB siblings. eif2b5 F1 founder offspring were then raised to adulthood, fin-clipped for DNA extraction and PCR amplification of the target locus, using the above described HRMA primers for eif2b5. Individual fish identified as potential mutants by HRMA were further confirmed by Topo-TA cloning (Thermo Fisher Scientific) of the target locus, and Sanger sequencing four clones per animal. To ensure that we did not miss larger mutations at the CRISPR mutagenesis site, PCR amplification of a larger region surrounding the target locus (517 bp) was performed using the following primers and PCR conditions: (eif2b5 forward sequencing primer) 5’- AGCTACCTCAACAGGGCGTA-3’, and (eif2b5 reverse sequencing primer) 5’- CGTCCAAAAACAAAACAGCA-3’; 98 °C for 1 m, followed by 34 cycles of 98 °C for 10 s, 60 °C for 15 s, and 72 for 20 s, followed by a final extension step of 72 °C for 10 m.

Cloning of human EIF2B2 and EIF2B5

Request a detailed protocol

Human EIF2B2 and EIF2B5 were amplified from cDNA prepared from SH-SY5Y human cell line. The following primers, and PCR conditions were used to amplify EIF2B2 for cloning into a middle entry clone Gateway-compatible vector (EIF2B2 forward primer contains: 31 nt attB1F sequence, a nine nt zebrafish optimized Kozak sequence, and 20 nt region of EIF2B2 beginning at the ATG) 5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTACGCCGCCACCATGCCGGGATCCGCAGCGAA-3’, and (EIF2B2 reverse primer contains: 30 nt attB2R sequence, and a 20 nt region of the 3’ EIF2B2 that does not contain the stop codon) 5’- GGGGACCACTTTGTACAAGAAAGCTGGGTCTAAAACATGATCATCAGGAT-3’; PCR conditions: 98 °C for 1 m, followed by 34 cycles of 98 °C for 10 s, 68 °C for 15 s, and 72 for 30 s, followed by a final extension step of 72 °C for 10 m. The following primers, and PCR conditions were used to amplify EIF2B5 for Gateway cloning (EIF2B5 forward primer contains: 31 nt attB1F sequence to allow for Gateway pME cloning, a nine nt zebrafish optimized Kozak sequence, and a 20 nt region of EIF2B5 beginning at the ATG) 5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTACGCCGCCACCATGGCGGCCCCTGTAGTGGC-3’, and (EIF2B5 Reverse primer contains: 30 nt attB2R sequence to allow for Gateway pME cloning, and a 20 nt region of the 3’ EIF2B5 that does not contain the stop codon) 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGTCATCTTCAGATGACT-3’; PCR conditions: 98 °C for 1 m, followed by 34 cycles of 98 °C for 10 s, 68 °C for 15 s, and 72 for 75 s, followed by a final extension step of 72 °C for 10 m.

The attB containing EIF2B PCR product were combined with a donor vector (pDonor #221) in a BP recombination reaction to generate Gateway middle clones, pME EIF2B2 and pME EIF2B5. These plasmids were then diagnostically digested and sequenced to confirm the correct cloning. Expression clones were assembled using the Tol2 kit and recombination reactions with Gateway plasmids. For expression and visualization of human EIF2B5 (pME EIF2B5) in the zebrafish we used the ubiquitous Beta actin enhancer containing a minimal core promoter (mcp) encoding the viral E1b TATA box fused to the carp b-actin 5’ UTR (p5E Beta actin) and the viral 2A bicistronic eGFP fluorescent tag (p3E 2A:eGFP) assembled into the pDestTol2pA2 plasmid.


Request a detailed protocol

Immunohistochemistry was performed as previously described (Bonkowsky et al., 2008). Antibodies used were: mouse anti-acetylated tubulin 1:250 (Sigma), mouse monoclonal anti-GFP 1:250 (Millipore), chicken anti-GFP 1:1000 (Aves Labs), mouse anti-HuC/D 1:400 (ThermoFisher), rabbit anti-dsRed 1:250 (Clontech), Cy-3 anti-rabbit 1:400 (Millipore), Alexa 488 donkey anti-mouse 1:400, Alexa 633 donkey anti-rabbit, Alexa 488 donkey anti-chicken 1:400, Alexa 555 rabbit anti-goat 1:400 (ThermoFisher), and 4',6-diamidino-2-phenylindole (DAPI).

In situ hybridization

Request a detailed protocol

The antisense digoxigenin-labeled cRNA probes for zebrafish eif2b1-5 and apoeb were prepared by using a clone-free method, as previously described (Thisse and Thisse, 2008). Forward and reverse primers were generated using Primer3 to generate a PCR product between 800 and 950 nt. The following primers were used: eif2b1 forward in situ primer 5’- CGTTGCATCAGCGACACTAT-3’, eif2b1 reverse in situ primer 5’-GAAATGCTTTATAAACAGCAATAATCA-3’; eif2b2 forward in situ primer 5’- CGCAGGTGAACTGATGGAG-3’, eif2b2 reverse in situ primer 5’-GATGTTTTGAATGCCAGACG-3’; eif2b3 forward in situ primer 5’-GAGAACAGCGGGACTTTGTC-3’, eif2b3 reverse in situ primer 5’-TTCGTCTTCAGGCCTGTTCT-3’,; eif2b4 forward in situ primer 5’-GGATCCAATGCTCGATCTGT-3’, eif2b4 reverse in situ primer 5’- GAGGGAAGTGTGTGCATCTG-3’; eif2b5 forward in situ primer 5’- TGGTGGTGGGTCCAGATATT-3’, eif2b5 reverse in situ primer 5’- CAGCCCGTTGTATTTTCCAG-3’; apoeb forward in situ primer 5’- ATGAGGTCTCTTGTGGTATTCTTTGCTC-3’, apoeb reverse in situ primer 5’- TTAAGCCTGAGTGGGAAGAGCTGCTG-3’. To generate a PCR product for antisense probe generation, the reverse primer also contains a 32 nt sequence containing; a 9 nt 5’ spacer sequence, a 17 nt T7 polymerase sequence, and a 6 nt 3’ spacer (5’-CCAAGCTTCTAATACGACTCACTATAGGGAGA −3’), resulting in a PCR product <1 kb. The constructs of olig1 and mag riboprobes are kindly provided by Yi-Chuan Cheng. Synthesis of digoxigenin-labeled antisense RNA probes were synthesized using a DIG RNA Labeling Kit (SP6/T7; Roche).

Microscopy and image analysis

Request a detailed protocol

Immunostained embryos were transferred step-wise into 80% glycerol/20% PBST, mounted on a glass slide with a #0 coverslip, and imaged on a confocal microscope. Confocal stacks were projected in ImageJ, and images composed with Adobe Photoshop and Illustrator.

TUNEL quantification

Request a detailed protocol

Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) was performed on whole-mount larvae (ApopTag-Fluorescein In Situ Apoptosis Detection Kit; Millipore) as previously described (Lambert et al., 2012). Confocal imaging was performed and images were rendered in ImageJ by compiling a max sum projection of 100 μm (step size 2.5 μm) into a single z-stack image, for cell counting using Photoshop’s (Adobe) count tool.

RNA isolation and cDNA synthesis

Request a detailed protocol

RNA was isolated from between 50–100 embryos per sample, depending on age. Each sample was suspended in 900 μl Trizol Reagent (Invitrogen), triturated with a 25-gauge needle until homogeneous; 270 μl chloroform was added and the sample was centrifuged for 15 m at 4 °C. The aqueous solution was moved to a new tube, an equal volume isopropanol (approximately 500 μl) was added, and 5 μl Glycoblue (Invitrogen) added, followed by centrifugation for 15 m at 4 °C. The pellet was washed in 70% ethanol, centrifuged for 10 m at 4 °C, and resuspended in 44 μl DEPC H2O. To remove DNA, 5 μl DNase I buffer and 1 μl Turbo DNase (Invitrogen) was added to each sample and incubate for 15 m at 25 °C. The volume was brought to 400 μl with DEPC H2O, and an equal volume phenol:chloroform was added, mixed, and centrifuged for 15 m at 4 °C. The aqueous phase was transferred to a new tube and 1.5 μl Glycoblue was added, 1/10 vol 3M NaOAc added, and 2.5x of the total volume of 100% ethanol was added. The sample was allowed to precipitate overnight at −20 °C. The sample was then centrifuged for 15 m at 4 °C, supernatant removed, and the pellet washed in 70% ethanol. This was followed by a final centrifugation step of 15 m at 4 °C, supernatant removed, and the RNA resuspended in 15 μl DEPC H2O.

First-strand cDNA was made from 1 to 5 μg total RNA using the SuperScript III First-Strand Synthesis System (Applied Biosystems) per manufacturer’s instructions.


Request a detailed protocol

All qRT-PCR reactions were performed using SYBR Green PCR master mix (Invitrogen) and 2 μl cDNA with the following conditions: 50 °C for 2 min, 95 for 10 min followed by 39 cycles of 95 °C for 20 s, 60 °C for 20 s, and 72 for 20 s, followed by a final melt curve step that ramps in temperature between 60°C and 95°C.

Behavior analysis

Request a detailed protocol

Larval behavior analysis was performed on 7 dpf larvae in 96-well square bottom plates (Krackeler Scientific) using video analysis software (Noldus EthoVision). For spontaneous behavior, animals were transferred at 6 dpf to the 96-well plate and kept at 28.5 °C overnight. At 7 dpf the plate was placed on the video imaging system and animals were allowed to adapt in the dark for 10 min, and then recording was performed for 5 m (1 min dark and 4 min light).


Request a detailed protocol

Following fixation overnight at 4 °C (in 2.5% glutaraldehyde; 1% PFA in 0.1M sodium cacodylate, 8 mM CaCl2, 2.4% sucrose; pH 7.4), then processed and embedded in plastic as follows: rinsed 2 X ten minutes in 0.1M sodium cacodylate buffer containing 2.4% sucrose and 8 mM CaCl2. Tissue was then post-fixed in 2% osmium tetroxide in a 0.1M sodium cacodylate buffer for 1 hr at room temperature, followed by a rinse for 5 min in water filtered through a 0.22 μm millipore filter. Staining was performed en bloc for 1 hr at room temperature with saturated aqueous uranyl acetate, that was filtered through a 0.22 μm millipore filter. Samples were dehydrated through a graded series of ethanol, 10 min at each step at room temperature.

Tissue was then transitioned through three changes of absolute acetone, 10 min each, followed by infiltration with with increasing concentrations of plastic (Embed 812) as follows: 1 hr, Plastic:Acetone 1:1; overnight, Plastic:Acetone 3:1, done at room temperature. Final plastic infiltration was carried out the following day by changing the plastic three times, then placing tissue vials on a rotator for 1 hr and then under vacuum for 1 hr. After the third change tissue was embedded in a fresh plastic in mold with appropriate labels and placed in 60–70°C oven overnight. Once the plastic was cured the samples were thick sectioned (0.5–1.0 um) and placed on glass slides; stained with 1% Toluidine Blue-O in 1% borax on a hot plate. Tissue was sectioned with a diamond knife on a Leica EMUC6 ultramicrotome, picked up on 150 mesh copper grids and contrasted sequentially with saturated aqueous uranyl acetate followed by staining with Reynold's lead citrate. Sections were examined on a JEOL 1400+ electron microscope.


Request a detailed protocol

The brains of wild-type (n = 6; 7-months old) and eif2b5zc103 fish (n = 6; 5.5-months old) were dissected leaving the skull, a small piece of the spinal cord, and a small amount of fat tissue surrounding the brain intact. They were placed in 4% paraformaldehyde and 0.5% magnevist (gadopentetate dimeglumine) overnight at 4 °C on a nutator.

MR imaging was performed with a 1.0 cm diameter loop-gap radiofrequency transmitter-receiver and a preclinical 7T MRI scanner (Bruker Biospec) with the microimaging gradient set (1100mTm−1, BGA-6, Bruker). Two primary scans were done to map the T1 and T2 behavior of the tissue. These scans were 3D turbo spin-echo scans (Rapid Acquisition with Refocused Echoes, RARE), specialized with varying repetition time (TR) or echo time (TE) to optimize T1 and T2 contrast. The T1 map scan utilized the following parameters: T1 weighted RARE: TR = [50, 150, 275, 450, 600]ms, TE = 12 ms, four averages, RARE factor = 2, matrix size = 305×140 x 165, spatial resolution = 0.036 mm isotropic, field of view: 110 x 50 x 60 mm. T2 weighted RARE: TR = 500 ms, TE = [12.2, 36.6, 60.94]ms, nine averages, RARE factor = 2, matrix size = 305 × 140 x 165, spatial resolution = 0.036 mm isotropic, field of view: 110 x 50 x 60 mm. Six zebrafish skulls were scanned in wild-type/mutant pairs in the custom coil.

The raw intensity data was exported from Paravision 5.1 (Bruker BioSpec). This data was imported into MATLAB r2017b (Mathworks, Natick MA), and reshaped into two sets of 3D volumes. For the T1 weighted scan, each volume was representative of an individual TR. For the T2 weighted scans, each volume was representative of a different TE. With this, a gradient descent algorithm could be applied to the intensity vs TR, TE curve of each pixel, for the T1, T2 volumes respectively. General parameters were T1: Initial constants: M0 = 8000, T1 = 150, Loop limit = 75000, learning rate = 0.000001. Equation: S=M0(1eTR/T1) T2: Initial constants: M0 = 8000, T2 = 75, Loop limit = 75000, learning rate = 0.000001. Equation: S=M0eTE/T2.

Sub-millimeter movement was witnessed between the T1 experiments, which caused pixel intensities to not properly fit to the T1 equation, and blurred in the averaged image. This was corrected for with simple 2D rigid body transformations between TR experiments, using the MATLAB r2017b ‘affine2d’ function. A transformation matrix was generated for a single representative slice, then applied to all slices within the volume. This transformation was applied to each T1 experiment of a given set and were averaged into a single volume.

Transformation matrices were generated with landmark based analysis. Three primary landmarks were utilized to build the transformation: the center of the lens of each eye and the tip of the vagal lobe. The repetitions were averaged and fitted with the gradient descent algorithm detailed above. This resulted in two volumes of T1 and T2 values for each scan pair. The skull pair was separated into two distinct volumes for each T1, T2 map, and rotated into the anatomical planes for visualization.

Analysis of the T1 and T2 maps involved a two-step process of quantifying overall brain volume, and determining the T1 and T2 values for white matter regions of interest (ROI). To begin, four representative measurements were taken for each wild-type and mutant pair. Measurements taken were the length from the tip of olfactory bulb to end of the tectum, the maximum width of the optic tectum, and the maximum height of brain at center ventricle. These measurements were normalized to the width of the specimen’s skull.

To measure the intensity of white matter regions in the T2 images, a 2 × 2 pixel region was taken from the periventricular grey zone and normalized to a 2 × 2 pixel region in the optic tectum from a slice at the end of the rhombencephalic ventricle (RV) of midbrain. Two more slices were measured moving rostrally from the RV.

Black/gold staining

Request a detailed protocol

Adult brains were dissected, fixed overnight in 4% PFA, then incubated 1 hr in 5% sucrose in PBS, overnight in 15% sucrose in PBS, and overnight in 30% sucrose in PBS, prior to embedding in OCT. Tissues were sectioned at 30 μm at −20 °C in the cryostat and mounted on positively charged slides.

Black gold II powder (Millipore) was resuspended in 0.9% NaCl to a final concentration of 0.3% and preheated to 60°C along with 1% sodium thiosulfate. Tissue sections were brought to room temperature for 5 min, then post-fixed in 10% formalin for 1 hr. Slides were incubated at 60°C in the pre-warmed Black Gold II solution for 15 min. Slides were rinsed 1X in tap water for 2 min, then incubated in sodium thiosulfate solution (1%) for 3 min at 60°C. After another tap water rinse, slides were dehydrated to 100% EtOH, incubated in 50:50 Hemo-De:EtOH for 3 min, and finally in Hemo-De for 3 min prior to mounting in Cytoseal 60.

Statistical analysis and blinding

Request a detailed protocol

Statistical analyses were performed using Prism6 software (GraphPad). Student’s t-test was used for two-way comparisons; comparisons between three or more groups was performed with ANOVA with post-hoc Tukey’s HSD between individual means.

Samples were randomly allocated to control or experimental groups, other than required distribution by genotype (e.g. wild-type embryos were in the wild-type group). Allocation of samples and animals, data collection, and analysis were performed blinded to genotype and/or experimental group.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided for Figures 1, 2, 3, 4, 5, and 6.


    1. van der Knaap MS
    2. Fogli A
    3. Boespflug-Tanguy O
    4. Abbink TEM
    5. Schiffmann R
    Childhood Ataxia with Central Nervous System Hypomyelination / Vanishing White Matter, GeneReviews, Seattle, WA, University of Washington, Seattle.

Decision letter

  1. Richard M White
    Senior Editor; Memorial Sloan Kettering Cancer Center, United States
  2. Beth Stevens
    Reviewing Editor; Boston Children's Hospital, United States
  3. Beth Stevens
    Reviewer; Boston Children's Hospital, United States
  4. Cody J Smith
    Reviewer; University of Notre Dame, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

In this study, Keefe et al., develop and validate a novel zebrafish model to study the mechanisms underlying Vanishing White Matter disease (VWM). They demonstrate that distinct mutations in multiple eIF2B complex subunits recapitulate several features of VWM, including disrupted growth, impaired myelination and motor defects. They show conservation of function by rescuing some of these defects with a human EIF2B2 ortholog. By leveraging this model, the authors show that the integrated stress response (ISR) that is activated in these mutants results in truncation of the eif2b5 subunit transcript. This truncated form is capable of causing motor defects and activating the ISR in wild type mice, suggesting that a feed-forward mechanism drives ISR activation in VWM. These findings address could provide insight regarding how minor stressors can lead to significant clinical deterioration and white matter damage in VWM patients.

Decision letter after peer review:

Thank you for submitting your article "Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Beth Stevens as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Richard White as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Cody J Smith (Reviewer #3).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 ( First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is 'in revision at eLife'. Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)


Mutations in the five subunits of the eukaryotic initiation factor 2B (eIF2B1-5) complex cause a severe leukodystrophy called Vanishing White Matter (VWM) disease. In this study from the Bonkowsky lab, new mutants were either generated or imported and analyzed for CNS defects relevant to VWM. By studying growth, lethality, myelination, CNS cell development, and swimming behavior, the authors conclude that the new eif2b mutants phenocopy VWM patients. The authors also show that in mutants, a retained intron leads to expression of a truncated transcript, which they conclude acts in a dominant-negative fashion and suggest that this explains some pathology in human VWM patients.

Although modeling human disease in model organisms like zebrafish is important, there are several major issues with the study that dampen enthusiasm as outlined below.

Essential revisions:

Significance of Model

1) For most of five the mutations most of them are heterozygous. Here the authors showed that only 2 out of 4 subunit mutants (eif2b5, eif2b2) exhibited phenotypes. Is it possible that other mutant alleles have mild phenotypes, such as increased ISR? More characterization of phenotypes in the other mutants (eif2b1, eif2b4) and the heterozygous siblings is needed to address relevance of this as a model of VWM.

Motor defects

1) It is unconvincing that the movement measurements in eif2b5zc103 mutants represent motor behavior deficits. Please address possible non-specific developmental delays cause the observed phenotypes. Can the authors perform the behavioral experiments at later stages or provide stage matched (rather than age matched) characterizations the mutants?

2) In Figure 6, for the truncated EIF2B5 mis-expression experiments, it is unclear from the text and Materials and methods how the experiments were performed. If the truncated protein acts as a dominant-negative in the e1f2b mutants, why would expression of the wild-type gene rescue the mutant phenotype? The dominant-negative product would still be present. Also, Figure 6D: Compare motor behavior in actin:eif2b vs eif2b5 expression and clarify and address alternative interpretations of the data (See reviewer 3 comments).

Characterization of oligodendrocytes and myelin:

1) Olig2 also labels motor neurons in the spinal cord and neural precursors in the hindbrain. Based on this marker alone it cannot be concluded they are only quantifying oligodendrocyte lineage cells in Figure 3. Please address.

2) Figure 3P-S: the TUNEL staining overlaps with Olig2 in the hindbrain but not in the rest of the brain. Please investigate which other cell types are undergoing apoptosis the optic nerve and optic tectum where the myelination and axon defects are evident in the eif2b5zc103/103 mutants/

3) Figure 3F-I:the eif2b2 and eif2b5 mutants show a striking change in proliferation pattern at 5dpf, including a loss of proliferation in the eyes and cerebellum and increased proliferation in the ventricles. To investigate which cell types are undergoing altered proliferation co-staining for cell-type-specific markers (eg: microglia, astrocytes, neurons) Is needed. See reviewer 1 comments.

4) The electron micrographs in Figure 4 are low quality and cannot be analyzed for G-ratio based on what is shown. Please address.

Reviewer #1:

In the manuscript entitled "Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response", Keefe et al., develop and validate a novel zebrafish model to study the mechanisms underlying Vanishing White Matter disease (VWM). They demonstrate that distinct mutations in multiple eIF2B complex subunits recapitulate several features of VWM, including disrupted growth, impaired myelination and motor defects. Remarkably, they show conservation of function by rescuing these defects with a human EIF2B2 ortholog. By leveraging this model, the authors show that the integrated stress response (ISR) that is activated in these mutants results in truncation of the eif2b5 subunit transcript. This truncated form is capable of causing motor defects and activating the ISR in wild type mice, suggesting that a feed-forward mechanism drives ISR activation in VWM. These findings address a key question in the field regarding how minor stressors can lead to significant clinical deterioration and white matter damage in VWM patients.

Overall, this study presents a potential new model to interrogate VWM pathophysiology and identify therapeutic agents. Below are a few comments that would strengthen the findings.

1) In Figure 3F-I, the eif2b2 and eif2b5 mutants show a striking change in proliferation pattern at 5dpf, including a loss of proliferation in the eyes and cerebellum and increased proliferation in the ventricles. The authors are encouraged to investigate which cell types are undergoing altered proliferation by co-staining for cell-type-specific markers (eg: microglia, astrocytes, neurons). This would further inform the origin of the defects seen in the adult eif2b5zc103/103 mutants.

2) Similarly, in Figure 3P-S, the TUNEL staining overlaps with Olig2 in the hindbrain but not in the rest of the brain. The authors are encouraged to investigate which other cell types are undergoing apoptosis, particularly in the optic nerve and optic tectum where the myelination and axon defects are evident in the eif2b5 zc103/103 mutants.

Reviewer #2:

Mutations in the five subunits of the eukaryotic initiation factor 2B (eIF2B1-5) complex cause a severe leukodystrophy called Vanishing White Matter (VWM) disease. In this study from the Bonkowsky lab, new mutants were either generated or imported and analyzed for CNS defects relevant to VWM. By studying growth, lethality, myelination, CNS cell development, and swimming behavior, the authors conclude that the new eif2b mutants phenocopy VWM patients. The authors also show that in mutants, a retained intron leads to expression of a truncated transcript, which they conclude acts in a dominant-negative fashion and suggest that this explains some pathology in human VWM patients. Although modeling human disease in model organisms like zebrafish is important, there are several issues with the study that dampen enthusiasm.

1) In human patients, mutations in each of the 5 eIF2B subunits can cause VWM, and most of them are heterozygous (van der Knaap et al., 2002). In this study, the authors showed that only 2 out of 4 subunit mutants (eif2b5, eif2b2) exhibited phenotypes. It is possible that other mutant alleles have mild phenotypes, such as increased ISR? Can the authors characterize such phenotypes in the other mutants (eif2b1, eif2b4) and also in the heterozygous siblings?

2) It is unconvincing that the movement measurements in eif2b5zc103 mutants represent motor behavior deficits. The authors point out that these mutants are smaller than wild-type controls and the mutant larvae fail to inflate their swim bladders. Thus, it is also possible that non-specific developmental delays cause the observed phenotypes. Can the authors perform the behavioral experiments at later stages or provide stage matched (rather than age matched) characterizations the mutants?

3) Olig2 also labels motor neurons in the spinal cord and neural precursors in the hindbrain. Thus, the authors cannot conclude they are only quantifying oligodendrocyte lineage cells in Figure 3.

4) The electron micrographs in Figure 4 are low quality and cannot be analyzed for G-ratio based on what is shown. These images look more like toluidine blue stained semi-thick sections than EM sections.

5) In Figure 6, for the truncated EIF2B5 mis-expression experiments, it is unclear from the text and Materials and methods how the experiments were performed. Did the authors generate a stable transgenic line, as for EIF2B2, or it was a transient injection of expressing DNA construct? If it was a transient injection experiment, expression would be mosaic and likely short-term; thus, a motor phenotype is surprising if this was the method.

6) If the truncated protein acts as a dominant-negative in the e1f2b mutants, why would expression of the wild-type gene rescue the mutant phenotype? The dominant-negative product would still be present.

Reviewer #3:

Keefe and Soderholm and Shih et al. present a thorough paper that uses multiple approaches to address how eif2b5 functions in neural development and function. The work nicely evaluated common features of VWM disease and sets foundation for future studies that would dissect mechanistic regulators in VWM. The model and data that is present will be of broad interest to groups studying neural development as well as VWM. The conclusions that are stated in the paper nicely match the data that is presented. Overall, this is a well written and complete story.

In Figure 6D, the impaired motor movement is observed. The authors conclude that it is acting as a dominant negative. However, it could be over expression and not a dominant negative effect. Can the authors compare motor behavior in actin:eif2b vs eif2b5 expression? Alternatively, can the authors add text that demonstrate alternative interpretations of the data.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response" for further consideration by eLife. Your revised article has been evaluated by Richard White (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below. Overall, this manuscript can serve as a useful model for understanding how mutations in eIF2b2 can leading to phenotypes present in VWM and will be a resource for the community. The authors have included several new data panels that help to clarify some of the previous concerns. However, a few issues remain that need to be addressed before publication.

1) A major issue remains in the quality of the electron microscopy to show myelin ultrastructure. As shown, it is unclear how g-ratio could have been calculated from images shown. Please address comments below (reviewer 1) and provide data using high quality EMs images as is standard for the field and important for a manuscript focused on a model of Vanishing White Matter disease.

2) New data in supplemental figures 1 and 2 are critical are important for the main story and should be included in the main figures for the story as written and revised. However, it is difficult to visualize the co-labeling of tunel and ph3 with the noted cell-type markers in those images that influence the quantification of data and results.

3) Please provide clarification and details on the sox10:mrfp transgene used in the study: The authors listed sox10:mrfp as a transgene that they used in the study but it is not clear which figure that transgenic animal was used. Tg(sox10:mrfp) would be a useful tool to validate the OPC phenotype in the spinal cord since sox10 labels OPCs with very different morphology than the subset of neurons that are labeled with that transgene.

Reviewer #2:

The authors were decently responsive to the previous round of critiques. A major issue remains in the quality of the electron microscopy to show myelin ultrastructure. As shown, it is unclear how g-ratio could have been calculated from images shown. Additionally, g-ratio quantifications are usually binned by axon size, which was not performed here and likely cannot be based on the quality of the EMs. The EMs are not publication quality and should not be published. If publication quality EMs cannot be obtained and quantified, the histological analysis of myelin will have to suffice, although this is certainly not ideal for a manuscript focused on a model of Vanishing White Matter disease. In this case, myelin was never formally examined, and the wording throughout the Abstract and manuscript will need to be changed to reflect this.

Reviewer #3:

Overall, this manuscript can serve as a useful model for understanding how mutations in eIF2b2 can leading to phenotypes present in VWM and will be a resource for the community. The authors have provided a point by point rebuttal to the reviewers concern. The authors have also included several new data panels that help to clarify some of the previous concerns. Most of this new data matches the conclusions as written. However, some of new data shown has presented a concern or clarification that should be addressed before publication.

New data in supplemental figures 1 and 2 are critical for the story as written and revised. It is difficult to visualize the co-labeling of tunel and ph3 with the noted cell-type markers in those images. It is not clear how such quantification could be completed, especially with the resolution of in situ hybridization vs immunostaining. As written, these figures are important for the main story and should be included in the main figures. The tunel staining in these new supplementary files is also different than displayed in the main figures. Can the authors provide insets for the labeling demonstrating an example of a co-labeled cell in each of the genotypes.

In an effort for the authors to address a review regarding the specificity of cell death in the spinal cord they used mag as a marker for oligodendrocytes. mag is certainly one marker that could identify an oligodendrocyte. But the mag in situ appears to be present in areas of the PNS without defined myelinating cells. There are also a low number of mag+ cells in the spinal cord of animal at 5 dpf in those images than would be expected for labeling of myelinating cells. Can the authors test that the mag+ cells in the spinal cord are also olig2+ or sox10+ to confirm that the mag labeling is specific.

Author response

Reviewer #1:

In the manuscript entitled "Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response", Keefe et al., develop and validate a novel zebrafish model to study the mechanisms underlying Vanishing White Matter disease (VWM). They demonstrate that distinct mutations in multiple eIF2B complex subunits recapitulate several features of VWM, including disrupted growth, impaired myelination and motor defects. Remarkably, they show conservation of function by rescuing these defects with a human EIF2B2 ortholog. By leveraging this model, the authors show that the integrated stress response (ISR) that is activated in these mutants results in truncation of the eif2b5 subunit transcript. This truncated form is capable of causing motor defects and activating the ISR in wild type mice, suggesting that a feed-forward mechanism drives ISR activation in VWM. These findings address a key question in the field regarding how minor stressors can lead to significant clinical deterioration and white matter damage in VWM patients.

Overall, this study presents a potential new model to interrogate VWM pathophysiology and identify therapeutic agents. Below are a few comments that would strengthen the findings.

1) In Figure 3F-I, the eif2b2 and eif2b5 mutants show a striking change in proliferation pattern at 5dpf, including a loss of proliferation in the eyes and cerebellum and increased proliferation in the ventricles. The authors are encouraged to investigate which cell types are undergoing altered proliferation by co-staining for cell-type-specific markers (eg: microglia, astrocytes, neurons). This would further inform the origin of the defects seen in the adult eif2b5zc103/103 mutants.

We have now examined this and have found that, interestingly, that proliferation was dysregulated across cell types, and affected glia, neurons, and microglia; and also had spatial specificity.

2) Similarly, in Figure 3P-S, the TUNEL staining overlaps with Olig2 in the hindbrain but not in the rest of the brain. The authors are encouraged to investigate which other cell types are undergoing apoptosis, particularly in the optic nerve and optic tectum where the myelination and axon defects are evident in the eif2b5 zc103/103 mutants.

We have now provided new data to address this. We found that the apoptosis only affected glial lineage cells, and only in the midline.

Reviewer #2:

Mutations in the five subunits of the eukaryotic initiation factor 2B (eIF2B1-5) complex cause a severe leukodystrophy called Vanishing White Matter (VWM) disease. In this study from the Bonkowsky lab, new mutants were either generated or imported and analyzed for CNS defects relevant to VWM. By studying growth, lethality, myelination, CNS cell development, and swimming behavior, the authors conclude that the new eif2b mutants phenocopy VWM patients. The authors also show that in mutants, a retained intron leads to expression of a truncated transcript, which they conclude acts in a dominant-negative fashion and suggest that this explains some pathology in human VWM patients. Although modeling human disease in model organisms like zebrafish is important, there are several issues with the study that dampen enthusiasm.

1) In human patients, mutations in each of the 5 eIF2B subunits can cause VWM, and most of them are heterozygous (van der Knaap et al., 2002). In this study, the authors showed that only 2 out of 4 subunit mutants (eif2b5, eif2b2) exhibited phenotypes. It is possible that other mutant alleles have mild phenotypes, such as increased ISR? Can the authors characterize such phenotypes in the other mutants (eif2b1, eif2b4) and also in the heterozygous siblings?

We thank the reviewer for this question. To clarify one point- in VWM, the disease is autosomal recessive.

We have further characterized the mutants with quite extensive experimental additions; including providing heterozygous data; and for the eif2b4 mutant, to demonstrate that our findings are consistent in a different subunit. Unfortunately, our eif2b1 mutant is quite sick, and we have difficulty getting enough offspring to analyze (we are just trying to keep the line alive). We analyzed survival, growth, behavior, and ISR qRT-PCR, and have included this in Figure 2—source data 3-6.

Given that we have 9 different lines, we selectively chose three alleles for the majority of our experiments. Since all four alleles we characterized in-depth showed similar phenotypes, and which is similar to the human disease, we are reassured that the phenotypes we are observed are representative of human disease.

Finally we have been trying very hard to get zebrafish mutants that have the exact same mutation as the human disease, but, in zebrafish generating allele-specific knock-ins is still quite difficult, and we have been pursuing several strategies for several years without success at this point. For future work in VWM disease this will be important, a point we have added to the Discussion. The human allele mutant in zebrafish will be really helpful to understand the degree of ISR, for example.

2) It is unconvincing that the movement measurements in eif2b5zc103 mutants represent motor behavior deficits. The authors point out that these mutants are smaller than wild-type controls and the mutant larvae fail to inflate their swim bladders. Thus, it is also possible that non-specific developmental delays cause the observed phenotypes. Can the authors perform the behavioral experiments at later stages or provide stage matched (rather than age matched) characterizations the mutants?

This is a good point. The phenotypes co-segregate with the mutations, but we do appreciate that the behavioral effects with our data are unable to differentiate a CNS effect, from an effect caused by the size of the animal, etc. The zc103 mutants stay persistently smaller throughout their life span, so stage matching is not a possibility. To clarify a point- the zc103 do have swim bladder (zc102 does not). We discuss this limitation on interpretation of the findings in the text.

3) Olig2 also labels motor neurons in the spinal cord and neural precursors in the hindbrain. Thus, the authors cannot conclude they are only quantifying oligodendrocyte lineage cells in Figure 3.

That is a good point about the Olig2:dsRed transgenic line. We clarify this point, but do also point out that the olig2:dsRed line is specific to OPCs in labeled cells that have migrated dorsally out of the spinal cord.

However, to more conclusively test this issue, we have now down experiments using in situ probes for oligodendrocytes (olig1 and mag), and we confirm that there is an increase in apoptosis of oligodendrocytes.

4) The electron micrographs in Figure 4 are low quality and cannot be analyzed for G-ratio based on what is shown. These images look more like toluidine blue stained semi-thick sections than EM sections.

We have included high resolution images of the TEM sections for Figure 4.

5) In Figure 6, for the truncated EIF2B5 mis-expression experiments, it is unclear from the text and Materials and methods how the experiments were performed. Did the authors generate a stable transgenic line, as for EIF2B2, or it was a transient injection of expressing DNA construct? If it was a transient injection experiment, expression would be mosaic and likely short-term; thus, a motor phenotype is surprising if this was the method.

We apologize that this was unclear- the experiment was performed with transient injection. With transient injections, because of the high copy number of plasmids, it is not infrequent to obtain a strong response, which is sometimes more marked than the response from a stable transgenic line, depending on the enhancer. We have clarified this in the text.

6) If the truncated protein acts as a dominant-negative in the e1f2b mutants, why would expression of the wild-type gene rescue the mutant phenotype? The dominant-negative product would still be present.

The reviewer raises an important point, it is possible that the phenotype observed is related to overexpression, and not from a dominant-negative effect. We have provided clarification in the text.

Reviewer #3:

Keefe and Soderholm and Shih et al. present a thorough paper that uses multiple approaches to address how eif2b5 functions in neural development and function. The work nicely evaluated common features of VWM disease and sets foundation for future studies that would dissect mechanistic regulators in VWM. The model and data that is present will be of broad interest to groups studying neural development as well as VWM. The conclusions that are stated in the paper nicely match the data that is presented. Overall, this is a well written and complete story.

In Figure 6D, the impaired motor movement is observed. The authors conclude that it is acting as a dominant negative. However, it could be over expression and not a dominant negative effect. Can the authors compare motor behavior in actin:eif2b vs eif2b5 expression? Alternatively, can the authors add text that demonstrate alternative interpretations of the data.

This is a good point, and we have revised our text to match the alternative potential explanation.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

1) A major issue remains in the quality of the electron microscopy to show myelin ultrastructure. As shown, it is unclear how g-ratio could have been calculated from images shown. Please address comments below (reviewer 1) and provide data using high quality EMs images as is standard for the field and important for a manuscript focused on a model of Vanishing White Matter disease.

We have provided images that are at higher magnification, that were used for the quantification and the g-ratio calculations. We have included these images in the revised Figure 6, and updated the text and figure legend. The images are similar in magnification and quality to those routinely published in the field (e.g. Ackerman et al., 2014, Nat Comm; Strachan et al., 2017, Hum Mol Genet; etc.), including for Vanishing White Matter disease (e.g. Dooves et al., 2016; Klok et al., Ann Clin Transl Neurol, 2018; etc.).

2) New data in supplemental figures 1 and 2 are critical are important for the main story and should be included in the main figures for the story as written and

revised. However, it is difficult to visualize the co-labeling of tunel and ph3 with the noted cell-type markers in those images that influence the quantification of

data and results.

It is not clear how such quantification could be completed, especially with the resolution of in situ hybridization vs immunostaining. As written, these figures are important for the main story and should be included in the main figures. The tunel staining in these new supplementary files is also different than displayed in the main figures. Can the authors provide insets for the labeling demonstrating an example of a co-labeled cell in each of the genotypes.

For Figure 3 (the quantification of TUNEL and apoptosis in the different alleles): We have now included the images in the main body of the manuscript, as new Figures 4 and 5, and re-numbered the subsequent figures. The differences in appearances of some of the images are because it is now more than a year after the original images were generated, so new experiments were performed. For the new Figure 4, showing co-labeling of TUNEL and olig1: we have also provided high-magnification insets showing examples of double-labeled cells for each genotype.

In an effort for the authors to address a review regarding the specificity of cell death in the spinal cord they used mag as a marker for oligodendrocytes. mag is certainly one marker that could identify an oligodendrocyte. But the mag in situ appears to be present in areas of the PNS without defined myelinating cells. There are also a low number of mag+ cells in the spinal cord of animal at 5 dpf in those images than would be expected for labeling of myelinating cells. Can the authors test that the mag+ cells in the spinal cord are also olig2+ or sox10+ to confirm that the mag labeling is specific.

We have now included a high-magnification image, showing co-localization of the mag in situ probe with GFP expressed from a transgenic sox10:GFP line, taken using a single slice confocal image (step size 2.5mm). This image is Figure 4—figure supplement 1.

The mag staining the reviewer notes in the PNS (in the region ventral to the spinal cord) is biological; mag is a marker for oligodendrocytes as well as for Schwann cells. The different appearances of the PNS mag labeling reflects differences in the positioning of the image used for the paper. Also, with regards to TUNEL/OPC quantification, we note that the separate experiments performed in Figure 3, K-O, that the method of quantification of the olig2:dsRed line, of cells that have dorsally migrated in the spinal cord, is specific for OPCs.

3) Please provide clarification and details on the sox10:mrfp transgene used in the study: The authors listed sox10:mrfp as a transgene that they used in the study but it is not clear which figure that transgenic animal was used. Tg(sox10:mrfp) would be a useful tool to validate the OPC phenotype in the spinal cord since sox10 labels OPCs with very different morphology than the subset of neurons that are labeled with that transgene.

We apologize about the confusion. Although we listed this line in the list of reagents, we did not in fact list or use it in the paper or in the figures. This was because although w had used this line in some experiments, those experiments ended up not being included in the submission, and so had erroneously left the line still in the reagents listed as being used, which we have now removed in the text and in the key resource table.

Article and author information

Author details

  1. Matthew D Keefe

    Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, United States
    Conceptualization, Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Writing - original draft, Writing - review and editing
    Contributed equally with
    Haille E Soderholm and Hung-Yu Shih
    Competing interests
    No competing interests declared
  2. Haille E Soderholm

    Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, United States
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing
    Contributed equally with
    Matthew D Keefe and Hung-Yu Shih
    Competing interests
    No competing interests declared
  3. Hung-Yu Shih

    Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, United States
    Data curation, Formal analysis, Investigation, Writing - review and editing
    Contributed equally with
    Matthew D Keefe and Haille E Soderholm
    Competing interests
    No competing interests declared
  4. Tamara J Stevenson

    Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, United States
    Conceptualization, Data curation, Formal analysis, Supervision, Investigation, Methodology, Project administration, Writing - review and editing
    Competing interests
    No competing interests declared
  5. Kathryn A Glaittli

    Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, United States
    Data curation, Formal analysis, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  6. D Miranda Bowles

    Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, United States
    Data curation, Formal analysis, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  7. Erika Scholl

    Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, United States
    Data curation, Formal analysis, Supervision, Writing - original draft, Project administration, Writing - review and editing
    Competing interests
    No competing interests declared
  8. Samuel Colby

    Department of Bioengineering, University of Utah, Salt Lake City, United States
    Data curation, Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared
  9. Samer Merchant

    Department of Bioengineering, University of Utah, Salt Lake City, United States
    Data curation, Formal analysis, Supervision, Investigation, Methodology
    Competing interests
    No competing interests declared
  10. Edward W Hsu

    Department of Bioengineering, University of Utah, Salt Lake City, United States
    Conceptualization, Resources, Formal analysis, Supervision, Methodology, Project administration
    Competing interests
    No competing interests declared
  11. Joshua L Bonkowsky

    1. Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, United States
    2. Brain and Spine Center, Primary Children’s Hospital, Salt Lake City, United States
    Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Methodology, Writing - original draft
    For correspondence
    Competing interests
    Consultant: Bluebird Bio (5/2017; 10/2017; 11/2019) Calico (1/2018-1/2019) Denali therapeutics (6/2019) Enzyvant (6/2019) Neurogene (3/2020) Board of Directors wfluidx 1/2018-present Stock Orchard Therapeutics
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8775-147X


National Institutes of Health (1R21 NS109441-01)

  • Joshua L Bonkowsky

University of Utah (Bray Chair)

  • Joshua L Bonkowsky

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank Yi-Chuan Cheng for the olig1 and mag constructs, Electron microscopy was performed at the University of Utah Electron Microscopy Core Laboratory with assistance from N Chandler and D Belnap. Confocal imaging was performed at the University of Utah Fluorescence Microscopy Core Facility, supported in part by an NCRR Shared Equipment Grant # 1S10RR024761-01. The University of Utah Centralized Zebrafish Animal Resource (CZAR) provided zebrafish husbandry, and is supported in part by NIH grant # 1G20OD018369-01. Sequencing was performed at the University of Utah DNA Sequencing Core Facility. CRISPR design and construction was performed at the University of Utah Mutation Generation and Detection Core.


Human subjects: Human subjects-related aspects of the study were approved by the Institutional Review Board of the University of Utah and the Privacy Board of Intermountain Healthcare. Informed consent was obtained including consent to publish, protocol #19596.

Animal experimentation: Zebrafish experiments were performed in strict accordance of guidelines from the University of Utah Institutional Animal Care and Use Committee (IACUC), regulated under federal law (the Animal Welfare Act and Public Health Services Regulation Act) by the U.S. Department of Agriculture (USDA) and the Office of Laboratory Animal Welfare at the NIH, and accredited by the Association for Assessment and Accreditation of Laboratory Care International (AAALAC).

Senior Editor

  1. Richard M White, Memorial Sloan Kettering Cancer Center, United States

Reviewing Editor

  1. Beth Stevens, Boston Children's Hospital, United States


  1. Beth Stevens, Boston Children's Hospital, United States
  2. Cody J Smith, University of Notre Dame, United States

Publication history

  1. Received: February 24, 2020
  2. Accepted: December 9, 2020
  3. Accepted Manuscript published: December 10, 2020 (version 1)
  4. Version of Record published: December 21, 2020 (version 2)


© 2020, Keefe et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,431
    Page views
  • 138
  • 8

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Matthew D Keefe
  2. Haille E Soderholm
  3. Hung-Yu Shih
  4. Tamara J Stevenson
  5. Kathryn A Glaittli
  6. D Miranda Bowles
  7. Erika Scholl
  8. Samuel Colby
  9. Samer Merchant
  10. Edward W Hsu
  11. Joshua L Bonkowsky
Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response
eLife 9:e56319.

Further reading

    1. Cancer Biology
    2. Medicine
    Hiba Dagher, Anne-Marie Chaftari ... Issam I Raad
    Short Report

    Background: An increasing number of observational studies have reported the persistence of symptoms following recovery from acute COVID-19 disease in non-cancer patients. The long-term consequences of COVID-19 are not fully understood particularly in the cancer patient population. The purpose of this study is to assess post-acute sequelae of SARS-CoV-2 infection (PASC) in cancer patients following acute COVID-19 recovery.

    Methods: We identified cancer patients at MD Anderson Cancer Center who were diagnosed with COVID-19 disease between March 1, 2020 and Sept 1, 2020 and followed them till May 2021. To assess PASC, we collected patients reported outcomes through questionnaires that were sent to patients daily for 14 days after COVID-19 diagnosis then weekly for 3 months, and then monthly thereafter. We also reviewed patients' electronic medical records to capture the persistence or emergence of new COVID19-related symptoms reported during any clinic or hospital encounter beyond 30 days of the acute illness and up to 14 months.

    Results: We included 312 cancer patients with a median age of 57 years (18-86). The majority of patients had solid tumors (75%). Of the 312 patients, 188 (60%) reported long COVID-19 symptoms with a median duration of 7 months and up to 14 months after COVID-19 diagnosis. The most common symptoms reported included fatigue (82%), sleep disturbances (78%), myalgias (67%) and gastrointestinal symptoms (61%), followed by headache, altered smell or taste, dyspnea (47%) and cough (46%). A higher number of females reported a persistence of symptoms compared to males (63% vs 37%; p=0.036). Cancer type, neutropenia, lymphocytopenia, and hospital admission during acute COVID-19 disease were comparable in both groups. Among the 188 patients with PASC, only 16 (8.5%) were readmitted for COVID-related reasons.

    Conclusions: More than one out of two cancer patients, and more likely females, report PASC that may persist beyond 6 months and even one year. The most common symptoms are non-respiratory and consist of fatigue, sleep disturbance, myalgia and gastro-intestinal symptoms. Most of the cancer patients with PASC were managed on outpatient basis with only 8,5% requiring a COVID-19 related re-admission.

    Funding: This research is supported by the National Institutes of Health/National Cancer Institute under award number P30CA016672, which supports the MD Anderson Cancer Center Clinical Trials Office. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

    1. Medicine
    2. Neuroscience
    Lawrence T Reiter

    Experiments on mice suggest that an approach called antisense oligonucleotide therapy may be able to treat some symptoms of Angelman syndrome, including problems with epilepsy and sleep.