Wnt/β-catenin signaling is an evolutionarily conserved determinant of chordate dorsal organizer
- Laboratory of Transcriptional Regulation, Institute of Molecular Genetics of the Czech Academy of Sciences, Czech Republic
Figures
Figure 1 with 1 supplement
Asymmetric activity of the Wnt/β-catenin signaling pathway during the cleavage and early gastrula stages of amphioxus embryo.
(A–D’), (F–F’), (H–H’), (K’) and (M–M’) Immunostaining of β-catenin with specific anti-amphioxus β-catenin antibody produced in the mouse. (J) Bright-field of the embryo shown with the signals in (J’…
Figure 1—figure supplement 1
Immunodetection of nuclear β-catenin at the cleavage stage, late gastrula and late neurula stages Immunostaining of amphioxus embryos with antibodies against amphioxus.
(A-Aiii, B–Bi, C–Ci, D–Ev) or human ß-catenin (Bii-Biv). Overlay of double staining in Biv and Civ. Embryos are at the two-cell stage in A-Aiii, four-cell stage in B-Biv, 16-cell stage in C-Civ, …
Figure 2 with 1 supplement
Nuclear β-catenin is colocalized with dorsal-specific protein Goosecoid during early development in amphioxus (A-Eiv’) Double immunostaining of Gooosecoid and β-catenin in Branchiostoma lanceolatum.
Lateral view of the embryos in (A-Aiv), (B-Biv), (C-Civ), (D-Div), (E-Eeiv). The embryos are shown from the vegetal pole view in (A’-Aiv’), (B’-Biv’), (C’-Civ’). Blastopore view of the embryos in (D’…
Figure 2—figure supplement 1
Nuclear β-catenin is colocalized with dorsal-specific protein Goosecoid and P-Smad2 during early development of Branchiostoma floridae.
(Aa-Abiv’) Double immunostaining of Gooosecoid and β-catenin. (Ba-Baiv’) Double immunostaining of P-Smad2 and β-catenin. Lateral view of embryos in (Aa-Aaiv), (Ab-Abiv), and (Ba-Baiv). The embryos …
Figure 3
Wnt/β-catenin and Nodal signaling activities overlap during early amphioxus development.
(A) Commercial anti-phosphoSmad2 antibodies specifically label phospho-Smad2 (P-Smad2) in amphioxus. (B) Double immunostaining of Gooosecoid and P-Smad2. (C) Double immunostaining of P-Smad2 and …
Figure 4
Treatment of amphioxus embryos with the inhibitors of Wnt/β-catenin signaling at one-cell stage results in downregulation of the dorsal-specific genes at the gastrula stage.
The expression of Wnt/β-catenin target Axin, dorsal-specific genes Chordin and Goosecoid, dorsal-specific genes encoding signaling molecules Nodal and Vg1, dorsal-specific neural markers Neurogenin …
Figure 5
Inhibition of Wnt/ß-catenin signaling by injection of dominant-negative Tcf (dnTcf) mRNA leads to impairment of the axis development in amphioxus neurula.
(A) The scheme illustrates the mechanism of Wnt/ß-catenin signaling inhibition by dnTcf. (B) mRNA expression of Chordin and Hex genes in the control embryos and embryos injected with dnTcf. (C) …
Figure 6
Ectopic activation of Wnt/β-catenin signaling at one-cell stage but not at the blastula stage results in ectopic expression of dorsal-specific genes (Aa-g’).
The expression of Axin, Chordin and Goosecoid in the control embryos and embryos treated with 5 µM of CHIR99021 at one-cell stage. Arrow in Ad marks ventral expansion of Chordin expression. …
Figure 7 with 1 supplement
Ectopic activation of Wnt/β-catenin signaling pathway by microinjection of Wnt8 ligand mRNA or treatment with CHIR99021 induces ectopic expression of dorsal axis-specific markers in the amphioxus embryos.
(A) Expression of Brachyury and Elav proteins at the mid-neurula of amphioxus embryos injected with Wnt8 mRNA at a low dose (3 ng/µl) or high dose (7 ng/µl). (B–C) Expression of Brachyury and Elav …
Figure 7—figure supplement 1
Wide-field image of amphioxus embryos injected with tdTomato mRNA or tdTomato with Wnt8 mRNA.
(A) The embryos injected with mRNA of tdTomato alone. (B) and (C) The embryos injected with mRNA of tdTomato and Wnt8.
Figure 8
Ectopic activation of Wnt/β-catenin signaling pathway by microinjection of Wnt11 ligand mRNA induces formation of a double axis in the amphioxus embryos.
Double immunostaining detecting the protein expression of Brachyury and Ac-Tub in the embryos injected with a low (A) or high (B) dose of Wnt11 mRNA (50 ng/µl or 250 ng/µl, respectively). The insert …
Figure 9 with 1 supplement
Wnt/β-catenin and Nodal signaling pathways co-act during early development to promote dorsal cell fate in the amphioxus embryo.
(A) Expression of Nodal (Aa-av’’) and Goosecoid (Ab-bv’’) in the control embryos, which were treated with DMSO (Aa-a’’ and Ab-b’’), and the embryo treated with Wnt signaling inhibitor C59 (Aai-ai’’ …
Figure 9—figure supplement 1
Assaying the responsiveness of cis-regulatory elements of amphioxus Goosecoid, Nodal and Vg1 to Wnt/β-catenin.
Luciferase reporter plasmids containing cis-regulatory elements of amphioxus Goosecoid (A), Nodal and Vg1(B) were cotransfected with expression plasmid encoding a stabilized form of β-catenin …
Figure 10
The role of Wnt/β-catenin signaling in the establishment of axial patterning in Metazoa.
(A) Wnt/β-catenin signaling determines the organizing center of the primary body axis formation in cnidarian Hydra and Nematostella. (A’) Wnt/β-catenin upstream of autoactivating Nodal signaling …
Author response image 1
Author response image 2
Author response image 3
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Branchiostoma lanceolatum) | Wild type | collected in Argeles-sur-mer, France | NCBITaxon: 7740 | |
| Strain, strain background (Branchiostoma floridae) | Wild type | Laboratory cultures, Institute of Molecular Genetics | NCBITaxon: 7739 | |
| Chemical compound, drug | CHIR99021 | SelleckChem | S1263 | |
| Chemical compound, drug | C59 | Xcess Bioscience Inc | M-60005–2 s | |
| Chemical compound, drug | SB505124 | Sigma | S4696 | |
| Antibody | Anti-β-Catenin, produced in rabbit | Sigma | C2206 | (1:500) |
| Antibody | Anti-Smad2(phospho S255), produced in rabbit | Abcam | ab188334 | (1:20,000) |
| Antibody | Anti-β-Catenin, produced in mouse | Bozzo et al., 2017 | (1:200) | |
| Antibody | Anti-FoxA, produced in mouse | Bozzo et al., 2017 | (1:200) | |
| Antibody | Anti-Goosecoid, produced in mouse | This paper | (1:200) | |
| antibody | Anti-Brachyury, produced in mouse | This paper | (1:200) | |
| Antibody | Anti-Elav, produced in mouse | This paper | (1:200) | |
| Sequence-based reagent | Goosecoid_fw | This paper | GCTTCGGATCCGAAGTCACCGAGCGCACGACC | |
| Sequence-based reagent | Goosecoid_rev | This paper | GGTCTAAGCTTACTGTCCGTCGCTAGGCGT | |
| Sequence-based reagent | Brachyury_fw | This paper | GCTGTGGATCCGGAATGGAAGATTTGCAAGAT | |
| Sequence-based reagent | Brachyury_rev | This paper | CCTGTAAGCTTAGAGCGATGGTGGAGTCAT | |
| Sequence-based reagent | Elav_fw | This paper | GTGCTGGATCCGGCTCGCCCGACGGACGCAC | |
| Sequence-based reagent | Elav_rev | This paper | GTGCTAAGCTTACAGTCCACTCACGTACAAGTT | |
| Sequence-based reagent | Vg1_fw | This paper | GCGGCCACTGCTTTTACTTT | |
| Sequence-based reagent | Vg1_rev | This paper | GTGTAGTAGTGGACAAGACTGAGGG | |
| Sequence-based reagent | Nodal_fw | This paper | TAACGTGAGGCCAGGTGATG | |
| Sequence-based reagent | Nodal_rev | This paper | CGGAGTTTGCGTGTTCGACT | |
| Sequence-based reagent | Wnt8_fw | This paper | GGAATTCGCACGATGCTCGCACAGCTC | |
| Sequence-based reagent | Wnt8_rev | This paper | GGAATTCCTAGTTGTTTCCCCTGTTTCTTC | |
| Sequence-based reagent | Wnt11_fw | This paper | CTCTTCTTCAACCTGCGACTG | |
| Sequence-based reagent | Wnt11_rev | This paper | TTTTCTCTGGCTTTCCCTTGA | |
| Sequence-based reagent | dnTcf_fw | This paper | GCGATCTAGAGGTTCCAAGCCACCGTTGCAA | |
| Sequence-based reagent | dnTcf_rev | This paper | GCTCAAGCTTTCACGTGTTGGGCGTTGACTT | |
| Software, algorithm | Fiji | Schindelin et al., 2012 | ||
| Software, algorithm | Leica Application Suite X (LAS X) | Leica |
Additional files
-
Supplementary file 1
Chemicals used in this study to affect the signaling pathways.
- https://cdn.elifesciences.org/articles/56817/elife-56817-supp1-v3.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/56817/elife-56817-transrepform-v3.docx
