SOX21 modulates SOX2-initiated differentiation of epithelial cells in the extrapulmonary airways

  1. Evelien Eenjes
  2. Marjon Buscop-van Kempen
  3. Anne Boerema-de Munck
  4. Gabriela G Edel
  5. Floor Benthem
  6. Lisette de Kreij-de Bruin
  7. Marco Schnater
  8. Dick Tibboel
  9. Jennifer Collins
  10. Robbert J Rottier  Is a corresponding author
  1. Department of Pediatric Surgery, Erasmus Medical Center – Sophia Children’s Hospital, Netherlands
  2. Department of Cell biology, Erasmus Medical Center, Netherlands
9 figures, 4 tables and 1 additional file

Figures

Figure 1 with 1 supplement
SOX21 is expressed in the proximal region of the SOX2+ non-branching zone of the airway epithelium.

(A) Co-staining of SOX9 (green) for distal buds, SOX2 (blue) for proximal epithelium, and SOX21 (red) at different stages of lung development. Boxed areas are sown as enlarged inserts. Schematic …

Figure 1—source data 1

Quantification of the number of cells represented as Dorsal-Ventral ratio of SOX2 and SOX21 positive cells.

https://cdn.elifesciences.org/articles/57325/elife-57325-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
SOX21 is unilaterally detected in the developing trachea and overexpression of SOX21 leads to lung cysts.

(A) Immunostaining on sections of the main bronchi immediately distal of the carina from mice at embryonic day (E) 12.5, 13.5, 14.5, and 15.5 using SOX2 (blue), SOX21 (red), and either SOX9 (green, …

Figure 2 with 1 supplement
SOX2 and SOX21 are co-expressed in the zone where progenitor cells differentiate to basal cells.

(A) Immunofluorescence of SOX2 (blue), SOX21 (red), and TRP63 (green) on lung sections of E12.5, E13.5, and E14.5 showing a spatial co-localization of the three proteins. Scale bar = 100 µm. (B) …

Figure 2—source data 1

Quantification of the number of SCGB1A1, FOXJ1 and TRP63 positive cells represented in the plots.

https://cdn.elifesciences.org/articles/57325/elife-57325-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Basal cells arise in the SOX2+ SOX21+ region.

(A) Immunofluorescence of SOX2 (blue), SOX21 (red), and TRP63 (green) on lung sections of embryonic ages (E) 11.5. T = thymus, L = lung, and E = esophagus. Scale bar = 100 µm. (B) Immunofluorescence …

Figure 3 with 1 supplement
SOX21 counter balances SOX2+ progenitor differentiation to airway-specific cell types.

(A–D) Immunofluorescence and quantification of the number of TRP63+ basal cells (A), TRP73+ cells (B), FOXJ1+-ciliated cells (C), and KI67+-dividing cells (D) at E14.5 in wild-type (WT), Sox21+/−, …

Figure 3—source data 1

Quantification of the number of positive cells represented in the plots.

https://cdn.elifesciences.org/articles/57325/elife-57325-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
SOX21 counter balances SOX2+ progenitor differentiation to airway specific cell types.

(A–D) Immunofluorescence and quantification of the number of TRP63+ basal cells (A), TRP73+ cells (B), FOXJ1+-ciliated cells (C), and KI67+-dividing cells (D) at E14.5 in wild-type (WT) and Sox2+/− m…

Figure 4 with 1 supplement
SOX2 and SOX21 are inversely correlated with basal cell differentiation to ciliated cells.

(A) Schematic overview of mouse tracheal epithelial cell (MTEC) culture. QPCR analysis of Sox2 and Sox21 expression during differentiation of MTECs on air–liquid interface (ALI). One-way ANOVA (n = 5…

Figure 4—source data 1

Quantification of the number of positive cells represented in the plots.

https://cdn.elifesciences.org/articles/57325/elife-57325-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
SOX2 and SOX21 are inversely correlated with basal cell differentiation to ciliated cells.

(A) Schematic overview of mouse tracheal epithelial cell (MTEC) culture experiment. QPCR analysis of TRP63, SCGB3A2 and FOXJ1 expression during differentiation of MTECs on air–liquid interface …

Figure 5 with 1 supplement
Regeneration is delayed in SOX2 deficient tracheal epithelium.

(A) Immunofluorescence staining on tracheal sections of adult wild-type mice for SOX2 (red), SOX21 (green), and KRT5 (grey, top row) or smooth muscle actin (grey, SMA, bottom row). TE = tracheal …

Figure 5—source data 1

Quantification of the number of FOXJ1, SCGB1A1, TRP63 and KI67 positive cells represented in the plots.

https://cdn.elifesciences.org/articles/57325/elife-57325-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Regeneration is delayed in SOX2 deficient tracheal epithelium.

(A) Immunofluorescence staining on tracheal sections of wild-type (WT), Sox2+/−, and Sox21+/−, 2 days post injury (2 DPI) of Keratin 5 (KRT, grey), Keratin 8 (KRT8, green), TubilinIV (TUBIV, red). (B

Evolutionary conserved expression of SOX21 in human airway epithelium.

(A) Immunofluorescence on human fetal lung sections post-conceptional week (PCW) 13, 16.5, and 17. Proximal–distal patterning of human developing airways is analyzed with SOX9 (red) and SOX2 (blue) …

Figure 7 with 1 supplement
SOX2 and SOX21 in human basal cell differentiation.

(A) Schematic overview of human primary bronchial epithelial cell (HPBEC) culture. QPCR analysis of SOX2 and SOX21 expression during differentiation of HPBECs on air–liquid Interface (ALI). One-way …

Figure 7—source data 1

Quantification of the number of positive cells represented in the plots.

https://cdn.elifesciences.org/articles/57325/elife-57325-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
SOX21 in human airway epithelium.

(A) Bright field images of human fetal lung tip organoids (scale bar = 250 µm). (B) QPCR analysis of TP63, SCGB3A1, and FOXJ1 expression during differentiation of HPEBCs on air–liquid Interface …

Author response image 1
Bar graphs representing the percentage of FOXJ1+, TRP63+ and SCGB1A1+ cells in E18.

5 lungs of WT, Sox2Sox2+/-, Sox21+/-, Sox21-/- and Sox2Sox2+/-Sox21+/- mice.

Author response image 2
Intensity of SOX2 or SOX21 was measured in nuclei of SCGB3A1+ cells and SCGB3A1- cells.

Circles were put around nuclei that were SCGB3A1+. Staining of SCGB3A1 was analyzed throughout the z-stack.

Tables

Key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional information
Genetic reagent (M. musculus)Sox2-CreERTPMID:21982232MGI:5295990Sox2tm1(cre/ERT2)Hoch
The Jackson Laboratories Stock No: 017593
Genetic reagent (M. musculus)Sox21-KOPMID:19470461MGI:2654070Dr. Stavros Malas
Genetic reagent (M. musculus)iSox2PMID:18374910MGI:98364Dr. Robbert Rottier
Genetic reagent (M. musculus)iSox21-MGI:2654070Dr. Robbert Rottier
Genetic reagent (M. musculus)SPC-rtTAPMID:11874100MGI:109517Prof. Jeffrey Whitsett
Genetic reagent (M. musculus)CC10-rtTAPMID:10766812MGI:98919Prof. Jeffrey Whitsett
AntibodyMouse anti-β-TUBULIN IVBioGenexMU178-UC1:100
AntibodyMouse anti-FOXJ1eBioscience14–99651:200
AntibodyRabbit anti-KRT5BiolegendPoly190551:500
AntibodyRat anti-KRT8DSHBTROMA-I1:100
AntibodyRabbit anti-MYC (Immunofluorescence)AbcamAB91061:500
AntibodyRabbit anti-SCGB1A1AbcamAB408731:200
AntibodyMouse anti-SCGB3A1R and D systemsAF17901:200
AntibodyGoat anti-SCGB3A2R and D systemsAF34651:500
AntibodyMouse anti-SMANeomarkersMS-113-P11:500
AntibodyRabbit anti-SOX2Seven-HillsWRAB-SOX21:500
AntibodyGoat anti-SOX2Immune systemsGT150981:500
AntibodyGoat anti-SOX21R and D systemsAF35381:100 (TSA: 9 min)
AntibodyRabbit anti-SOX9AbcamAB1852301:500
AntibodyMouse anti-TRP63AbcamAB7351:100
AntibodyRabbit anti-TRP73AbcamAB406581:100
AntibodyRabbit anti-FLAGSigmaF7425Western blot, 1:1000
AntibodyRabbit anti-MYCAbcamAB91061:1000
AntibodyRabbit anti-MUC5BSigmaHPA0082461:500
AntibodyMouse anti-β -TUBULINSigmaT83281:2000
AntibodyAlexa Fluor 405, 488, 594 Donkey anti Goat IgGJackson ImmunoResearch705-475-147,
705-545-147,
705-585-147
1:500
AntibodyAlexa Fluor 488, 594, 647 Donkey anti Mouse IgGJackson ImmunoResearch715-545-151,
715-585-151,
711-605-151
1:500
AntibodyAlexa Fluor 488, 594, 647 Donkey anti Rabbit IgGJackson ImmunoResearch711-545-152,
711-585-151,
711-605-152
1:500
AntibodyAlexa Fluor 488, 594 Donkey anti Rat IgGJackson ImmunoResearch712-545-150
712-585-153
1:500
AntibodyDonkey anti-Goat HRP conjugatedJackson ImmunoResearch705-035-1471:500
Table 1
Medium.
KSFM-hPBEC medium
ReagentCompanyCat. no.Final concentration
KSFMGibco17005034n/a
Penicillin/streptomycinLonzaDE17-602e100 U/ml 100 µg/ml
Bovine pituitary extractGibco130280140.03 mg/ml
Human EGFPeprotech315–0925 ng/ml
IsoproterenolSigmaI-65041 µM
KSFM-MTEC expansion medium
ReagentCompanyCat. no.Final Concentration
KSFMGibco17005034n/a
Penicillin/streptomycinLonzaDE17-602e100 U/ml 100 µg/ml
Bovine pituitary extractGibco130280140.03 mg/ml
Mouse EGFPeprotech315–0925 ng/ml
IsoproterenolSigmaI-65041 µM
Rock Inhibitor (Y27632)Axon MedChem168310 µM
DAPTAxon MedChem14845 µM
MTEC proliferation medium
ReagentCompanyCat. no.Final concentration
DMEM:F12Gibco1133032n/a
Penicillin/streptomycinLonzaDE17-602e100 U/ml 100 µg/ml
NaHCO3Gibco250800940.03% (w/v)
Fetal calf serumHyCloneSH30071.035%
L-GlutamineGibco250300811.5 mM
Insulin-transferin-seleniumGibco41400045
Cholera toxinSigmaC80520.1 µg/ml
Bovine pituitary extractGibco130280140.03 mg/ml
Mouse EGFPeprotech315–0925 ng/ml
Rock inhibitor (Y27632)Axon MedChem168310 µM
Retinoic acidSigmaR26250.05 µM
MTEC differentiation medium
ReagentCompanyCat. no.Final concentration
DMEM:F12Gibco1133032n/a
Penicillin/streptomycinLonzaDE17-602e100 U/ml 100 µg/ml
NaHCO3Gibco250800940.03% (w/v)
Bovine serum albuminGibco152600370.1% (w/v)
L-GlutamineGibco250300811.5 mM
Insulin-transferin-seleniumGibco41400045
Cholera toxinSigmaC80520.025 µg/ml
Bovine pituitary extractGibco130280140.03 mg/ml
Mouse EGFPeprotech315–095 ng/ml
Retinoic acidSigmaR26250.05 µM
Human fetal organoid medium
ReagentCompanyCat. no.Final concentration
Advanced DMEM:F12Invitrogen12634–034n/a
R-SpondinPeprotech120–38500 ng/ml
NogginPeprotech120–10C100 ng/ml
Fgf10Peprotech100–26100 ng/ml
Fgf7Peprotech100–19100 ng/ml
EGFPeprotechAF-100–1550 ng/ml
CHIR99021Stem Cell Techn.720523 µM
SB431542Tocris161410 µM
B27 supplement (- VitA)ThermoFisher12587–010
N-AcetylcysteineSigmaA91651.25 mM
Glutamax 100×Invitrogen12634–034
N2ThermoFisher17502–048
HepesGibco15630–5610 mM
Penicillin/streptomycinLonzaDE17-602e100 U/ml 100 µg/ml
PrimocinInvivogenAnt-pm-150 µg/ml
Human airway organoid medium
ReagentCompanyCat. no.Final concentration
Advanced DMEM:F12Invitrogen12634–034n/a
R-SpondinPeprotech120–38500 ng/ml
NogginPeprotech120–10C100 ng/ml
Fgf10Peprotech100–26100 ng/ml
Fgf7Peprotech100–1925 ng/ml
SB202190SigmaS7067500 nM
A83-01Tocris2939500 nM
Y-27632Axon MedChem16835 µM
B27 supplementGibco17504–44
N-AcetylcysteineSigmaA91651.25 mM
NicotinamideSigmaN06365 mM
Glutamax 100×Invitrogen12634–034
HepesGibco15630–5610 mM
Penicillin/streptomycinLonzaDE17-602e100 U/ml 100 µg/ml
PrimocinInvivogenAnt-pm-150 µg/ml
Table 2
RT-PCR primers.
RT-primers
GeneForward (5’→3’)Reverse (5’→3’)Species
Foxj1CAGACCCCACCTGGCAGAATTCAAAGGCAGGGTGGATGTGGACTMouse
Gapdh (housekeeping)CCTGCCAAGTATGATGACATGTCCTCAGTGTAGCCCAAGMouse
Krt5TACCAGACCAAGTATGAGGAGTGGATCATTCGGTTCATCTCAGMouse
Scgb1a1GCAGCTCAGCTTCTTCGGACATCCTGGTCTCTTGTGGGAGGGMouse
Scgb3a2GTGGTTATTCTGCCACTGCCCTTTCGTCCACACACTTCTTCAGTCCMouse
Sox2AACATGGCAATCAAATGTCTTGCCAGTACTTGCTCTCATMouse
Sox21TTGAAAGATGCCTCTCACCAAATAAGCTAAATGGGAAGGGAGMouse
Trp63GGAAAACAATGCCCAGACTCGATGGAGAGAGGGCATCAAAMouse
Actin (housekeeping)ATTGGCAATGAGCGGTTCGGATGCCACAGGACTCCATHuman
Foxj1CCCACCTGGCAGAATTCAATCCGCAGTCGCCGCTTCTTGAAAGCHuman
Scgb1a1GCTCCGCTTCTGCAGAGATCTGGCTTTTGGGGGAGGGTGTCCAHuman
Scgb3a1TGCTGGGGGCCCTGACAACGTTTATTGAGAGGGGCCGGHuman
Sox2AATGCCTTCATGGTGTGGTCTTGCTGATCTCCGAGTTGTGHuman
Sox21CCACTCGCTTGGATTTCTGACACATCGACTCAAACTTAGGGCAACGAHuman
Trp63CCACCTGGACGTATTCCACTGTCGAATCAAATGACTAGGAGGGGHuman
Table 3
Primers used for pGL4.10[luc2] cloning.
Primers used for pGL4.10[luc2] cloning
NamePrimers (5’→3’) cut siteCut site
Trp63Forward: CAGGGTACCGGGCACATTCCATCTTTCCTKpnI
Reverse: CAGCTCGAGAGACTGGTCAAGGCTGCTCTXho
Sox2Forward: CAGGGTACCCGCGAGAGTATTGCAGGGAAKpnI
Reverse: CAGGCTAGCCGGAGATCTGGCGGAGAATANheI
Trp73Forward: CAGGGTACCGGACACGCATCTGTTGTGGAKpnI
Reverse: CAGCTCGAGTCTGCACACGCTGAGGAGCTXho

Additional files

Download links