Strain (Saccharomyces cerevisiae) | W303a (MATa; can1-100; his3-11,15; leu2-3,112; trp1-1; ura3-1; ade2-1) | Schirmer et al., 2004 | N/A | |
Strain (S. cerevisiae) | W303a∆hsp104 (MATa; can1-100; his3-11,15; leu2-3,112; trp1-1; ura3-1; ade2-1; hsp104::KanMX) | Schirmer et al., 2004 | A3224 | |
Strain (Escherichia coli) | BL21-CodonPlus (DE3)-RIL | Agilent | 2302545 | |
Strain (Caenorhabditis elegans) | UA44 (baln11 [Pdat-1: :α-syn, Pdat-1: :GFP]) | Cao et al., 2005 | UA44 | Full description can be found in Materials and methods: Generation of transgenic C. elegans and neurodegeneration analysis |
Strain (C. elegans) | UA381 (baln11 [Pdat-1: :α-syn, Pdat-1: :GFP]; baEx210 [Pdat-1:: CtHsp104, rol-6]) | This paper | UA381 | Full description can be found in Materials and methods: Generation of transgenic C. elegans and neurodegeneration analysis |
Strain (C. elegans) | UA382 (baln11 [Pdat-1: :α-syn, Pdat-1: :GFP]; baEx211 [Pdat-1:: TtHsp104, rol-6]) | This paper | UA382 | Full description can be found in Materials and methods: Generation of transgenic C. elegans and neurodegeneration analysis |
Strain (C. elegans) | UA383 (baln11 [Pdat-1: :α-syn, Pdat-1: :GFP]; baEx212 [Pdat-1:: TIHsp104, rol-6]) | This paper | UA383 | Full description can be found in Materials and methods: Generation of transgenic C. elegans and neurodegeneration analysis |
Strain (C. elegans) | UA403 (vtIs7 [Pdat-1::GFP]; baEx223 [Pdat-1::CtHSP104, rol-6]) | This paper | UA403 | Full description can be found in Materials and methods: Generation of transgenic C. elegans and neurodegeneration analysis |
Strain (C. elegans) | UA404 (vtIs7 [Pdat-1::GFP]; baEx224 [Pdat-1:: TtHSP104, rol-6]) | This paper | UA404 | Full description can be found in Materials and methods: Generation of transgenic C. elegans and neurodegeneration analysis |
Strain (C. elegans) | UA405 (vtIs7 [Pdat-1::GFP]; baEx225 [Pdat-1:: TlHSP104, rol-6]) | This paper | UA405 | Full description can be found in Materials and methods: Generation of transgenic C. elegans and neurodegeneration analysis |
Cell line (Homo sapiens) | HEK293T | ATCC | Cat# CRL-3216 RRID:CVCL_0063 | |
Antibody | Mouse monoclonal anti-FLAG M2 | Sigma-Aldrich | Cat# F1804; RRID:AB_262044 | (1:1000 dilution) |
Antibody | Rabbit polyclonal anti-TDP-43 | Proteintech | Cat#10782; RRID:AB_615042 | (1:1000 dilution) |
Antibody | Rabbit polyclonal anti-GFP | Sigma-Aldrich | Cat# G1544; RRID:AB_439690 | (1:2500 dilution) |
Antibody | Mouse monoclonal anti-3-phosphoglycerate kinase | Novex | Cat# 459250; RRID:AB_221541 | (1:1000 dilution) |
Antibody | Rat monoclonal anti-tubulin | Abcam | Cat# ab6160; RRID:AB_305328 | (1:1000 dilution) |
Antibody | IRDye 680RD Goat anti-Rabbit IgG secondary antibody | Li-Cor | Cat# 926–68071; RRID:AB_10956166 | (1:2500 dilution) |
Antibody | IRDye 800CW Goat anti-Mouse IgG secondary antibody | Li-Cor | Cat# 926–32210; RRID:AB_621842 | (1:5000 dilution) |
Antibody | IRDye 800CW Goat anti-Rat IgG secondary antibody | Li-Cor | Cat# 926–32219; RRID:AB_1850025 | (1:2500 dilution) |
Recombinant DNA reagent | pAG416GAL-ccdB | Alberti et al., 2007 | N/A | |
Recombinant DNA reagent | pRS313HSE-ccdB | Gates et al., 2017 | N/A | |
Recombinant DNA reagent | pMCSG | Kim et al., 2011 | N/A | |
Recombinant DNA reagent | pDAT-ccdB | Jackrel et al., 2014 | N/A | |
Recombinant DNA reagent | pInducer20-ccdB | Meerbrey et al., 2011 | N/A | |
Recombinant DNA reagent | pE-SUMO | Lifesensors | N/A | |
Recombinant DNA reagent | pAG416GAL-ScHsp104-FLAG | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pRS313HSE-ScHsp104-FLAG | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pNOTAG-ScHsp104 | Jackrel et al., 2014 | N/A | |
Recombinant DNA reagent | pAG416GAL- ScHsp104A503V-FLAG | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pAG416GAL- ScHsp104A503S-FLAG | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pNOTAG-ScHsp104A503S | Jackrel et al., 2014 | N/A | |
Recombinant DNA reagent | pMCSG-CtHsp104 | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pAG416GAL-CtHsp104-FLAG | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pRS313HSE-CtHsp104-FLAG | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pDAT-CtHsp104 | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pInducer20-CtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CtHsp104DN-FLAG | This paper | N/A | Encodes CtHsp104158-882; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CtHsp104DN-FLAG | This paper | N/A | Encodes CtHsp104158-882; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CtHsp104DWA(KA)-FLAG | This paper | N/A | Encodes CtHsp104K211A:K612A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CtHsp104DWA(KA) FLAG | This paper | N/A | Encodes CtHsp104K211A:K612A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CtHsp104DWA(KT)-FLAG | This paper | N/A | Encodes CtHsp104K211T:K612T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CtHsp104DWA(KT) FLAG | This paper | N/A | Encodes CtHsp104K211T:K612T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CtHsp104DPLA-FLAG | This paper | N/A | CtHsp104Y249A:Y654A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CtHsp104DPLA-FLAG | This paper | N/A | CtHsp104Y249A:Y654A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CtHsp104DWB(EA)-FLAG | This paper | N/A | CtHsp104E275A:E679A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CtHsp104DWB(EA) FLAG | This paper | N/A | CtHsp104E275A:E679A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CtHsp104DWB(EQ)-FLAG | This paper | N/A | CtHsp104E275Q:E679Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CtHsp104DWB(EQ)-FLAG | This paper | N/A | CtHsp104E275Q:E679Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CaSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CaSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CaCaSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CaCaSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CaCaCaS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CaCaCaS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SSCaS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SSCaS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CaSCaS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CaSCaS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GsHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GsHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GsHsp104DN-FLAG | This paper | N/A | Encodes GsHsp104158-922; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GsHsp104DN-FLAG | This paper | N/A | Encodes GsHsp104158-922; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GsHsp104DWA(KA)-FLAG | This paper | N/A | Encodes GsHsp104K211A:K621A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GsHsp104DWA(KA) FLAG | This paper | N/A | Encodes GsHsp104K211A:K621A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GsHsp104DWA(KT)-FLAG | This paper | N/A | Encodes GsHsp104K211T:K621T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GsHsp104DWA(KT) FLAG | This paper | N/A | Encodes GsHsp104K211T:K621T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GsHsp104DPLA-FLAG | This paper | N/A | Encodes GsHsp104Y249A:Y663A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GsHsp104DPLA-FLAG | This paper | N/A | Encodes GsHsp104Y249A:Y663A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GsHsp104DWB(EA)-FLAG | This paper | N/A | Encodes GsHsp104E277A:E688A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GsHsp104DWB(EA) FLAG | This paper | N/A | Encodes GsHsp104E277A:E688A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GsHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes GsHsp104E277Q:E688Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GsHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes GsHsp104E277Q:E688Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GGSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GGSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GGGS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GGGS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SSGS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SSGS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-GSGS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-GSGS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pNOTAG-MbHsp104 | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MbHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MbHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MbHsp104DN-FLAG | This paper | N/A | Encodes MbHsp104160-889; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MbHsp104DN-FLAG | This paper | N/A | Encodes MbHsp104160-889; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MbHsp104DWA(KA)-FLAG | This paper | N/A | Encodes MbHsp104K213A:K623A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MbHsp104DWA(KA) FLAG | This paper | N/A | Encodes MbHsp104K213A:K623A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MbHsp104DWA(KT)-FLAG | This paper | N/A | Encodes MbHsp104K213T:K623T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MbHsp104DWA(KT) FLAG | This paper | N/A | Encodes MbHsp104K213T:K623T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MbHsp104DPLA-FLAG | This paper | N/A | Encodes MbHsp104Y251A:Y665A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MbHsp104DPLA-FLAG | This paper | N/A | Encodes MbHsp104Y251A:Y665A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MbHsp104DWB(EA)-FLAG | This paper | N/A | Encodes MbHsp104E279A:E690A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MbHsp104DWB(EA) FLAG | This paper | N/A | Encodes MbHsp104E279A:E690A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MbHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes MbHsp104E279Q:E690Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MbHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes MbHsp104E279Q:E690Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MMSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MMSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MMMS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MMMS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SSMS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SSMS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MSMS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MSMS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pNOTAG-CrHsp104 | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CrHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CrHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CrHsp104DN-FLAG | This paper | N/A | Encodes CrHsp104165-925; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CrHsp104DN-FLAG | This paper | N/A | Encodes CrHsp104165-925; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CrHsp104DWA(KA)-FLAG | This paper | N/A | Encodes CrHsp104K216A:K614A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CrHsp104DWA(KA) FLAG | This paper | N/A | Encodes CrHsp104K216A:K614A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CrHsp104DWA(KT)-FLAG | This paper | N/A | Encodes CrHsp104K216T:K614T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CrHsp104DWA(KT) FLAG | This paper | N/A | Encodes CrHsp104K216T:K614T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CrHsp104DPLA-FLAG | This paper | N/A | Encodes CrHsp104Y255A:Y656A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CrHsp104DPLA-FLAG | This paper | N/A | Encodes CrHsp104Y255A:Y656A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CrHsp104DWB(EA)-FLAG | This paper | N/A | Encodes CrHsp104E283A:E681A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CrHsp104DWB(EA) FLAG | This paper | N/A | Encodes CrHsp104E283A:E681A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CrHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes CrHsp104E283Q:E681Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CrHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes CrHsp104E283Q:E681Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CCSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CCSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CCCS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CCCS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SSCS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SSCS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-CSCS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-CSCS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PeHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PeHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pInducer20-PeHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PeHsp104DN-FLAG | This paper | N/A | Encodes PeHsp104163-914; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PeHsp104DN-FLAG | This paper | N/A | Encodes PeHsp104163-914; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PeHsp104DWA(KA)-FLAG | This paper | N/A | Encodes PeHsp104K214A:K613A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PeHsp104DWA(KA) FLAG | This paper | N/A | Encodes PeHsp104K214A:K613A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PeHsp104DWA(KT)-FLAG | This paper | N/A | Encodes PeHsp104K214T:K613T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PeHsp104DWA(KT) FLAG | This paper | N/A | Encodes PeHsp104K214T:K613T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PeHsp104DPLA-FLAG | This paper | N/A | Encodes PeHsp104Y253A:Y655A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PeHsp104DPLA-FLAG | This paper | N/A | Encodes PeHsp104Y253A:Y655A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PeHsp104DWB(EA)-FLAG | This paper | N/A | Encodes PeHsp104E281A:E680A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PeHsp104DWB(EA) FLAG | This paper | N/A | Encodes PeHsp104E281A:E680A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PeHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes PeHsp104E281Q:E680Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PeHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes PeHsp104E281Q:E680Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PPSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PPSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PPPS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PPPS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SSPS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SSPS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PSPS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-PSPS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SrHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SrHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pInducer20-SrHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SrHsp104DN-FLAG | This paper | N/A | Encodes SrHsp104160-892; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SrHsp104DN-FLAG | This paper | N/A | Encodes SrHsp104160-892; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SrHsp104DWA(KA)-FLAG | This paper | N/A | Encodes SrHsp104K213A:K624A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SrHsp104DWA(KA) FLAG | This paper | N/A | Encodes SrHsp104K213A:K624A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SrHsp104DWA(KT)-FLAG | This paper | N/A | Encodes SrHsp104K213T:K624T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SrHsp104DWA(KT) FLAG | This paper | N/A | Encodes SrHsp104K213T:K624T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SrHsp104DPLA-FLAG | This paper | N/A | Encodes SrHsp104Y251A:Y666A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SrHsp104DPLA-FLAG | This paper | N/A | Encodes SrHsp104Y251A:Y666A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SrHsp104DWB(EA)-FLAG | This paper | N/A | Encodes SrHsp104E279A:E691A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SrHsp104DWB(EA) FLAG | This paper | N/A | Encodes SrHsp104E279A:E691A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SrHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes SrHsp104E279Q:E691Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SrHsp104DWB(EQ) FLAG | This paper | N/A | Encodes SrHsp104E279Q:E691Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-RSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-RSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-RRSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-RRSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-RRRS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-RRRS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SSRS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SSRS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-RSRS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-RSRS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pMCSG-TtHsp104 | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pDAT-TtHsp104 | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtHsp104DN-FLAG | This paper | N/A | Encodes TtHsp104173-923; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtHsp104DWA(KA)-FLAG | This paper | N/A | Encodes TtHsp104K226A:K637A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtHsp104DWA(KT)-FLAG | This paper | N/A | Encodes TtHsp104K226T:K637T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtHsp104DPLA-FLAG | This paper | N/A | Encodes TtHsp104Y265A:Y679A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtHsp104DWB(EA)-FLAG | This paper | N/A | Encodes TtHsp104E293A:E704A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtHsp104DWB(EQ) FLAG | This paper | N/A | Encodes TtHsp104E293Q:E704Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtTtSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtTtTtS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SSTtS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TtSTtS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pMCSG-TlHsp104 | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pDAT-TlHsp104 | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlHsp104DN-FLAG | This paper | N/A | Encodes TlHsp104173-922; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlHsp104DN-FLAG | This paper | N/A | Encodes TlHsp104173-922; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlHsp104DWA(KA)-FLAG | This paper | N/A | Encodes TlHsp104K226A:K638A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlHsp104DWA(KA) FLAG | This paper | N/A | Encodes TlHsp104K226A:K638A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlHsp104DWA(KT)-FLAG | This paper | N/A | Encodes TlHsp104K226T:K638T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlHsp104DWA(KT) FLAG | This paper | N/A | Encodes TlHsp104K226T:K638T; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlHsp104DPLA-FLAG | This paper | N/A | Encodes TlHsp104Y265A:Y680A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlHsp104DPLA-FLAG | This paper | N/A | Encodes TlHsp104Y265A:Y680A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlHsp104DWB(EA)-FLAG | This paper | N/A | Encodes TlHsp104E293A:E705A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlHsp104DWB(EA)-FLAG | This paper | N/A | Encodes TlHsp104E293A:E705A; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes TlHsp104E293Q:E705Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlHsp104DWB(EQ)-FLAG | This paper | N/A | Encodes TlHsp104E293Q:E705Q; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlSSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlTlSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlTlSS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlTlTlS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlTlTlS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-SSTlS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-SSTlS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TlSTlS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TlSTlS-FLAG | This paper | N/A | Chimera sequence available in Supplementary file 2; full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-ClpB-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-ClpBK476C-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-ClpBY503D-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-ClpB-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-ClpGGI-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-DdHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-DdHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-AtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-AtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-ChtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-ChtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-LtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-LtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-MtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-MtHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-StHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-StHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-TaHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pRS313HSE-TaHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG416GAL-PfHsp104-FLAG | This paper | N/A | Full description can be found in Materials and methods: Plasmids |
Recombinant DNA reagent | pAG303GAL-TDP43 | Johnson et al., 2009 | N/A | |
Recombinant DNA reagent | pAG303GAL-TDP43-GFPS11 | Jackrel et al., 2014 | N/A | |
Recombinant DNA reagent | pAG305GAL-GFPS1-10 | Jackrel et al., 2014 | N/A | |
Recombinant DNA reagent | pAG303GAL-FUS | Sun et al., 2011 | N/A | |
Recombinant DNA reagent | pAG303GAL-aSyn-YFP | Gitler et al., 2008 | N/A | |
Recombinant DNA reagent | pAG304GAL-aSyn-YFP | Gitler et al., 2008 | N/A | |
Recombinant DNA reagent | pE-SUMO-Ssa1 | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pE-SUMO-Hsc70 | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pE-SUMO-Sis1 | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pE-SUMO-Ydj1 | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pE-SUMO-Hdj1 | Michalska et al., 2019 | N/A | |
Recombinant DNA reagent | pE-SUMO-Hdj2 | Michalska et al., 2019 | N/A | |
Sequence-based reagent | CtHsp104 forward | This paper | qPCR primer | GACGAAGCGTGTGCCAATAC |
Sequence-based reagent | CtHsp104 reverse | This paper | qPCR primer | CACTTCCTGGAGCCGCTG |
Sequence-based reagent | TtHsp104 forward | This paper | qPCR primer | CAACTACTTCCTGCCCGAG |
Sequence-based reagent | TtHsp104 reverse | This paper | qPCR primer | ATCTGGACGTTGCGGTCGT |
Sequence-based reagent | TlHsp104 forward | This paper | qPCR primer | AACCGTCTCACCAAGCGTG |
Sequence-based reagent | TlHsp104 reverse | This paper | qPCR primer | GCCTCTCCGAGATAGTCCT |
Sequence-based reagent | aSyn forward | This paper | qPCR primer | ATGTAGGCTCCAAAACCAAGG |
Sequence-based reagent | aSyn reverse | This paper | qPCR primer | ACTGCTCCTCCAACATTTGTC |
Sequence-based reagent | snb-1 forward | This paper | qPCR primer | CCGGATAAGACCATCTTGACG |
Sequence-based reagent | snb-1 reverse | This paper | qPCR primer | GACGACTTCATCAACCTGAGC |
Sequence-based reagent | cdc-42 forward | This paper | qPCR primer | CCGAGAAAAATGGGTGCCTG |
Sequence-based reagent | cdc-42 reverse | This paper | qPCR primer | TTCTCGAGCATTCCTGGATCAT |
Sequence-based reagent | tba-1 forward | This paper | qPCR primer | ATCTCTGCTGACAAGGCTTAC |
Sequence-based reagent | tba-1 reverse | This paper | qPCR primer | GTACAAGAGGCAAACAGCCAT |
Peptide, recombinant protein | ScHsp104 | Jackrel et al., 2014 | N/A | |
Peptide, recombinant protein | ScHsp104A503S | Jackrel et al., 2014 | N/A | |
Peptide, recombinant protein | MbHsp104 | This paper | N/A | Full description can be found in Materials and methods: Protein expression and purification |
Peptide, recombinant protein | CrHsp104 | This paper | N/A | Full description can be found in Materials and methods: Protein expression and purification |
Peptide, recombinant protein | His6-(TevC)-CtHsp104 | Michalska et al., 2019 | N/A | |
Peptide, recombinant protein | His6-(TevC)-TtHsp104 | This paper | N/A | Full description can be found in Materials and methods: Protein expression and purification |
Peptide, recombinant protein | His6-(TevC)-TlHsp104 | This paper | N/A | Full description can be found in Materials and methods: Protein expression and purification |
Peptide, recombinant protein | His6-SUMO-Ssa1 | Michalska et al., 2019 | N/A | |
Peptide, recombinant protein | His6-SUMO-Hsc70 | Michalska et al., 2019 | N/A | |
Peptide, recombinant protein | His6-SUMO-Sis1 | Michalska et al., 2019 | N/A | |
Peptide, recombinant protein | His6-SUMO-Ydj1 | Michalska et al., 2019 | N/A | |
Peptide, recombinant protein | His6-SUMO-Hdj1 | Michalska et al., 2019 | N/A | |
Peptide, recombinant protein | His6-SUMO-Hdj2 | Michalska et al., 2019 | N/A | |
Peptide, recombinant protein | Firefly luciferase | Sigma-Aldrich | L9506 | |
Peptide, recombinant protein | MBP-(TevC)-TDP43 | This paper | N/A | Full description can be found in Materials and methods: Protein expression and purification |
Commercial assay or kit | PiColorLock Phosphate Detection | Innova | Cat# 601–0120 | |
Commercial assay or kit | Luciferase assay reagent | Promega | E1483 | |
Chemical compound, drug | Creatine phosphate | Roche | 10621722001 | |
Chemical compound, drug | ATP | Sigma-Aldrich | A3377 | |