Molecular rationale for antibody-mediated targeting of the hantavirus fusion glycoprotein
- Division of Structural Biology, Wellcome Centre for Human Genetics, University of Oxford, United Kingdom
- Helsinki Institute of Life Science HiLIFE, University of Helsinki, Finland
- Molecular and Integrative Biosciences Research Programme, The Faculty of Biological and Environmental Sciences, University of Helsinki, Finland
- Department of Infectious Diseases, King's College London, Guy's Hospital, United Kingdom
- Institute of Veterinary Pathology, Vetsuisse Faculty, University of Zürich, Switzerland
- Department of Virology, Medicum, Faculty of Medicine, University of Helsinki, Finland
- Departments of Virology and Veterinary Biosciences, University of Helsinki and HUSLAB, Helsinki University Hospital, Finland
- Zoonosis Science Center, Department of Medical Biochemistry and Microbiology, Uppsala University, Sweden
- CIRI, Centre International de Recherche en Infectiologie, INSERM U1111, CNRS UMR5308, Université Lyon, France
Figures
Figure 1 with 1 supplement
Composition and neutralization potency of recombinantly-derived bank vole mAb P-4G2.
(A) Composition of the complementarity-determining regions (CDRs) of the mAb P-4G2 antigen-binding fragment (Fab) heavy (VH) and kappa (VK) chains. For the full sequence of Fab P-4G2 variable …
Figure 1—figure supplement 1
Sequence alignment of antibody variable regions from bank vole mAb P-4G2 and a representative mouse antibody.
Fab P-4G2 variable regions with variable regions from representative mouse (Mus musculus) antibodies. Mouse homologues used in the alignment were identified by NCBI BLAST (Altschul et al., 1990; John…
Figure 2 with 3 supplements
Crystal structure of neutralizing antibody P-4G2 in complex with Puumala virus (PUUV) Gc.
(A) Crystal structure of Fab P-4G2−PUUV Gc complex at 3.5 Å resolution. PUUV Gc, a class II fusion protein, comprises domains I−III (colored red, yellow, and blue, respectively), a Gc C-terminal …
Figure 2—figure supplement 1
Electron density at the Fab P-4G2−Puumala virus (PUUV) Gc interface.
Stereo-view of the interaction between PUUV Gc and CDRH3 of Fab P-4G2, with the simulated annealing composite omit electron density map shown contoured at 1σ. The structure is shown in stick …
Figure 2—figure supplement 2
Key interactions at the Fab P-4G2−Puumala virus Gc complex interface.
Paratope and epitope residues involved in hydrogen bonding (dashed black lines) for contacts made by the heavy (A) and light (B) chains were identified using the PDBePISA server (Krissinel and …
Figure 2—figure supplement 3
Sequence conservation at the mAb P-4G2 epitope.
A sequence alignment of Gc glycoproteins from Puumala virus (PUUV; CAB43026.1), Andes virus (ANDV; AAO86638.1), and Hantaan virus (HTNV; AIL25319.1) numbered according to PUUV Gc. In the alignment, …
Figure 3 with 1 supplement
The epitope of antibody P-4G2 denotes a key antigenic site at the hantaviral surface.
(A) Puumala virus (PUUV) Gc from the Gc-4G2 complex displays a domain III conformation distinct from that observed in (B) post-fusion PUUV Gc (Willensky et al., 2016). (C) Fab P-4G2 binding …
Figure 3—figure supplement 1
Overlay analysis of viral class II fusion proteins with Puumala virus (PUUV) GcGc-P-4G2 indicates that PUUV Gc has crystallized in a conformation similar to the pre-fusion conformation.
(A) The conformation of PUUV GcGc-P-4G2 is distinct from (B) the previously reported PUUV Gc post-fusion structure (PDB 5J9H) (Willensky et al., 2016), and from (C) the intermediate configuration of …
Figure 4 with 2 supplements
Treatment of Puumala virus (PUUV) virus-like particles (VLPs) with Fab P-4G2 results in additional density and is associated with loss of continuous lattice at the VLP surface.
Cryo-ET reconstructions of the Fab P-4G2-treated PUUV VLP surface, derived from (A) regions of continuous lattice (14.3 Å) and (B) regions of incomplete lattice (13.4 Å). While both reconstructions …
Figure 4—figure supplement 1
The Puumala virus (PUUV) virus-like particle (VLP) surface displays ordered regions of glycoprotein lattice and is congruent with previously published reconstructions.
Size-distribution plot of the VLPs (upper right corner) shows that the pleomorphic particles vary in size, with most particles measuring between 80 and 100 nm in the longest dimension. Despite the …
Figure 4—figure supplement 2
Treatment with Fab P-4G2 alters the presentation of the hantaviral glycoprotein lattice at the surface of Puumala virus (PUUV) virus-like particles (VLPs).
Tomographic slices of the selected PUUV VLPs (left) and corresponding Mercator projections (right) describing the positions of (Gn−Gc)4 spikes on VLP surfaces are shown (A) in the absence and (B) …
Figure 5
Fitting of the Fab P-4G2−Puumala virus (PUUV) Gc crystal structure into the cryo-ET reconstruction confirms the P-4G2 epitope in the context of the viral surface and supports the hypothesis that the observed Gc conformation constitutes a pre-fusion state.
(A) Side view and (B) top view of the Fab P-4G2-treated PUUV virus-like particle (VLP) spike at 13.4 Å resolution. Crystal structures of Fab P-4G2−PUUV, along with PUUV Gn (PDB id 5FXU), were fitted …
Figure 6 with 2 supplements
Fitting of Puumala virus (PUUV) Gn and Gc into the cryo-ET-derived reconstruction of PUUV virus-like particles (VLPs) shows that lattice formation is mediated by Gc homo-dimers.
(A) Top- and side views of the PUUV lattice. Crystal structures of PUUV Gc from the Fab P-4G2 complex, and PUUV Gn (PDB id: 5FXU) are shown fitted into a cryo-ET reconstruction of the PUUV VLP …
Figure 6—figure supplement 1
Domain I mediates dimer contacts at the Gc–Gc interface.
(A) Gc homodimer interface generated by fitting Puumala virus (PUUV) GcGc-P-4G2 into a cryo-ET reconstruction of PUUV virus-like particle (VLP) surface at 13.9 Å resolution (see also Figure 6C). …
Figure 6—figure supplement 2
Fab P-4G2 epitopes from neighboring Puumala virus (PUUV) Gc proteins within the Gn−Gc lattice are in close proximity.
Top (panel A) and side (panel B) view representations of the PUUV Gn–Gc surface at the Fab P-4G2 epitope are shown. The surface of PUUV Gn and Gc are colored according to the legend at the bottom of …
Author response image 1
A representative example of a hantaviral lattice “break point” displayed as a Mercator projection.
Points colored blue represent points that were manually picked and aligned to generate the map in Author response image 2. This figure is adapted from Figure 4—figure supplement 2.
Author response image 2
A reconstruction of a hantaviral spike using particles manually picked from “break points” in the lattice.
The resulting map displays an empty patch of membrane where an 8th neighbour would normally be expected as indicated with a dashed circle. Additional density that likely corresponds to fab P-4G2 is …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Puumala orthohantavirus) | Glycoprotein precursor (GPC); used in recombinant Gc production | GenBank | CAB43026.1 | Synthetic cDNA was produced by GeneArt, Life Technologies |
| Gene (Puumala orthohantavirus) | Glycoprotein precursor (GPC); used in PUUV VLP production | GenBank | CCH22848.1 | Synthetic cDNA was produced by GeneArt, Life Technologies |
| Gene (Hantaan orthohantavirus) | Glycoprotein precursor (GPC) | GenBank | AIL25321.1 | Synthetic cDNA was produced by GeneArt, Life Technologies |
| Gene (Andes orthohantavirus) | Glycoprotein precursor (GPC) | GenBank | AAO86638.1 | Synthetic cDNA was produced by GeneArt, Life Technologies |
| Strain, strain background (Escherichia coli) | Subcloning Efficiency DH5α Competent Cells | Thermo Fisher Scientific | Cat#: 18265017 | Competent cells |
| Cell line (Homo-sapiens) | Human embryonic kidney HEK 293T | ATCC | CRL-3216 | |
| Cell line (Homo-sapiens) | Human embryonic kidney HEK293F | Thermo Fisher Scientific | Cat#: R79007 | |
| Biological sample (Myodes Glareolus, Mus musculus) | Bank vole-mouse heterohybridoma producing mAb P-4G2 | Lundkvist and Niklasson, 1992 | ||
| Biological sample (Indiana vesiculovirus) | VSV-ΔG RFP | Reynard and Volchkov, 2015 | ||
| Recombinant DNA reagent | pHLsec plasmid | Aricescu et al., 2006 | ||
| Recombinant DNA reagent | pHLsec-8H-SUMO-1D4 plasmid | Chang et al., 2015 | ||
| Recombinant DNA reagent | pgk-φC31/pCB92 plasmid | Chen et al., 2011 | ||
| Recombinant DNA reagent | pURD plasmid | Zhao et al., 2014 | ||
| Recombinant DNA reagent | Tim1/pCAGGs plasmid | Watt et al., 2014 | ||
| Recombinant DNA reagent | pCAGGS plasmid | Niwa et al., 1991 | ||
| Recombinant DNA reagent | Mouse IgG1 plasmid | von Boehmer et al., 2016 | ||
| Recombinant DNA reagent | Mouse IgK plasmid | von Boehmer et al., 2016 | ||
| Recombinant DNA reagent | Fab P-4G2 light chain synthetic DNA fragment | This study | Synthetic cDNA was produced by GeneArt, Life Technologies | |
| Recombinant DNA reagent | Fab P-4G2 heavy chain synthetic DNA fragment | This study | Synthetic cDNA was produced by GeneArt, Life Technologies | |
| Sequence-based reagent | Mouse IgG sequencing primers | von Boehmer et al., 2016 | List of primer sequences is provided in the referenced study | |
| Sequence-based reagent | PUUV Gc ectodomain cloning primer, forward | This study | CGCACCGGTGAGACACAGAACCTGAACAGCGGC | |
| Sequence-based reagent | PUUV Gc ectodomain cloning primer, reverse | This study | GCGGTACCCTCGCCGGACTTGGTGAACC | |
| Sequence-based reagent | Fab P-4G2 HC R100A mutagenesis primer, forward | This study | GTATTACTGTACAAGAGATGCATTAGGCCCTTTTGA | |
| Sequence-based reagent | Fab P-4G2 HC R100A mutagenesis primer, reverse | This study | TCAAAAGGGCCTAATGCATCTCTTGTACAGTAATAC | |
| Commercial assay or kit | Phusion High-Fidelity PCR Master Mix with HF Buffer | New England Biolabs | Cat#: M0531S | |
| Commercial assay or kit | SuperScript III reverse transcriptase | Thermo Fisher Scientific | Cat#: 18080093 | |
| Commercial assay or kit | Quick Ligation kit | New England Biolabs | Cat#: M2200S | |
| Chemical compound, drug | PEI Max 40K | Polysciences, Inc | Cat#: 24765–1 | |
| Chemical compound, drug | PEI | Polysciences, Inc | Cat#: 23966–1 | |
| Chemical compound, drug | Lipofectamine 2000 Transfection reagent | Thermo Fisher Scientific | Cat#: 11668027 | |
| Chemical compound, drug | Kifunensine | Cayman Chemical | Cat#: 10009437 | |
| Software, algorithm | XIA2 | Winter, 2010 | ||
| Software, algorithm | CCP4 | Potterton et al., 2003 | ||
| Software, algorithm | SWISS-MODEL | Waterhouse et al., 2018 | ||
| Software, algorithm | Coot | Emsley and Cowtan, 2004 | ||
| Software, algorithm | REFMAC | Murshudov et al., 1997 | ||
| Software, algorithm | PHENIX | Adams et al., 2002 | ||
| Software, algorithm | Molprobity | Davis et al., 2007 | ||
| Software, algorithm | IMGT/V-QUEST server | Brochet et al., 2008 | ||
| Software, algorithm | GraphPad Prism | GraphPad Software, San Diego, CA, USA | ||
| Software, algorithm | PDBePISA server | Krissinel and Henrick, 2007 | ||
| Software, algorithm | PyMOL | The PyMOL Molecular Graphics System, Schrödinger, LLC | ||
| Software, algorithm | UCSF Chimera | Pettersen et al., 2004 | ||
| Software, algorithm | LigPlot+ software | Laskowski and Swindells, 2011 | ||
| Software, algorithm | Motioncor2 | Zheng et al., 2017 | ||
| Software, algorithm | CTFFIND4 | Rohou and Grigorieff, 2015 | ||
| Software, algorithm | tomo_preprocess script | This study | ||
| Software, algorithm | IMOD | Mastronarde and Held, 2017 | ||
| Software, algorithm | Dynamo | Castaño-Díez et al., 2012 | ||
| Software, algorithm | PatchFinder script | This study | ||
| Other | Chromatography column, Superdex 200 10/300 Increase | Cytiva | Cat#: 28990944 | |
| Other | Chromatography column, HisTrap FF Crude 5 ml | Cytiva | Cat#: 17528601 | |
| Other | 1-MDa cut-off dialysis membrane | Spectrum Chemical | ||
| Other | Holey carbon grids, 2 μm hole diameter | Protochips |
Additional files
-
Supplementary file 1
Table S1: Crystallographic data collection and refinement statistics for Fab P-4G2−Puumala virus Gc.
Table S2. Cryo-EM tomography data collection, sub-tomogram reconstruction, and fitting statistics.
- https://cdn.elifesciences.org/articles/58242/elife-58242-supp1-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/58242/elife-58242-transrepform-v1.docx
