Structural basis for histone variant H3tK27me3 recognition by PHF1 and PHF19

Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Tianjin Medical University, China
Laboratory for Phyloinformatics, RIKEN Center for Biosystems Dynamics Research, Japan
Department of Cardiac Surgery, Asahikawa Medical University, Japan
Structural Genomics Consortium, University of Toronto, Canada
Division of Chromatin Regulation, National Institute for Basic Biology, Japan
Department of Basic Biology, School of Life Science, The Graduate University for Advanced Studies (SOKENDAI), Japan
Centre for Advanced Research and Education, Asahikawa Medical University, Japan
Department of Physiology, University of Toronto, Canada

Sep 1, 2020

https://doi.org/10.7554/eLife.58675

Open access
Copyright information

Figures
Tables
Additional files

7 figures, 3 tables and 2 additional files

Figures

Figure 1

Download asset Open asset

Tudor domains of PHF1 and PHF19 preferentially recognize H3K36me3 and H3tK27me3.

(A) Schematic representation of domain structures of PHF1, MTF2, and PHF19. PHD: plant homeodomain finger. EH: extended homologous domain. (B) Peptide sequences of H3K36me3, H3K27me3, and H3tK27me3. The methylated lysines are colored in red. A24 of histone H3 and V24 of histone H3t are colored in blue. (C) Sequence alignment of the Tudor domains of PHF1, MTF2, and PHF19. The secondary structure elements are shown above the alignment. Identical residues and conserved residues are highlighted in red and olive-green backgrounds, respectively. The residues forming the aromatic cage and the leucyl patch are colored in red and blue, respectively. (**D-F**) ITC measurements of the interactions of the Tudor domains of PHF1, PHF19, and MTF2 with the H3K36me3, H3tK27me3, and H3K27me3 peptides. (G) Superposition of the aromatic cage residues of PHF1-H3tK27me3 complex (green, this study), MTF2-H3K36me3 (yellow, PDB: 5XFR), and PHF19-H3tK27me3 complex (cyan, this study). The trimethyl-lysine is shown as salmon sticks.

Figure 2

Download asset Open asset

PHF1 is associated with the H3t in vivo.

(A) Expression levels of PHF1 in different mouse tissues using the RT-qPCR analysis. (B) Immunostaining of testis sections by antibodies against H3t (green) and PHF1 (red). Seminiferous tubules at stages IX-X are indicated and magnified images of the pachytene stage nuclei are shown in each panel. Scale bars, 100 μm and 10 μm, in magnified image. (C) PHF1 expression during meiosis. Note that PHF1 started to accumulate in the nucleus from the pachytene stage. Scale bar, 10 μm. (D) PHF1 (red) and H3t (green) co-localize from the pachytene until the round spermatid stage. Scale bar, 10 μm. (E) PHF1 was excluded from the XY body. Testis sections were stained with anti-PHF1 (red) and anti–γH2AX (green) antibodies and the pachytene stage nucleus is indicated. H3t is also excluded from the XY body. Scale bar, 10 μm.

Figure 3

Download asset Open asset

PHF1-Tudor could enrich H3t peptides.

(**A, B**) In vitro GST pull-down assays using GST-tagged PHF1-Tudor proteins and histones prepared from H3t-expressed HEK293T cells. GST proteins from input, bound, and unbound flow-through (FT) fractions were analyzed using SDS-PAGE with Coomassie Brilliant Blue (CBB) staining (A). Input and bound histones were analyzed using western blotting with indicated antibodies (B). (C) MS/MS spectrum of the histone H3t peptide corresponding to residues 19–36. The observed y and b ions and fragment map are shown. (D) Spectral counts of methylated lysine residues in input or pull-down fractions. Control histones (Input) or pooled histones pulled-down with the GST-PHF1-Tudor (pull-down) were digested with LysN proteinase and subjected to LC-MS/MS analysis (detected peptides were summarized in Supplementary file 1). The spectral counts of methylated lysine residues in each fraction are shown. Since short peptides cleaved at unmodified lysine residues could not be efficiently detected in the LC-MS/MS analysis, these data do not accurately reflect their abundance.

Figure 4

Download asset Open asset

Crystal structures of PHF1/19-Tudor domain in complex with H3tK27me3.

(A) Overall structure of PHF1-Tudor in complex with H3tK27me3. PHF1-Tudor is shown in cartoon representation and colored in green. The H3tK27me3 peptide is colored in salmon and shown as sticks. (B) Overall structure of PHF19-Tudor in complex with H3tK27me3. PHF19-Tudor is shown in cartoon representation and colored in green. The H3tK27me3 peptide is colored in cyan and shown as sticks. (C) Close-up view of the detailed interactions between PHF1-Tudor and the H3tK27me3 peptide. The H3tK27me3 peptide is shown as salmon sticks and the peptide interacting residues in PHF1 are shown as green sticks. The hydrogen bonds are indicated as dash lines and two involved water molecules are shown as spheres. (D) Close-up view of the detailed interactions between PHF19-Tudor and the H3tK27me3 peptide. The H3tK27me3 peptide and the peptide interacting residues in PHF19 are shown as cyan and green sticks, respectively. The hydrogen bonds are indicated as dash lines. (**E-F**) PHF1-Tudor and PHF19-Tudor are displayed in surface representations with the H3tK27me3 peptide shown as green sticks. The three interaction regions of PHF1 and PHF19: hydrophobic patch, negative groove, and aromatic cage are colored in cyan, magenta, and salmon, respectively. The residues of PHF1/19 involved in the interactions are shown as sticks.

Figure 5

Download asset Open asset

H3tK27me3 and H3K36me3 peptides bound to PHF1/19 within the same binding grooves but in reverse directions.

(A) Superposition of the complex structures of PHF1-H3tK27me3 and PHF1-H3K36me3 (PDB: 4HCZ). The PHF1-Tudor is shown in a gray surface representation. The H3tK27me3 and H3K36me3 peptides are shown as salmon and pale green cartoons, respectively. (B) Superposition of the complex structures of PHF19-H3tK27me3 and PHF19-H3K36me3 (PDB: 4BD3). The PHF19-Tudor is shown in a gray surface representation. The H3tK27me3 and H3K36me3 peptides are shown as cyan and yellow cartoons, respectively. (C) Comparison of the detailed interactions of the H3tK27me3 and H3K36me3 peptides with PHF1. The H3tK27me3 and H3K36me3 peptides are shown in salmon and pale green sticks, respectively, and the key interacting residues of PHF1 are shown as light orange sticks. (D) Comparison of the detailed interactions of the H3tK27me3 and H3K36me3 peptides with PHF19. The H3tK27me3 and H3K36me3 peptides are shown in cyan and yellow sticks, respectively, and the key interacting residues of PHF19 are shown as light orange sticks. (E) Multiple sequence alignment of different peptides. The trimethylated lysines in the peptides are defined as position zero. The H3K36me3 sequence is aligned in a reverse direction. The relatively conserved motif is indicated in a green background.

Figure 6

Download asset Open asset

V24 of H3t is an optimal residue for the H3t recognition by the Tudor domain of PHF1/19.

(A) Binding affinities of PHF1 and PHF19 Tudor domain with various peptides determined using ITC. (B) The crystal structure of PHF1 in complex with H3K36me3H39V. The mutant H3K36me3H39V peptide is shown as a stick in light magenta. PHF1 is shown as surface and the hydrophobic patch surrounding V39 is indicated in cyan. Some additional interactions in the H3K36me3-H39V mutant are indicated with dash lines. (C) Structural comparison of PHF1-H3K36me3 (PDB: 4HCZ) and PHF1-H3K36me3-H39V. The four leucines involved in hydrophobic interactions are shown with stick in cyan. The H3K36me3 peptide and H3K36me3-H39V mutant are shown as cartoon in pale green and light magenta, respectively. (D) The sequence alignment of H3t from human, mouse, and rat. The secondary structure elements are shown above the sequence. Identical residues are indicated in aqua and the different residues are colored in red.

Author response image 1

Download asset Open asset

Tables

Table 1

Binding affinities of PHF1/MTF2 mutants with the H3tK27me3 peptide.

PHF1	ITC (µM)
W41A	NB
Y47A	NB
F65A	NB
F71A	192 ± 18
L38A	125 ± 9
L45A	178 ± 9
L46A	127 ± 8
L46Y	50 ± 5
L48A	81 ± 2
L38A, L45A, L46A, L48A	>500
E66A	>200
MTF2	ITC (µM)
S86F	91 ± 21
S86Y	110 ± 11

NB indicates no detectable binding.

Table 2

Data collection and refinement statistics.

	PHF1-H3tK27me3	PHF19-H3tK27me3	PHF1-H3K36me3-H39V
PDB ID	6WAU	6WAT	6WAV
Data collection
Space group	P2₁	P3₂	C2
Cell (a,b,c (Å)) (α, β, γ (°))	32.8, 286.8, 123.5 90, 90.7, 90	111.5, 111.5, 34.4 90, 90, 120	153.0, 65.6, 29.0 90, 97.1, 90
Resolution (Å)	47.80–1.80 (1.83–1.80)	55.74–1.71 (1.74–1.71)	40.07–1.70 (1.73–1.70)
Rmerge overall	0.071 (0.939)	0.048 (1.314)	0.048 (0.416)
Rmeas overall	0.082 (1.117)	0.054 (1.608)	0.056 (0.487)
No. reflections	207862 (9809)	51838 (2547)	29381 (1501)
Mean I/sigma	10.5 (1.3)	21.6 (0.7)	16.4 (3.1)
CChalf	0.999 (0.706)	1.000 (0.190)	0.998 (0.810)
Completeness (%)	99.2 (93.7)	99.4 (92.1)	93.8 (90.9)
Multiplicity	3.8 (3.3)	5.4 (2.9)	3.7 (3.6)
Model refinement
Resolution (Å)	40.76–1.80	48.27–1.75	32.80–1.70
Reflections/free	395473/19949	48195/2242	29359/1455
Rwork/Rfree	0.215/0.260	0.209/0.251	0.198/0.242
All (No. atoms/mean B (Å²))	33004/39.0	3137/30.0	2348/20.8
Tudor	27847/38.7	2697/29.6	1878/19.5
Peptide	4169/42.0	383/32.2	306/26.0
Water	953/36.5	47/30.7	132/25.1
Others	35/31.9	10/26.7	32/27.4
rmsd bonds (Å)/angles (°)	0.011/1.1	0.012/1.9	0.011/1.7

Values in parentheses are for the highest-resolution shell.

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Mus musculus)	H3.4 histone (H3t)	GenBank	382523
Gene (Homo sapiens)	PHF1	GenBank	5252
Strain, strain background (Escherichia coli)	BL21(DE3)	Thermo Fisher	C600003
Cell line (Homo sapiens)	293T/17	ATCC	CRL-11268
Antibody	Anti-histone H3 (rabbit polyclonal)	abcam	ab1791	WB (1:2000)
Antibody	Anti-histone H3t (mouse monoclonal)	This paper Ueda et al., 2017		WB (1:1000) IF (1:1000)
Antibody	Anti-PHF1 (rabbit polyclonal)	Abcam	Cat# ab80042	IF (1:500)
Antibody	Anti-SCP3 (mouse monoclonal)	Abcam	10G11/7 Cat# ab97672	IF (1:1000)
Antibody	Anti-γ H2A.X (mouse monoclonal)	Merck Millipore	Cat# #05–636	IF (1:1000)
Antibody	Lectin PNA tagged with Alexa Fluor 488	Thermo Fisher	Cat# L21409	IF (1:1000)
Sequence-based reagent	Eef1a1–Fw	Ueda et al., 2017	PCR primers	CTCTGACTACCCTCCACTTGGTCG
Sequence-based reagent	Eef1a1–Rev	Ueda et al., 2017	PCR primers	ATTAAGACTGGGGTGGCAGGTGTT
Sequence-based reagent	Phf1–Fw	This paper	PCR primers	TGAGAAGTGTCGCCATGCTTA
Sequence-based reagent	Phf1–Rev	This paper	PCR primers	CATAGGGACCTTTCTTCAGTGC
Recombinant DNA reagent	pET28-MHL	SGC, Toronto	26096 (Genbank accession number: EF456735)	Expression of the Tudor domains of PHF1, MTF2 and PHF19, and their mutants
Software, algorithm	Origin 6.1, Origin 7.0	OriginLab	http://www.originlab.com/	For ITC curve fitting and calculation of Kd values
Software, algorithm	XDS	PMID:20124692	http://xds.mpimf-heidelberg.mpg.de/	Processing of X-ray diffraction data
Software, algorithm	Pymol	DeLano Scientific LLC	http://www.pymol.org/	Drawing structure figures
Software, algorithm	Coot	PMID:15572765	http://www2.mrc-lmb.cam.ac.uk/Personal/pemsley/coot/	Structure model building
Software, algorithm	CCP4	PMID:21460441	https://www.ccp4.ac.uk/	Structure determination and refinement
Software, algorithm	MASCOT program	Matrix Science		Version 2.6
Software, algorithm	Proteome discoverer 2.2	Thermo Fisher
Other	Hoechst 33342	Thermo Fisher	Cat# H3570	IF (1:5000)