TFEB/Mitf links impaired nuclear import to autophagolysosomal dysfunction in C9-ALS

  1. Kathleen M Cunningham
  2. Kirstin Maulding
  3. Kai Ruan
  4. Mumine Senturk
  5. Jonathan C Grima
  6. Hyun Sung
  7. Zhongyuan Zuo
  8. Helen Song
  9. Junli Gao
  10. Sandeep Dubey
  11. Jeffrey D Rothstein
  12. Ke Zhang
  13. Hugo J Bellen
  14. Thomas E Lloyd  Is a corresponding author
  1. Cellular and Molecular Medicine Program, School of Medicine, Johns Hopkins University, United States
  2. Department of Neurology, School of Medicine, Johns Hopkins University, United States
  3. Program in Developmental Biology, Baylor College of Medicine (BCM), United States
  4. Brain Science Institute, School of Medicine, Johns Hopkins University, United States
  5. Solomon H. Snyder Department of Neuroscience, School of Medicine, Johns Hopkins University, United States
  6. Department of Molecular and Human Genetics, BCM, United States
  7. Department of Neuroscience, Mayo Clinic, United States
  8. Department of Neuroscience, BCM, United States
  9. Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital, United States
  10. Howard Hughes Medical Institute, United States

Abstract

Disrupted nucleocytoplasmic transport (NCT) has been implicated in neurodegenerative disease pathogenesis; however, the mechanisms by which disrupted NCT causes neurodegeneration remain unclear. In a Drosophila screen, we identified ref(2)P/p62, a key regulator of autophagy, as a potent suppressor of neurodegeneration caused by the GGGGCC hexanucleotide repeat expansion (G4C2 HRE) in C9orf72 that causes amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). We found that p62 is increased and forms ubiquitinated aggregates due to decreased autophagic cargo degradation. Immunofluorescence and electron microscopy of Drosophila tissues demonstrate an accumulation of lysosome-like organelles that precedes neurodegeneration. These phenotypes are partially caused by cytoplasmic mislocalization of Mitf/TFEB, a key transcriptional regulator of autophagolysosomal function. Additionally, TFEB is mislocalized and downregulated in human cells expressing GGGGCC repeats and in C9-ALS patient motor cortex. Our data suggest that the C9orf72-HRE impairs Mitf/TFEB nuclear import, thereby disrupting autophagy and exacerbating proteostasis defects in C9-ALS/FTD.

Introduction

A GGGGCC (G4C2) hexanucleotide repeat expansion (HRE) in chromosome nine open reading frame 72 (C9orf72) is the most common genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), accounting for up to 40% of cases of familial ALS (DeJesus-Hernandez et al., 2011; ITALSGEN Consortium et al., 2011). ALS and/or FTD caused by mutations in C9orf72 (C9-ALS/FTD) is inherited in an autosomal dominant manner, suggesting that the HRE causes disease through gain-of-function or haploinsufficiency (DeJesus-Hernandez et al., 2011; Ling et al., 2013). Loss of C9orf72 function has been linked to disruption of autophagy and lysosome function, though neurodegeneration is not observed in C9orf72 knockout mice (Liu et al., 2016; Shi et al., 2018; Webster et al., 2016), suggesting that C9-ALS/FTD is primarily caused by toxicity of the HRE. Furthermore, expression of G4C2 repeats causes neurotoxicity in Drosophila and cell culture models of C9-ALS (Goodman et al., 2019a; Kramer et al., 2016; Tran et al., 2015). This toxicity has been proposed to occur through either G4C2 repeat RNA-mediated sequestration of RNA-binding proteins or translation of the G4C2 repeats into dipeptide-repeat proteins (DPRs) through non-canonical repeat-associated non-AUG (RAN) translation (Donnelly et al., 2013; Goodman et al., 2019a; Mori et al., 2013; Tran et al., 2015).

We previously conducted a Drosophila screen of candidate proteins that bound with moderate-to-high affinity to G4C2 RNA and identified modulation of the nucleocytoplasmic transport (NCT) pathway as a potent modifier of G4C2 toxicity in both fly and iPS neuron models of C9-ALS (Zhang et al., 2015a), a finding that has also been made by other groups (Freibaum et al., 2015; Jovičić et al., 2015). The mechanisms by which the G4C2 HRE disrupts NCT remain unclear, but potential mechanisms include G4C2 RNA binding to the master NCT regulator RanGAP (Zhang et al., 2015a), DPRs disrupting the nuclear pore complex (Boeynaems et al., 2016; Shi et al., 2017; Zhang et al., 2016), stress granules sequestering NCT factors (Zhang et al., 2018), or cytoplasmic TDP-43-dependent dysregulation of karyopherin-α (Chou et al., 2018; Gasset-Rosa et al., 2019; Solomon et al., 2018). Recently, a role for NCT disruption in Huntington’s disease and Alzheimer’s disease has been proposed, indicating that NCT disruption may be a common mechanism in several neurodegenerative diseases (Eftekharzadeh et al., 2018; Gasset-Rosa et al., 2017; Grima et al., 2017). However, the pathways affected by NCT disruption that cause neurodegeneration have not yet been elucidated.

In a Drosophila screen for modifiers of G4C2-mediated neurodegeneration (Zhang et al., 2015a), we identified refractory to sigma P (ref(2)P), the Drosophila homolog of p62/SQSTM1 (Sequestosome 1). p62/SQSTM1 functions in macroautophagy (hereafter termed autophagy), and mutations in p62/SQSTM1 are a rare genetic cause of ALS/FTD (Cirulli et al., 2015; Le Ber et al., 2013; Teyssou et al., 2013). Interestingly, many other genes implicated in ALS/FTD function in autophagy (Evans and Holzbaur, 2019; Lin et al., 2017; Ramesh and Pandey, 2017) such as tank-binding kinase 1 (TBK1), optineurin (OPTN1), ubiquilin 2 and 4 (UBQLN2 and 4), valosin-containing protein (VCP), charged multivesicular body protein 2B (CHMP2B), VAMP-associated protein B (VapB), and the C9orf72 protein itself (O'Rourke et al., 2015; Sellier et al., 2016; Sullivan et al., 2016; Ugolino et al., 2016; Webster et al., 2016; Yang et al., 2016). Organelles and protein aggregates are degraded via polyubiquitination and targeting to a newly forming autophagosome, followed by degradation upon fusion with the lysosome. Deletion of key autophagy genes in neurons is sufficient to cause neurodegeneration in mice (Hara et al., 2006; Komatsu et al., 2006).

Although autophagy and nucleocytoplasmic transport have both been implicated in neurodegeneration, it is unclear whether or how these two pathways interact in disease pathogenesis (Gao et al., 2017; Thomas et al., 2013). Here, we show that expression of expanded G4C2 repeats is sufficient to disrupt autophagy in Drosophila, leading to an accumulation of p62 and ubiquitinated protein aggregates. We find that autophagolysosomal defects are caused by loss of nuclear localization of the transcription factor Mitf (the Drosophila homolog of TFEB), which regulates transcription of genes involved in autophagolysosome biogenesis (Bouché et al., 2016; Palmieri et al., 2011; Sardiello et al., 2009; Zhang et al., 2015b). Furthermore, suppressing this NCT defect is sufficient to rescue Mitf nuclear localization, restoring autophagy and lysosome function and rescuing neurodegeneration. These findings suggest a pathogenic cascade in C9-ALS/FTD whereby NCT disruption causes a failure of autophagosome biogenesis and lysosome dysfunction that ultimately leads to neuronal death.

Results

Ref(2)P/p62 knockdown suppresses G4C2-mediated neurodegeneration

Expression of 30 G4C2 repeats (30R) in the eye using GMR-Gal4 results in progressive photoreceptor degeneration and visible ommatidial disruption by day 15 (Figure 1AXu et al., 2013; Zhang et al., 2015a). In a genetic modifier screen of over 800 RNAi lines, UAS-ref(2)PRNAi was among the strongest of 32 suppressors of G4C2-mediated eye degeneration (Zhang et al., 2015aFigure 1A). ref(2)P is the Drosophila homolog of p62/SQSTM1, and this modifier is of particular interest because SQSTM1 mutations that cause loss of selective autophagy cause ALS/FTD (Cirulli et al., 2015; Goode et al., 2016; Le Ber et al., 2013), and p62 aggregates are pathological features of both familial and sporadic ALS (Al-Sarraj et al., 2011; Cooper-Knock et al., 2012). Knockdown of ref(2)P suppresses eye degeneration, whereas overexpression of ref(2)P enhances this phenotype (Figure 1A–B, Figure 1—figure supplement 1A). ref(2)P RNAi #1 expression reduced ref(2)P mRNA levels by ~80%, but did not alter G4C2 RNA levels in 30R expressing eyes (Figure 1—figure supplement 1B–C), suggesting that ref(2)P acts downstream of G4C2 transcription. Similarly, knockdown of ref(2)P also rescued eye degeneration in a second G4C2 model expressing 36 G4C2 repeats (36R) (Mizielinska et al., 2014Figure 1C–D). We next assessed the ability of ref(2)P RNAi to rescue toxicity of G4C2 repeats in motor neurons using the 30R model and a new G4C2 model expressing 44R (Goodman et al., 2019b). As shown in Figure 1E–F, while expression of either 30R or 44R in motor neurons with vGlut-Gal4 leads to paralysis and lethality during pupal development, knockdown of ref(2)P partially rescues this phenotype, whereas overexpression of ref(2)P enhances the pupal lethality observed with 44R expression. These data suggest that ref(2)P is required for G4C2-mediated toxicity during Drosophila development.

Figure 1 with 1 supplement see all
Autophagy receptor Ref(2)P/p62 genetically suppresses G4C2-HRE-mediated degeneration.

(A) 15-day-old Drosophila eyes expressing GMR-Gal4 +/- UAS-30R (GMR>30R) with RNAi background (control), ref(2)P RNAi#1 or overexpression (OE) of ref(2)P. (B) Quantification of external eye degeneration in A by semi-quantitative scoring system. Data are reported as mean ± SEM. Kruskal-Wallis test, p<0.0001, followed by Dunn’s multiple comparisons, n 15 adults. (C) 15-day-old Drosophila eyes expressing GMR-Gal4 +/- UAS-36R (GMR >36R) along with UAS-luciferase RNAi (control), UAS-ref(2)P RNAi #1, UAS-ref(2)P RNAi #2, or UAS-ref(2)P OE. (D) Quantification of external eye degeneration in C by semi-quantitative scoring system. Data are reported as mean ± SEM. Kruskal-Wallis test, p<0.0001, followed by Dunn’s multiple comparisons, n = 23, 62, 28, 10 adults respectively. (E) Percent of pupal eclosion of adult flies expressing the motor neuron driver vGlut-Gal4 +/- UAS-30R and RNAi background control or UAS-ref(2)P RNAi #1. Fisher’s exact test, n 100 pupa. (F) Percent of pupal eclosion of adult flies expressing the motor neuron driver vGlut-Gal4 +/- UAS-44R along with UAS-luciferase RNAi, UAS-ref(2)P RNAi #1, or UAS-ref(2)P OE. Fisher’s exact test, n > 55 pupa. (G) Adult Drosophila expressing UAS-30R under the control of the inducible, pan-neuronal elavGS induced with 200 µM RU486 or vehicle alone and co-expressing control or UAS-ref(2)P RNAi #1. Data are reported as mean ± SEM. One-way ANOVA, ****p<0.0001, with Sidak’s multiple comparisons test, n = 9, 8, 8, 8 groups of 10 flies.

To determine whether ref(2)P knockdown is able to suppress age-dependent neurodegeneration, we used a pan-neuronal, inducible ‘GeneSwitch’ driver (elavGS) in which 30R-expression leads to a marked reduction in climbing ability after 7 days (Figure 1G). This climbing defect is suppressed with coexpression of ref(2)P RNAi, suggesting that ref(2)P contributes to G4C2-mediated neurotoxicity in the adult nervous system. Since RAN-translation of arginine-containing DPRs have been implicated in G4C2-mediated toxicity in Drosophila (Kwon et al., 2014; Mizielinska et al., 2014), we next tested whether ref(2)P knockdown rescues poly-glycine-arginine (GR) repeat-mediated toxicity. As shown in Figure 1—figure supplement 1D, ref(2)P RNAi partially rescues the severe eye degeneration phenotype caused by poly(GR)36 expression. Together, these data indicate that ref(2)P, the Drosophila orthologue of p62/SQSTM1, modulates G4C2-mediated neurodegeneration.

G4C2 repeat expression impairs autophagic flux

p62/SQSTM1-positive inclusions are a common pathologic feature seen in brains of C9-ALS/FTD patients where they colocalize with ubiquitin and DPRs (Al-Sarraj et al., 2011). We next investigated the localization of Ref(2)P protein (hereafter referred to as p62) in motor neurons. Expression of 30R leads to the formation of many large p62:GFP puncta in cell bodies compared to controls that strongly colocalize with poly-ubiquitinated proteins (Figure 2A–B, Figure 2—figure supplement 1A–B). Western blot analysis demonstrates that p62 and poly-ubiquitin are strongly upregulated in flies ubiquitously expressing 30R (Figure 2C, Figure 2—figure supplement 1C–D). Similarly, immunofluorescence staining with a p62 antibody shows endogenous p62 accumulations colocalizing with polyubiquitinated proteins in the ventral nerve cord and salivary gland of flies ubiquitously overexpressing 30R (Figure 2—figure supplement 1E). These data show that G4C2 repeat expression in fly models recapitulates the p62 accumulation with ubiquitinated protein aggregates seen in C9-ALS/FTD patient tissue and iPS neurons (Almeida et al., 2013; Mackenzie et al., 2014).

Figure 2 with 2 supplements see all
G4C2 repeat expression impairs autophagic flux.

(A) Drosophila motor neurons expressing UAS-p62:GFP +/- UAS-30R, showing multiple motor neuron cell bodies (top) or a representative cell co-expressing the membrane marker CD8:RFP (bottom). Plasma membrane outlined with solid white line; nucleus outlined with dotted line. Scale bar = 10 µm (top), 1 µm (bottom) (B) Quantification of number of p62:GFP puncta in Drosophila motor neuron cell bodies. Data are reported as mean ± SEM. Mann-Whitney test, n = 5 larvae per genotype. (C) Western blot of anti-p62 and anti-beta-actin showing the whole (W), supernatant (S) and pellet (P) fractions of lysates from Drosophila larvae ubiquitously expressing -/+ UAS-30R under the control of Act-Gal4. (D) Drosophila motor neurons expressing UAS-mCherry:Atg8 -/+ UAS-30R showing cell bodies (top) with an example single cell highlighting mCherry:Atg8-positive puncta (bottom). Scale bar = 10 µm (top), 1 µm (bottom). (E) Quantification of mCherry:Atg8-positive autophagic vesicles (AVs) in the ventral nerve cord of vGlut-Gal4/+ or vGlut >30R expressing flies. Data are reported as mean ± SEM. Mann-Whitney test, n = 16 and 13 larvae, respectively. (F) Western blot of anti-GFP and anti-beta-actin of lysates from whole Drosophila larvae ubiquitously expressing UAS-GFP:mCherry:Atg8 -/+ UAS-30R under the control of Act-Gal4 showing full length GFP:mCherry:Atg8 at 75 kDa and cleaved GFP at 25 kDa. (G) Drosophila motor neurons expressing UAS-GFP:Lamp1 (with N-terminal [luminal] GFP) -/+ UAS-30R under the control of vGlut-Gal4 in multiple cell bodies (top) or in a representative cell (bottom). Scale bar = 10 µm (top), 1 µm (bottom). (H) Quantification of GFP:Lamp1 positive area in G. Data are reported as mean ± SEM. Student’s t-test, n = 5 larvae. (I) Western of whole Act-Gal4 Drosophila larvae -/+ UAS-30R blotted for the lysosomal protease Cp1, showing pro- (inactive, upper band) and cleaved (active, lower band) Cp1. (J) Quantification of the ratio of pro-Cp1 to total Cp1 in I. Data are reported as mean ± SEM. Student’s t-test, n = 5 biological replicates.

Increased p62 levels can be due to either increased transcription and/or translation or insufficient protein degradation (Korolchuk et al., 2010). Using qRT-PCR, we find that ref(2)P transcript levels are unchanged in G4C2 repeat-expressing larvae (Figure 2—figure supplement 1F), suggesting that G4C2 repeats cause p62 upregulation by inhibiting p62 degradation. Since p62 is degraded by autophagy and disrupted autophagic flux is known to cause p62 upregulation, we assessed autophagy in G4C2-repeat-expressing flies. We first co-expressed the tagged autophagosome marker mCherry:Autophagy-related 8 (Atg8, the fly orthologue of mammalian Microtubule-associated protein 1A/1B-light chain 3 (LC3)) with 30R in fly motor neurons and found a marked reduction in mCherry:Atg8 autophagic esicles (AVs) when compared to wild-type controls (Figure 2D–E). p62:GFP accumulation and loss of mCherry:Atg8 puncta were recapitulated in 36R and poly(GR)36 Drosophila models of C9-ALS/FTD (Figure 2—figure supplement 1G–J). Reduction of mCherry:Atg8-positive vesicles coupled with the accumulation of p62 and ubiquitin suggest that autophagic flux is impaired in these fly models of C9-ALS/FTD.

G4C2 repeat expression causes lysosome defects

To further study lysosomal morphology and function, we expressed Lysosome- associated membrane protein 1 (Lamp1) with luminally-tagged GFP in our control and G4C2-expressing flies. Since GFP is largely quenched by the acidity of lysosomes in control animals (Pulipparacharuvil et al., 2005), the accumulation of GFP:Lamp-positive vesicles in 30R-expressing motor neurons suggests a defect in lysosomal acidity or targeting of GFP:Lamp to mature lysosomes (Figure 2G–H). Furthermore, we observe a marked increase in size and number of late endosomes and lysosomes using genomically tagged Ras-related GTP-binding protein 7, Rab7:YFP, throughout 30R-expressing motor neurons (Figure 2—figure supplement 2A) without alterations in early endosomes labeled with Rab5:YFP (data not shown). Together, these data demonstrate a marked expansion of the late endosome/lysosome compartment in G4C2-expressing neurons.

Though accumulation of p62 and ubiquitinated proteins could be caused by a failure of autophagic vesicles to fuse with the degradative endolysosomal compartment, we did not detect a decrease in mCherry:Atg8+, Rab7:GFP+ amphisomes in G4C2-expressing motor neuron cell bodies (Figure 2—figure supplement 2B–F). To assess autophagolysosomal function after fusion, we performed a GFP liberation assay on larvae expressing GFP:mCherry:Atg8 (Klionsky et al., 2016; Mauvezin et al., 2014). GFP is degraded more slowly than the rest of the mCherry:Atg8 protein, leaving a population of free GFP in functioning lysosomes. Free lysosomal GFP is not observed in G4C2-expressing larvae, suggesting an impairment in GFP:mCherry:Atg8 degradation by the lysosome (Figure 2F). To directly probe lysosome enzymatic activity, we performed Western analysis of Drosophila cathepsin Cp1. Whereas pro-Cp1 is normally cleaved to its mature form by acid hydrolases in lysosomes (Kinser and Dolph, 2012), larvae ubiquitously expressing 30R show an increase in the ratio of pro-Cp1 to Cp1, indicating a decrease in pro-Cp1 cleavage efficiency (Figure 2I–J). Together, these data suggest that lysosomes are expanded and dysfunctional in G4C2 repeat-expressing animals.

To investigate whether the autophagic pathway defects precede neurodegeneration in G4C2 repeat-expressing neurons, we performed transmission electron microscopy (TEM) on Drosophila eyes. As GMR-Gal4 is expressed throughout the development of the eye, we chose to perform electroretinograms (ERGs) of fly eyes selectively expressing 30R in photoreceptor neurons (PRs) using Rh1-Gal4, which turns on during adulthood. Rh1 >30R PRs show only a mild reduction of ON transient amplitude at 28 days, but a complete loss of ON and OFF transients and a decrease in ERG amplitude by 56 days (Figure 3—figure supplement 1A–D), indicating a slow and progressive loss of synaptic transmission and impaired phototransduction respectively. These changes also correspond to a marked loss of photoreceptors and synaptic terminals by 54 days which are not observed at 28 days (Figure 3A–B; Figure 3—figure supplement 1E). We therefore examined autophagic structures by TEM at 28 days, prior to cell loss. Strikingly, we observe a marked increase in the size and number of multilamellar bodies (MLBs) (Figure 3C–D). MLBs are commonly observed in lysosomal storage diseases and result from a deficiency of lysosomal hydrolases and accumulations of lysosomal lipids and membranes (Hariri et al., 2000; Weaver et al., 2002). Though we did not detect an alteration in the number of autophagosomes, lysosomes, or multivesicular bodies, we did see a significant increase in the number of autolysosomes (Figure 3C–D). These data suggest that autophagolysosomal function is disrupted in G4C2-expressing photoreceptor neurons at early stages of degeneration.

Figure 3 with 1 supplement see all
Autophagolysosomal defects precede neurodegeneration in photoreceptor neurons.

(A) Transmission electron microscopy (TEM) of rhabdomeres (cell bodies) in Rhodopsin1-Gal4 (Rh1-Gal4) driving UAS-LacZ (control) or UAS-30R at Day 1, Day 28, and Day 54 after eclosion. Scale bar = 2 µm. (B) Quantification of number of healthy (not split) photoreceptors (PRs) per ommatidium in A. Data are reported as mean ± SEM. Student’s t-test, n = 8, 8, 6, 6, 6, and 6 flies, respectively. (C) TEM images at 28 days of Drosophila eyes (rhabdomeres) -/+ 30R repeats expressed by Rh1-Gal4 showing representative autolysosomes and multilamellar bodies (MLBs), marked with red arrows. Scale bar = 200 nm. (D) Quantification of different vesicle types (autophagosomes, autolysosomes, lysosomes, MLBs, and multivesicular bodies (MVBs)) shown in TEM of rhabdomeres with Rh1-Gal4 driving UAS-LacZ or UAS-30R (as in C) normalized to LacZ (control). Data are reported as mean ± SEM. Student’s t-test, n = 3 adults per genotype.

Given the impairment in autophagic flux, we hypothesized that genetic or pharmacologic manipulations that accelerate autophagy may suppress neurodegenerative phenotypes, whereas those that further impede autophagy would enhance the phenotypes. Indeed, in a candidate-based screen, activation of early steps in the autophagic pathway (e.g. by Atg1 overexpression) suppresses eye degeneration and blocking autophagosome/lysosome fusion (e.g. by Snap29 knockdown) enhances eye degeneration (Supplementary file 1). Similarly, pharmacologic activation of autophagy via inhibition of mTor with rapamycin or mTor-independent activation via trehalose (Sarkar et al., 2007) rescues neurodegenerative phenotypes and p62 accumulation (Figure 2—figure supplement 2G–K). Together, these data show that promoting autophagy or lysosomal fusion are potent suppressors of G4C2-mediated neurodegeneration.

Nucleocytoplasmic transport impairment disrupts autophagic flux

A diverse array of cellular pathways including autophagy, RNA homeostasis, and NCT are implicated in the pathogenesis of ALS and FTD (Balendra and Isaacs, 2018; Evans and Holzbaur, 2019; Gao et al., 2017; Lin et al., 2017; Ling et al., 2013; Ramesh and Pandey, 2017). However, the sequence of events in the pathogenic cascade remains unknown. Cytoplasmic protein aggregates or RNA stress granule formation is sufficient to disrupt nucleocytoplasmic transport (Woerner et al., 2016; Zhang et al., 2018). We therefore tested whether defects in autophagy are upstream, downstream, or in parallel with defects in NCT.

We first tested whether knockdown of ref(2)P rescues the mislocalization of the NCT reporter shuttle-GFP (S-GFP) containing both a nuclear localization sequence (NLS) and nuclear export sequence (NES). G4C2 repeat expression causes mislocalization of S-GFP to the cytoplasm (Zhang et al., 2015a), but knockdown of ref(2)P does not restore nuclear localization (Figure 5—figure supplement 1A). Similarly, stimulation of autophagy with rapamycin or trehalose fails to rescue S-GFP mislocalization in G4C2 expressing salivary glands (Figure 5—figure supplement 1B). Stimulating autophagy does not rescue NCT defects although it can rescue neurodegeneration, suggesting that autophagy defects are either independent of or downstream of NCT defects. Indeed, RanGAP knockdown increases the number and size of p62:GFP puncta, similar to the effects of overexpressing the G4C2 repeats (Figure 5—figure supplement 1C), suggesting that NCT disruption is sufficient to disrupt autophagic flux in Drosophila motor neurons.

Mitf is mislocalized and inactivated in Drosophila models of C9-ALS/FTD

Because we observed a reduction in autophagosomes and expansion of lysosome-related organelles, we hypothesized that transcription factors regulating autophagolysosomal function may be mislocalized to the cytoplasm due to disrupted nuclear import. The MiT/TFE family of transcription factors (TFEB, TFE3, MITF, and TFEC) regulates multiple steps of autophagy from autophagosome biogenesis through lysosome acidification via a network of genes called the Coordinated Lysosome Expression And Regulation (CLEAR) network (Settembre et al., 2011). These transcription factors are regulated by localization between the cytoplasm and nucleus (Li et al., 2018). In Drosophila, this conserved transcription factor family is represented by a single homolog called Mitf (Bouché et al., 2016; Zhang et al., 2015b). Mitf knockdown in the nervous system causes lysosomal defects similar to those observed in G4C2-expressing flies (Bouché et al., 2016; Hallsson et al., 2004; Sardiello et al., 2009; Song et al., 2013). Additionally, TFEB levels are reduced in superoxide dismutase 1 (SOD1) mutant cell culture and mouse ALS models (Chen et al., 2015) as well as in ALS and Alzheimer’s patient brain tissue (Wang et al., 2016). Therefore, we hypothesized that impaired Mitf nucleocytoplasmic transport might underlie the autophagolysosomal phenotypes in fly models of C9-ALS. Indeed, both salivary gland cells and motor neurons expressing 30R show a reduction in percent nuclear Mitf (Figure 4A–D). To assess whether disrupted Mitf NCT alters CLEAR gene expression in adult heads, we expressed 30R using a ubiquitous inducible driver, daughterless-GeneSwitch (daGS). In control flies, a mild (~1.75 fold) overexpression of Mitf mRNA resulted in a significant upregulation of 3 of the 7 Mitf targets tested (the vesicular ATPase (v-ATPase) subunits Vha16-1, Vha68-2, and Vha44) and a trend towards upregulation of 4 others (Figure 4E). Importantly, co-expression of 30R with daGS >Mitf led to a similar ~2 fold increase in Mitf transcripts but did not induce Mitf target genes (Figure 4E). This lack of Mitf target induction in 30R flies suggests that decreased nuclear import of Mitf suppresses the ability of 30R-expressing flies to upregulate CLEAR genes in order to maintain or induce autophagic flux.

Mitf/TFEB is mislocalized from the nucleus and inactivated.

(A) Drosophila larval salivary glands -/+ UAS-30R under the control of vGlut-Gal4 stained with anti-Mitf and DAPI. Dotted lines outline nuclei. Scale bar = 10 µm. (B) Quantification of percent (%) nuclear Mitf (nuclear Mitf fluorescence/total fluorescence) in A. Data are reported as mean ± SEM. Student’s t-test, n = 5 larvae per genotype. (C) Drosophila motor neurons (MNs) expressing UAS-Mitf-HA and UAS-CD8:GFP -/+ UAS-30R under the control of vGlut-Gal4 stained with anti-HA, anti-GFP (membrane), and DAPI to show nuclear localization. Scale bar = 1 µm. (D) Quantification of percent (%) nuclear Mitf in C. Data are reported as mean ± SEM. Student’s t-test, n = 4 and 5 larvae, respectively, with at least 10 motor neurons per larva. (E) Quantitative RT-PCR to assess transcript levels of Mitf and seven target genes from lysates of Drosophila heads expressing control (UAS-LacZ) or UAS-30R driven by daGS in control conditions or with overexpression of Mitf. Data are reported as mean ± SEM. One-way ANOVA, p<0.0001, with Sidak’s multiple comparisons test, n > 4 biological replicates of 30 heads per genotype.

We next examined whether rescue of nucleocytoplasmic transport defects in 30R-expressing animals can rescue Mitf nuclear import and autophagolysosomal defects. Exportin-1 has recently been demonstrated to regulate Mitf/TFEB nuclear export (Li et al., 2018; Silvestrini et al., 2018). Knockdown of exportin-1 (Drosophila emb) rescues G4C2-mediated cytoplasmic Mitf mislocalization in the salivary gland (Figure 5A–B) and GFP:Lamp accumulation in motor neurons (Figure 5C–D). Importantly, emb knockdown increases the total number of autophagosomes in G4C2-expressing motor neuron cell bodies by ~3 fold (Figure 5E–F), suggesting that nuclear retention of Mitf rescues autophagolysosomal defects. However, emb knockdown caused a slight elevation of p62:GFP puncta intensity in controls and did not rescue the accumulations of p62:GFP in 30R-expressing motor neurons (Figure 5G–H). Together, these data indicate that autophagolysosomal dysfunction in 30R-expressing animals occurs downstream of nucleocytoplasmic transport disruption, whereas inhibition of nuclear export is not sufficient to rescue p62 accumulation.

Figure 5 with 1 supplement see all
Modulation of nucleocytoplasmic transport rescues autophagolysosome dysfunction.

(A) Drosophila larval salivary glands stained with anti-Mitf and DAPI expressing +/- UAS-30R, UAS-shuttle-GFP (S-GFP, not shown), and either control RNAi (UAS-lucRNAi) or exportin RNAi (UAS-embRNAi ) under the control of vGlut-Gal4. Scale bar = 10 µm (B) Quantification of percent (%) nuclear Mitf in A. Data are reported as mean ± SEM. Student’s t-test, n = 4 and 5 larvae, respectively. (C) Drosophila motor neurons expressing UAS-GFP:Lamp1 (N-terminal, luminal GFP) -/+ UAS-30R and UAS-lucRNAi or exportin RNAi (UAS-embRNAi ). Scale bar = 10 µm. (D) Quantification of C. Student’s t-test, n = 6 larvae. (E) Drosophila motor neurons expressing UAS-mCherry:Atg8 +/- UAS-30R and either control RNAi (UAS-lucRNAi) or exportin RNAi (UAS-embRNAi ). Scale bar = 10 µm. (F) Quantification of E. Data are reported as mean ± SEM. Mann-Whitney test, n = 10 larvae. (G) Drosophila motor neurons expressing UAS-p62:GFP -/+ UAS-30R and either control RNAi (lucRNAi) or exportin RNAi (embRNAi ) under the control of vGlut-Gal4. Scale bar = 10 µm. (H) Quantification of G. Data are reported as mean ± SEM. Brown-Forsythe and Welch ANOVA test, p<0.0001, followed by Dunnett’s T3 multiple comparisons, n = 12–14 larvae per genotype.

Mitf rescues G4C2 repeat-mediated degeneration

Since Mitf mislocalization contributes to autophagolysosome defects in a fly C9-ALS model, we hypothesized that increasing total levels of Mitf might compensate for impaired nuclear import. While high level Mitf overexpression is toxic in Drosophila (Hallsson et al., 2004), a genomic duplication construct containing the Mitf gene lacking the DNA repetitive intron 1 (Mitf Dp) (Zhang et al., 2015b), is sufficient to partially rescue 30R-mediated eye degeneration, while Mitf knockdown enhances eye degeneration (Figure 6A–B). Furthermore, pupal lethality caused by 30R expression in motor neurons and climbing impairment in elavGS >30R flies are also partially rescued by Mitf Dp (Figure 6C–D). In contrast, Mitf Dp did not rescue the severe rough eye phenotype observed with GMR-Gal4 overexpression of poly(GR)36 (Figure 6—figure supplement 1A–B), suggesting that Mitf Dp rescues toxicity caused by the G4C2 repeat RNA rather than the DPRs alone. To determine whether increased levels of Mitf rescue G4C2-mediated neurodegeneration through effects on the autophagolysosomal pathway, we examined GFP:Lamp and p62:GFP expression in 30R-expressing motor neurons. Indeed, Mitf Dp rescues increased GFP:Lamp1 expression (Figure 6E–F) and reduces p62:GFP accumulation in motor neurons of vGlut >30R larvae (Figure 6G–H). Thus, increasing Mitf levels in multiple neuronal subtypes in Drosophila suppresses G4C2-mediated neurotoxicity, consistent with our hypothesis that loss of nuclear Mitf is a key contributor to G4C2-mediated neurodegeneration.

Figure 6 with 1 supplement see all
Transcription factor Mitf/TFEB suppresses neurodegeneration caused by G4C2 expansion via lysosome activity.

(A) 15-day-old Drosophila eyes expressing UAS-30R under the control of GMR-Gal4, crossed to controls (w1118 or UAS-luciferase RNAi), genomic Mitf Duplication (Mitf Dp), or UAS-Mitf RNAi. (B) Quantification of external eye degeneration shown in A. Data are reported as mean ± SEM. Kruskal-Wallis test, p<0.0001, followed by Dunn’s multiple comparisons, n = 10–20 adults per genotype. (C) Percent of pupal eclosion in Drosophila expressing UAS-30R under the control of vGlut-Gal4 -/+ Mitf Dp compared to vGlut-Gal4/w1118 control. Fisher’s exact test, n = 133, 139, and 84 pupae, respectively. (D) Adult Drosophila expressing UAS-30R under the control of the inducible, pan-neuronal elavGS driver induced with 200 µM RU486 have decreased climbing ability at 7 days of age. Co-expressing Mitf Dp with UAS-30R rescues climbing ability. One-way ANOVA, p<0.0001, followed by Sidak’s multiple comparisons, n = 14–17 groups of 10 flies per genotype. (E) Representative images of motor neurons expressing UAS-GFP:Lamp1 for control (w1118), UAS-30R, or coexpressing Mitf Dp and UAS-30R. Scale bar = 10 µm (F) Quantification of the GFP positive (GFP+) area of GFP:Lamp1 in E. Data are reported as mean ± SEM. Brown-Forsythe and Welch ANOVA, p<0.0001, test followed by Dunnett’s T3 multiple comparisons, n = 15 per genotype. (G) Representative images of motor neurons coexpressing UAS-p62:GFP with no repeats (control, w1118), UAS-30R, and Mitf Dp with UAS-30R. Scale bar = 10 µm. (H) Quantification of p62:GFP GFP+ puncta area in F. Data are reported as mean ± SEM. Brown-Forsythe and Welch ANOVA test, p<0.0001, followed by Dunnett’s T3 multiple comparisons, n = 12–14 larvae per genotype.

If the impaired lysosomal function we observe in our Drosophila model is contributing to neurodegeneration downstream of NCT defects, we would predict that genetic upregulation of key regulators of lysosome function may suppress degenerative phenotypes. Indeed, overexpression of Rab7, the small GTPase required for fusion of autophagosomes with lysosomes, or Trpml, a lysosomal calcium channel, suppress eye degeneration (Figure 6—figure supplement 1C–D). Furthermore, overexpression of key lysosomal v-ATPase subunits whose expression is regulated by Mitf also suppresses neurodegeneration in the Drosophila eye, while RNAi-mediated knockdown enhances degeneration (Figure 6—figure supplement 1C–D). Interestingly, loss of the ALS-associated gene ubqn in Drosophila was also rescued by increase in key lysosomal v-ATPase subunits or by nanoparticle mediated lysosome acidification (Şentürk et al., 2019). Overexpression of these Mitf-regulated genes also showed partial rescue of pupal lethality in animals expressing 30R in motor neurons (Figure 6—figure supplement 1E). These findings suggest a model whereby downregulation or cytoplasmic retention of Mitf targets leads to lysosomal disruption in G4C2-repeat-expressing flies.

Nuclear TFEB is reduced in human cells and motor cortex with GGGGCC repeat expansions

In humans, TFEB is the homolog of Drosophila Mitf that is best characterized for its role in autophagy and has been implicated in neurodegenerative disease (Cortes and La Spada, 2019; Martini-Stoica et al., 2016). Interestingly, a previous study showed nuclear TFEB was selectively depleted in the motor cortex of a sample of five ALS patients compared to five controls (Wang et al., 2016). To test the relevance of our findings in Drosophila models to human disease, we next examined whether G4C2 repeat expression impairs nuclear import of TFEB in HeLa cells stably expressing TFEB:GFP (Roczniak-Ferguson et al., 2012) using a 47-repeat (47R) G4C2 construct that expresses tagged DPRs (see Materials and methods). In control cells, TFEB:GFP is predominantly localized to the cytoplasm, whereas induction of autophagy by 3 hr starvation leads to robust nuclear translocation of TFEB (Figure 7A–B). In contrast, while 47R-expressing cells have a mild basal elevation of nuclear TFEB, the nuclear translocation of TFEB in response to starvation is significantly impaired relative to control cells (Figure 7A–B). We then tested the effect of expression of DPRs produced by alternate codons (i.e. in the absence of G4C2 repeats): poly-glycine-alanine (poly-GA50), poly-glycine-arginine (poly-GR50), and poly-proline-arginine (poly-PR50) (Figure 7—figure supplement 1A–B). While poly-GA50 causes a mild decrease in TFEB nuclear translocation, expression of poly-GR50 or poly-PR50 does not disrupt TFEB:GFP nuclear translocation. These data suggest that human cells expressing an expanded G4C2 repeat, but not DPRs, are unable to efficiently import TFEB into the nucleus in response to stimuli.

To further investigate the relevance of loss of TFEB nuclear import to C9-ALS patients, we obtained human motor cortex samples from four non-neurological controls and four C9-ALS patients (Supplementary file 2). These samples were fractionated into cytoplasmic and nuclear-enriched fractions and assayed for TFEB using Western analysis. TFEB is reduced by an average of 76% in the nuclear fraction and by about 50% in the cytoplasm in C9-ALS compared to controls (Figure 7C–D, Figure 7—figure supplement 1C). These data suggest that TFEB protein is downregulated in C9-ALS/FTD motor cortex, but the greatest depletion occurs in the nucleus. Therefore, we propose a model whereby disruption of protein nuclear import by the C9orf72-HRE results in a failure of Mitf/TFEB to translocate to the nucleus to regulate the autophagic response to protein stress (Figure 8).

Figure 7 with 1 supplement see all
Nuclear TFEB is reduced in human cells expressing GGGGCC repeats and in C9-ALS human motor cortex.

(A) HeLa cells stably expressing TFEB:GFP transfected with 0R (Control) or a 47R construct (Flag tag in frame with poly-GR) in normal media (DMEM) or starved (3 hr in EBSS) conditions. White arrowheads indicate transfected cells in the 47R starved group. (B) Quantification of cells from A showing the percent (%) nuclear TFEB:GFP (nuclear/total) for each group. Data are presented as mean + SEM. One-way ANOVA, p<0.0001, with Sidak’s multiple comparisons, n = 47, 47, 35, and 38 cells. (C) Western blot for TFEB of human motor cortex samples fractionated into cytoplasmic and nuclear samples from postmortem control and C9-ALS patient brains. (D) Quantification of TFEB levels against total protein loading (Faststain) in control and C9-ALS patients. Data reported are mean ± SEM. One-way ANOVA, p=0.0142, with Sidak’s multiple comparisons, n = 4.

A proposed model of GGGGCC repeat expansion pathogenesis.

G4C2 repeat expansion causes nucleocytoplasmic transport disruption through multiple proposed mechanisms including G4C2 RNA binding of RanGAP and stress granule recruitment of nucleocytoplasmic transport machinery. Transport disruption leads to a blockage in the translocation of autophagy-mediating transcription factors such as Mitf/TFEB to the nucleus in response to proteotoxic stress. Failure to induce autophagic flux leads to autophagy pathway disruption such as the accumulation of large, non-degradative lysosomes and MLBs. Loss of autophagic flux leads to accumulation of Ref(2)P/ p62 and ubiquitinated protein aggregates, leading to chronic protein stress signaling and eventually neuronal cell death.

Discussion

Our work has revealed that the ALS-associated G4C2 hexanucleotide repeat is sufficient to disrupt multiple aspects of autophagy. In Drosophila, G4C2 repeats cause loss of autophagosomes and disrupt lysosomal structure and function. This accumulation of autolysosomes and lysosome-related organelles (MLBs) has been observed in lysosomal storage disorders and has been reported in spinal cord tissue from sporadic ALS patients (Bharadwaj et al., 2016; Parkinson-Lawrence et al., 2010; Sasaki, 2011). Regulation of protein and lipid homeostasis by the lysosome may be particularly important in neurons since they are post-mitotic and have high energy demands (Fraldi et al., 2016). Loss of function of C9orf72 also disrupts autophagy and lysosomal function in multiple cell types (Farg et al., 2014; Ji et al., 2017; O'Rourke et al., 2015; Sellier et al., 2016; Shi et al., 2018; Sullivan et al., 2016; Ugolino et al., 2016; Webster et al., 2016; Yang et al., 2016; Zhu et al., 2020), suggesting a mechanism whereby G4C2 repeats may have synergistically detrimental effects with haploinsufficient C9orf72 in C9-ALS/FTD patients. Additionally, multiple forms of familial ALS are caused by mutations in genes in autophagy and lysosome function (Evans and Holzbaur, 2019; Lin et al., 2017; Ramesh and Pandey, 2017), and upregulation of lysosome function has been proposed to be beneficial in multiple preclinical models of ALS (Donde et al., 2020; Mao et al., 2019; Şentürk et al., 2019; Shi et al., 2018). Thus, our findings suggest that, as has been shown in other forms of ALS, neurotoxicity of G4C2 repeats in C9 ALS-FTD is at least partially caused by disrupted autophagolysosomal function.

The finding that ref(2)P knockdown prevents or delays G4C2-mediated neurodegeneration is surprising, as p62/SQSTM1 is thought to link toxic ubiquitinated aggregates to LC3 to remove aggregates via selective autophagy (Cipolat Mis et al., 2016; Levine and Kroemer, 2008; Saitoh et al., 2015). However, other studies have also suggested that p62 may contribute to (rather than ameliorate) toxicity of ubiquitinated proteins. For example, Atg7-/- mice display severe defects in autophagy and accumulation of p62-positive protein aggregates in the liver and brain, and knockout of p62 in these mice prevents the formation of ubiquitinated aggregates and rescues liver dysfunction via suppression of chronic oxidative stress signaling (Komatsu et al., 2007). Additionally, Ataxia Telangiectasia Mutated-mediated DNA double stranded break repair is impaired in cultured neurons expressing the C9orf72-HRE, and this phenotype is rescued by p62 knockdown (Walker et al., 2017). These findings suggest that increases in p62 may contribute to DNA damage previously described in C9-ALS. Further, p62 is found to co-localize with DPRs in C9-ALS patients (Al-Sarraj et al., 2011; Mackenzie et al., 2014; Mori et al., 2013) and may promote protein aggregation. We hypothesize that p62-positive aggregate or oligomer formation in C9-patients contributes to neurotoxicity by activating downstream signaling pathways that are alleviated by autophagy-mediated clearance.

While many groups have reported nucleocytoplasmic transport dysfunction in ALS, it has remained unclear how NCT disruption causes ALS. Stress granules can recruit nuclear pore proteins to the cytoplasm and cause nucleocytoplasmic transport defects, suggesting that the disruptions in phase separation of RNA-binding proteins may lie upstream of nucleocytoplasmic transport defects (Zhang et al., 2018). Recently, Ortega et al. discovered that hyperactivity of nonsense-mediated decay may lie downstream of nucleocytoplasmic transport, indicating that multiple proteostasis pathways may be disrupted (Ortega et al., 2020). Additionally, selective autophagy is required for nuclear pore turnover (Lee et al., 2020), implying that autophagy defects may contribute to the cytoplasmic nuclear pore pathology found in C9-ALS patients and animal models. Our data show that in Drosophila, HeLa cells, and human tissue, nucleocytoplasmic transport defects lead to an inability to activate TFEB translocation to the nucleus, causing widespread autophagy defects and accumulation of protein aggregates (Figure 8). Interestingly, genetic inhibition of nuclear export or increase in Mitf expression are able to strongly rescue autophagosome and lysosome phenotypes and neurodegeneration, but do not result in complete clearance of p62 accumulations (Figures 56). Additional studies will be needed to better understand the relationship between p62 accumulation, autophagy, nucleocytoplasmic transport, and neurodegeneration. Overall, these findings place nucleocytoplasmic transport defects in ALS upstream of proteostasis defects.

Importantly, TFEB has been previously proposed as a therapeutic target in ALS and other neurodegenerative disease (Cortes and La Spada, 2019). Upregulation of TFEB signaling helps clear multiple types of proteotoxic aggregates found in Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, ALS and FTD (Decressac et al., 2013; Parr et al., 2012; Polito et al., 2014; Torra et al., 2018; Vodicka et al., 2016). Our study suggests that modulation of TFEB nucleocytoplasmic transport may be an additional therapeutic target, and that targeting both nucleocytoplasmic transport and autophagy may act synergistically in ALS and FTD.

Materials and methods

Drosophila genetics

Request a detailed protocol

Drosophila were raised on standard cornmeal-molasses food at 25°C. For eye degeneration, GMR-GAL4, UAS-30R/CyO, twi-GAL4, UAS-GFP were crossed to UAS-modifier lines or background controls and GMR-GAL4, UAS-30R/UAS-modifier or GMR-GAL4, UAS-30R/+ were selected (where UAS-modifier can be on any chromosome) from the offspring and aged at 25°C for 15 days. Eye degeneration is quantified using a previously described method (Ritson et al., 2010). Briefly, points were added if there was complete loss of interommatidial bristles, necrotic patches, retinal collapse, loss of ommatidial structure, and/or depigmentation of the eye. Eye images were obtained using a Nikon SMZ 1500 Microscope and Infinity 3 Luminera Camera with Image Pro Insight 9.1 software.

For pupal survival assay, either three males from vGlut-Gal4 or vGlut-Gal4; UAS-30R/TM6G80(Tb) were crossed to 5–6 female flies containing UAS-modifier lines or background controls. Parental adult crosses were transferred to fresh vials every 2–3 days. After 15 days, non-tubby pupated flies that were (either vGlut-Gal4/UAS-modifier, vGlut/+; UAS-30R, or vGlut-Gal4/UAS-modifier; UAS-30R) were scored as either eclosed (empty pupal case) or non-eclosed (typically a fully developed pharate adult fly unable to eclose from pupal case due to paralysis).

For the climbing assay, UAS-30R; elavGS were crossed to experimental or genetic background controls. Adults were transferred 3–5 days after eclosion to vials containing 200 μM RU486 food or ethanol vehicle alone and transferred to new vials every 2–3 days. After aging 7–10 days, groups of 10 flies were placed into empty food vials and were tapped to the bottom and then locomotor function assessed by their negative geotaxis (flies reflexively crawl against gravity) response as measured by ability to climb 8 cm in 10 seconds. Each cohort of 10 flies was tested 10 times to obtain an average. N represents individual cohorts of 10 flies.

Drosophila drug feeding

Request a detailed protocol

Cornmeal-molasses-yeast fly food was melted and then cooled for 5 min before being mixed with concentrations of mifepristone (RU486), rapamycin, or trehalose and cooled to room temperature. Ethanol or DMSO was used as a vehicle control. Parent flies were crossed on normal food, and then they were transferred to food containing drug every 2–3 days such that their offspring would develop in food containing drug or adult offspring were transferred to drug food once eclosed as noted. Wandering third-instar larvae were selected for immunostaining or western blot analysis. Adult flies were aged on the drug-containing food for 15 days before analyzing their eye morphology or assessed for climbing ability on the day noted.

Quantitative RT–PCR

Request a detailed protocol

For each genotype, mRNA was collected from 5 flies or 30 heads using the TRIzol reagent following the manufacturer’s protocol. Reverse transcription was performed using SuperScript III First-Strand synthesis kit following the manufacturer’s protocol. Quantitative PCR was performed using SYBR Green PCR system on a 7900HT fast Real-Time PCR system (Applied Biosystem). The primers for G4C2 repeats were designed to amplify a 3’ region immediately after the repeats in the UAS construct.

Immunofluorescence staining and imaging

Request a detailed protocol

For Drosophila ventral nerve cords, wandering third-instar larvae were dissected in HL3 (Stewart et al., 1994) using a standard larval fillet dissection then fixed in 4% paraformaldehyde (or Bouin's fixative for UAS-mCherry:Atg8 experiments) (Sigma) for 20 min, followed by wash and penetration with PBS 0.1% Triton X-100 (PBX) for 3 × 20 min washes. The tissues were blocked for 1 hr at room temperature in PBS with 5% normal goat serum (NGS) and 0.1% PBX, then stained with primary antibodies at 4C overnight (16 hr). Tissues were washed three times for 20 min each with 0.1% PBX. Secondary antibodies (Goat antibodies conjugated to Alexa Fluor 568, 488, 633) diluted in 0.1% PBX 5% NGS and incubated for 2 hr and then washed three times for 20 min each with 0.1% PBX. During one wash, DAPI was added to the prep at a final concentration of 1 µg/mL. Larvae were mounted in Fluoromount-G (Invitrogen).

Drosophila salivary glands were dissected using a standard protocol and stained as above excepting for stronger solubilization with 0.3% PBX. Fixed cells or tissues were analyzed under an LSM780 or LSM800 confocal microscope (Carl Zeiss) with their accompanying software using Plan Apochromat 63 ×, NA 1.4 DIC or Plan Apochromat 40×, 1.3 Oil DIC objectives (Carl Zeiss) at room temperature. Images were captured by an AxioCam HRc camera (Carl Zeiss) and were processed using ImageJ/Fiji. To quantify fluorescent intensities, after opening the images in ImageJ/Fiji, certain areas/bands were circled and the intensities were measured. Puncta were counted using the Analyze Particles function in Image J using the same thresholding across experiments. Images are representative and experiments were repeated two to five times.

Western blotting

Request a detailed protocol

Tissues or cells were homogenized and/or lysed in RIPA buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, and 1% Triton X-100) supplemented with protease inhibitor cocktail (Complete, Roche) using microcentrifuge pestles, and then were incubated in RIPA buffer on ice for 20 min. Samples were spun down at 100 g for 5 min to remove carcass and unbroken cells. For protein quantification, solution was diluted and measured by BCA assay (Thermo Fischer Scientific).

For nucleocytoplasmic fractionation of autopsy tissue, fractionation was performed with the NE-PER Nuclear and Cytoplasmic Extraction Kit according to the manufacturer’s protocol. For detection of proteins in the whole fraction, Drosophila larvae were solubilized in 8M urea. For the soluble and pelleted fraction, larvae were first solubilized in RIPA buffer as described above. The samples were spun down at 15000 rpm for 20 min and the soluble supernatant was set aside. Freshly prepared 8M urea buffer (Sigma) was added to the pellet and dissolved through vortexing. Samples were spun again at 15000 rpm for 20 min and urea-soluble pellet fraction was collected. A small amount of sample buffer dye was added and urea-buffered protein samples were run immediately on SDS-PAGE without heating. For immunoblot, 10–50 µg of total protein sample was mixed with 4x Laemmli buffer (Bio-Rad) and heated at 98°C for 10 min. The protein samples were run on 4–15% SDS Mini-PROTEAN TGX Precast Gels (Bio-Rad) and transferred to nitrocellulose membrane. TBST (50 mM Tris-HCl pH 7.4, 1% Triton X-100) with 5% non-fat milk (Bio-Rad) was used for blocking.

Electroretinogram (ERG) Assay

Request a detailed protocol

For ERG recordings, Rh1-GAL4/UAS-LacZ and Rh1-GAL4/UAS-30R flies were aged at 25°C in 12 hr light/12 hr dark cycle. ERG recordings were performed as described (Şentürk et al., 2019). In brief, adult flies were immobilized on a glass slide by glue. A reference electrode was inserted in the thorax and a recording electrode was placed on the eye surface. Flies were maintained in the darkness for at least 2 min prior to 1 s flashes of white light pulses (LED source with daylight filter), during which retinal responses were recorded and analyzed using WinWCP (University of Strathclyde, Glasgow, Scotland) software. At least five flies were examined for each genotype and timepoint.

Transmission Electron Microscopy (TEM)

Request a detailed protocol

Rh1-GAL4/UAS-lacZ and Rh1-GAL4/UAS-30R flies were aged at 25°C in 12 hr light/12 hr dark cycle. Retinae of adult flies were processed for TEM imaging as previously described (Chouhan et al., 2016). Three flies were examined for each genotype and timepoint.

Plasmids Source and Construction

Request a detailed protocol

pSF-CAG-Amp (0G504) was purchased from Oxford Genetics. We generated a mammalian expression plasmid pSF-(G4C2)47-VFH (V5-Flag-His), which can express 47 G4C2 repeats with three different tags to monitor expression of DPRs (polyGP-V5, polyGA-His, and polyGR-Flag). pEGFP-(GA,GR, or PR)50 was obtained from Davide Trotti (Wen et al., 2014), and the GFP cDNA sequence was replaced with mCherry by digesting with BamHI and XhoI.

TFEB:GFP HeLa cell culture, transfection, and immunofluorescence analysis

Request a detailed protocol

HeLa cell line with stable expressing TFEB:GFP was a gift from Dr. Shawn Ferguson at Yale University. Hela cells were grown in DMEM media (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone Laboratories Inc). The cell line was authenticated by observing nuclear translocation of TFEB:GFP in the presence of starvation (Figure 7). Absence of mycoplasma contamination was confirmed by staining with DAPI. Transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Briefly, 1–2 µg of cDNA was diluted into 100 µl of Opti-MEM I Medium (Invitrogen) and mixed gently. Lipofectamine 2000 mixture was prepared by diluting 2–4 µl of Lipofectamine 2000 in 100 µl of Opti-MEM I Medium. The ratio of DNA to Lipofectamine 2000 used for transfection was 1∶two as indicated in the manual. The DNA-Lipofectamine 2000 mixture was mixed gently and incubated for 20 min at room temperature. Cells were directly added to the 200 µl of DNA-Lipofectamine 2000 mixture. After 48 hr, transfected HeLa cells were treated with EBSS medium for 3 hr for starvation. HeLa cells were fixed with 4% PFA at room temperature for 15 min, washed three times with PBS, permeabilized for 10 min with 1% PBTX, washed another three times with PBS, and blocked for 1 hr at room temperature with 10% normal goat serum (Sigma) diluted in 0.1% PBTX. Cells were then incubated overnight at 4°C with primary antibody mouse anti-Flag antibody. After three washes in PBS (5 min each), cells were incubated for 1 hr at room temperature with secondary antibodies (goat anti-Alexa Fluor 568) diluted in the blocking solution. Cells were washed three times in PBS and mounted with Prolong Gold anti-fade reagent with DAPI (Cell Signaling).

Collection of human autopsied tissue

Request a detailed protocol

Human autopsied tissue used for these data are described in detail in Supplementary file 2. The use of human tissue and associated decedents’ demographic information was approved by the Johns Hopkins University Institutional Review Board and ethics committee (HIPAA Form five exemption, Application 11-02-10-01RD) and from the Ravitz Laboratory (UCSD) through the Target ALS Consortium.

Statistics

All quantitative data were derived from independent experiments. Each n value representing biological replicates is indicated in the figure legends. Statistical tests were performed in Prism version 8.3.1 or Microsoft Excel 16.34 and were performed as marked in the figure legends. All statistical tests were two-sided. Results were deemed significant when the P value α = 0.05. No statistical methods were used to predetermine sample size. The investigators were not blinded during experiments.

Appendix 1

Appendix 1—key resources table
Reagent type
(species) or
resource
DesignationSource or referenceIdentifiersAdditional information
Genetic reagent (D. melanogaster)GMR-Gal4Bloomington Drosophila Stock CenterBDSC:1104w*; P{GAL4-ninaE.GMR}12
Genetic reagent (D. melanogaster)30RPeng Jin (Xu et al., 2013)FlyBase:
FBal0294759
w[1118];UAS-(G4C2)30
Genetic reagent (D. melanogaster)TRiP background controlBloomington Drosophila Stock CenterBDSC: 36303y[1] v[1]; P{y[+t7.7]=CaryP}attP2
Genetic reagent (D. melanogaster)UAS-ref(2)PRNAi#1Bloomington Drosophila Stock CenterBDSC: 36111y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=TRiP.HMS00551}attP2
Genetic reagent (D. melanogaster)UAS-ref(2)PRNAi #2Bloomington Drosophila Stock CenterBDSC: 33978y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=TRiP.HMS00938}attP2
Genetic reagent (D. melanogaster)UAS-ref(2)P-HAL.M. Martins (de Castro et al., 2013)Flybase: FBtp0089618
Genetic reagent (D. melanogaster)vGlut-Gal4Bloomington Drosophila Stock CenterFlybase: FBal0194519w[1118]; P{w[+mW.hs]=GawB}VGlut[OK371]
Genetic reagent (D. melanogaster)elavGSAdrian IsaacsFlybase: FBtp0015149w[*]; P{elav-Switch.O} GSG301
Genetic reagent (D. melanogaster)UAS-poly(GR)36Adrian Isaacs (Mizielinska et al., 2014)BDSC: 58692w[1118]; P{{y[+t7.7] w[+mC]=UAS poly-GR.PO-36}attP40
Genetic reagent (D. melanogaster)Act-Gal4Bloomington Drosophila Stock CenterFlybase: FBti0183703y[1] w[*]; P{Act5C-GAL4}17bFO1/TM6B, Tb1
Genetic reagent (D. melanogaster)UAS-ref(2)P: GFPThomas Neufeld (Chang and Neufeld, 2009)Flybase: FBtp0041098
Genetic reagent (D. melanogaster)UAS-mCherry-Atg8Bloomington Drosophila Stock CenterBDSC: 37749y[1] w[1118]; P{w[+mC]=UASp-GFP-mCherry-Atg8a}2
Genetic reagent (D. melanogaster)UAS-GFP:Lamp1Helmut Kramer (Pulipparacharuvil et al., 2005)Flybase: FBtp0041063w[*]; P{w[+mC]=UAS-GFP-LAMP}2
Genetic reagent (D. melanogaster)UAS-3R; UAS-(G4C2)3Adrian Isaacs (Mizielinska et al., 2014)BDSC: 58687w[1118]; P{{y[+t7.7] w[+mC]=UAS GGGGCC.3}attP40
Genetic reagent (D. melanogaster)UAS-36R; UAS-(G4C2)36Adrian Isaacs (Mizielinska et al., 2014)BDSC: 58688w[1118]; P{{y[+t7.7] w[+mC]=UAS GGGGCC.36}attP40
Genetic reagent (D. melanogaster)UAS-44R; UAS-LDS(G4C2)44Nancy Bonini
(Goodman et al., 2019b)
BDSC: 84723w[1118]; P{w[+mC]=UAS-LDS-(G4C2)44.GR-GFP}9
Genetic reagent (D. melanogaster)UAS-LacZBloomington Drosophila Stock CenterBDSC: 3956w[1118]; P{w[+mC]=UAS-lacZ.NZ}J312
Genetic reagent (D. melanogaster)Rh1-Gal4Bloomington Drosophila Stock CenterBDSC: 8961P{ry[+t7.2]=rh1 GAL4}3, ry[506]
Genetic reagent (D. melanogaster)gRab7-YFPBloomington Drosophila Stock CenterBDSC: 62545w[1118]; TI{TI}Rab7[EYFP]
Genetic reagent (D. melanogaster)UAS-Rab7-GFPBloomington Drosophila Stock CenterBDSC: 42706
Genetic reagent (D. melanogaster)UAS-luciferaseRNAiBloomington Drosophila Stock CenterBDSC: 31603y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF01355}attP2
Genetic reagent (D. melanogaster)UAS-S-GFP;Bloomington Drosophila Stock CenterBDSC: 7032w[1118]; P{w[+mC]=UAS-NLS-NES[+]-GFP}5A
Genetic reagent (D. melanogaster)UAS-RanGAPZhang et al., 2015a
Genetic reagent (D. melanogaster)UAS-RanGAPRNAi;Bloomington Drosophila Stock CenterBDSC: 29565y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF03244}attP2/TM3, Sb[1]
Genetic reagent (D. melanogaster)UAS-CD8:GFPBloomington Drosophila Stock CenterFlybase: FBti0012685y[1] w[*]; P{w[+mC]=UAS-mCD8::GFP.L}LL5
Genetic reagent (D. melanogaster)UAS-Mitf-HAFrancesca Pignoni
(Zhang et al., 2015b)
Genetic reagent (D. melanogaster)daGSBloomington Drosophila Stock CenterFlybase:
FBtp0057039
w[*]; P{w[+mC]=da-GSGAL4.T}
Genetic reagent (D. melanogaster)UAS-embargoed RNAiBloomington Drosophila Stock CenterBDSC: 31353y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF01311}attP2
Genetic reagent (D. melanogaster)Mitf duplication; MitfSI-RESFrancesca Pignoni (Zhang et al., 2015b)Flybase: FBtp0115483
Genetic reagent (D. melanogaster)UAS-Mitf RNAiBloomington Drosophila Stock CenterBDSC: 43998y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=TRiP.HMS02712}attP2
Genetic reagent (D. melanogaster)UAS-Rab7WTBloomington Drosophila Stock CenterBDSC: 23641y[1] w[*]; P{w[+mC]=UASp YFP.Rab7}21/SM5
Genetic reagent (D. melanogaster)UAS-Cp1EPBloomington Drosophila Stock CenterBDSC: 15957y[1] w[67c23]; P{w[+mC] y[+mDint2]=EPgy2}Cp1[EY05806]
Genetic reagent (D. melanogaster)UAS-Vha100-1EPBloomington Drosophila Stock CenterBDSC: 63269w[1118]; P{w[+mC]=EP}Vha100-1[G4514]/TM6C, Sb[1]
Genetic reagent (D. melanogaster)UAS-TrpmlKartik VenkatachalamFlybase: FBti0162438
Genetic reagent (D. melanogaster)UAS-Vha44EPBloomington Drosophila Stock CenterBDSC: 20140y[1] w[67c23]; P{w[+mC] y[+mDint2]=EPgy2}Vha44[EY02202]
Genetic reagent (D. melanogaster)UAS-VhaSFDEPBloomington Drosophila Stock CenterBDSC: 15758y[1] w[67c23]; P{w[+mC] y[+mDint2]=EPgy2}VhaSFD[EY04644]/CyO
Genetic reagent (D. melanogaster)UAS-Rab7DNBloomington Drosophila Stock CenterBDSC: 9778y[1] w[*]; P{w[+mC]=UASp YFP.Rab7.T22N}06
Genetic reagent (D. melanogaster)UAS-Cp1RNAiBloomington Drosophila Stock CenterBDSC: 32932y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=TRiP.HMS00725}attP2
Genetic reagent (D. melanogaster)UAS-Vha100-1RNAiBloomington Drosophila Stock CenterBDSC: 26290y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02059}attP2
Genetic reagent (D. melanogaster)UAS-TrpmlRNAiBloomington Drosophila Stock CenterBDSC: 31294y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF01239}attP2
Genetic reagent (D. melanogaster)UAS-Vha44RNAiBloomington Drosophila Stock CenterBDSC: 33884y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=TRiP.HMS00821}attP2
Genetic reagent (D. melanogaster)UAS-VhaSFDRNAiBloomington Drosophila Stock CenterBDSC: 40896y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=TRiP.HMS02144}attP40
Genetic reagent (D. melanogaster)UAS-Atg6RNAiBloomington Drosophila Stock CenterBDSC: 35741y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01483}attP2
Genetic reagent (D. melanogaster)UAS-Atg18aRNAiBloomington Drosophila Stock CenterBDSC: 34714y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01193}attP2
Genetic reagent (D. melanogaster)UAS-Atg1Bloomington Drosophila Stock CenterBDSC: 51655y[1] w[*]; P{w[+mC]=UAS-Atg1.S}6B
Genetic reagent (D. melanogaster)UAS-Atg7Bloomington Drosophila Stock CenterNAw[1118]; P{w[+mC]=UAS-Atg7}
Genetic reagent (D. melanogaster)UAS-Atg101RNAiBloomington Drosophila Stock CenterBDSC: 34360y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01349}attP2
Genetic reagent (D. melanogaster)UAS-Atg8aRNAiBloomington Drosophila Stock CenterBDSC: 34340y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01328}attP2
Genetic reagent (D. melanogaster)UAS-Atg5RNAiBloomington Drosophila Stock CenterBDSC: 27551y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02703}attP2
Genetic reagent (D. melanogaster)UAS-Atg5RNAiBloomington Drosophila Stock CenterBDSC: 34899y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01244}attP2
Genetic reagent (D. melanogaster)UAS-Atg8aRNAiBloomington Drosophila Stock CenterBDSC: 28989y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02895}attP2 e[*]/TM3, Sb[1]
Genetic reagent (D. melanogaster)UAS-Atg14RNAiBloomington Drosophila Stock CenterBDSC: 55398y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMC04086}attP2
Genetic reagent (D. melanogaster)UAS-Atg16RNAiBloomington Drosophila Stock CenterBDSC: 34358y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01347}attP2
Genetic reagent (D. melanogaster)UAS-Atg16RNAiBloomington Drosophila Stock CenterBDSC: 58244y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMJ22265}attP40/CyO
Genetic reagent (D. melanogaster)UAS-Atg17RNAiBloomington Drosophila Stock CenterBDSC: 36918y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01611}attP2/TM3, Sb[1]
Genetic reagent (D. melanogaster)UAS-Atg6RNAiBloomington Drosophila Stock CenterBDSC: 28060y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02897}attP2
Genetic reagent (D. melanogaster)UAS-Atg8bRNAiBloomington Drosophila Stock CenterBDSC: 34900y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01245}attP2
Genetic reagent (D. melanogaster)UAS-bchsRNAiBloomington Drosophila Stock CenterBDSC: 42517y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMJ02083}attP40
Genetic reagent (D. melanogaster)UAS-Atg8bRNAiBloomington Drosophila Stock CenterBDSC: 27554y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02706}attP2
Genetic reagent (D. melanogaster)UAS-Atg9RNAiBloomington Drosophila Stock CenterBDSC: 28055y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02891}attP2
Genetic reagent (D. melanogaster)UAS-Atg18aRNAiBloomington Drosophila Stock CenterBDSC: 28061y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02898}attP2
Genetic reagent (D. melanogaster)UAS-GyfRNAiBloomington Drosophila Stock CenterBDSC: 28896y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HM05106}attP2
Genetic reagent (D. melanogaster)Atg600096Bloomington Drosophila Stock CenterBDSC: 11487ry[506] P{ry[+t7.2]=PZ}Atg6[00096]/TM3, ry[RK] Sb[1] Ser[1]
Genetic reagent (D. melanogaster)UAS-Atg4bRNAiBloomington Drosophila Stock CenterBDSC: 56046y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS04249}attP2
Genetic reagent (D. melanogaster)UAS-Atg17EPBloomington Drosophila Stock CenterBDSC: 15618y[1] w[67c23]; P{w[+mC] y[+mDint2]=EPgy2}Atg17[EY03045]
Genetic reagent (D. melanogaster)bchs58Bloomington Drosophila Stock CenterBDSC: 9887y[1] w[*]; P{w[+mC]=EP}EP2299, bchs[58]/CyO
Genetic reagent (D. melanogaster)UAS-Atg4aRNAiBloomington Drosophila Stock CenterBDSC: 35740y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01482}attP2
Genetic reagent (D. melanogaster)UAS-Atg4aRNAiBloomington Drosophila Stock CenterBDSC: 44421y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.GLC01355}attP40
Genetic reagent (D. melanogaster)UAS-Atg10RNAiBloomington Drosophila Stock CenterBDSC: 40859y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS02026}attP40
Genetic reagent (D. melanogaster)UAS-Atg16RNAiBloomington Drosophila Stock CenterBDSC: 34358y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01347}attP2
Genetic reagent (D. melanogaster)UAS-Atg9RNAiBloomington Drosophila Stock CenterBDSC: 34901y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01246}attP2
Genetic reagent (D. melanogaster)UAS-ltRNAiBloomington Drosophila Stock CenterBDSC: 34871y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS00190}attP2/TM3, Sb[1]
Genetic reagent (D. melanogaster)UAS-Atg7RNAiBloomington Drosophila Stock CenterBDSC: 34369y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01358}attP2/TM3, Sb[1]
Genetic reagent (D. melanogaster)Atg7d06996Bloomington Drosophila Stock CenterBDSC: 19257w[1118]; P{w[+mC]=XP}Atg7[d06996]/CyO
Genetic reagent (D. melanogaster)UAS-Atg4aRNAiBloomington Drosophila Stock CenterBDSC: 28367y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF03003}attP2
 genetic reagent (D. melanogaster)UAS-Atg8aRNAiBloomington Drosophila Stock CenterBDSC: 58309y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMJ22416}attP40
Genetic reagent (D. melanogaster)Bchs17Bloomington Drosophila Stock CenterBDSC: 9888y[1] w[*]; P{w[+mC]=EP}EP2299, bchs[17]/CyO
Genetic reagent (D. melanogaster)UAS-Atg8aEPBloomington Drosophila Stock CenterBDSC: 10107w[1118] P{w[+mC]=EP}Atg8a[EP362]
Genetic reagent (D. melanogaster)UAS-Atg2EPBloomington Drosophila Stock CenterBDSC: 17156w[1118]; P{w[+mC]=EP}Atg2[EP3697]/TM6B, Tb[1]
Genetic reagent (D. melanogaster)UAS-Atg7RNAiBloomington Drosophila Stock CenterBDSC: 34369y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01358}attP2/TM3, Sb[1]
Genetic reagent (D. melanogaster)UAS-Atg13RNAiBloomington Drosophila Stock CenterBDSC: 40861y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS02028}attP40
Genetic reagent (D. melanogaster)UAS-Atg14RNAiBloomington Drosophila Stock CenterBDSC: 40858y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS02025}attP40/CyO
Genetic reagent (D. melanogaster)UAS-Atg3EPBloomington Drosophila Stock CenterBDSC: 16429y[1] w[67c23]; P{w[+mC] y[+mDint2]=EPgy2}Atg3[EY08396]
Genetic reagent (D. melanogaster)UAS-Atg18bRNAiBloomington Drosophila Stock CenterBDSC: 34715y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01194}attP2
Genetic reagent (D. melanogaster)UAS-Atg2RNAiBloomington Drosophila Stock CenterBDSC: 27706y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02786}attP2
Genetic reagent (D. melanogaster)Snap29B6-21Bloomington Drosophila Stock CenterBDSC: 56818w[*]; P{ry[+t7.2]=neoFRT}42D Snap29[B6-21]/CyO, P{w[+mC]=GAL4 twi.G}2.2, P{w[+mC]=UAS-2xEGFP}AH2.2
Genetic reagent (D. melanogaster)UAS-Atg3RNAiBloomington Drosophila Stock CenterBDSC: 34359y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01348}attP2
Genetic reagent (D. melanogaster)UAS-Atg2RNAiBloomington Drosophila Stock CenterBDSC: 34719y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01198}attP2
Genetic reagent (D. melanogaster)UAS-Atg18bRNAiBloomington Drosophila Stock CenterBDSC: 34715y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS01194}attP2
Genetic reagent (D. melanogaster)Atg4bP0997Bloomington Drosophila Stock CenterBDSC: 36340y[1] w[*]; P{w[+mC]=lacW}Atg4b[P0997]
Genetic reagent (D. melanogaster)UAS-bchs-HABloomington Drosophila Stock CenterBDSC: 51636y[1] w[*]; P{w[+mC]=UAS bchs.HA}32
Cell line (Homo sapiens)HeLa stably expressing TFEB:GFPShawn Ferguson (Roczniak-Ferguson et al., 2012)
Biological sample (Homo sapiens)Control (non-neurological) and ALS postmortem motor cortex tissueRavitz laboratory (UCSD) through Target ALS Consortium; Brain Resource Center at JHMI
AntibodyRabbit polyclonal anti-dsRedClontechCat#63249, RRID:AB_100134831:1000 for IF
AntibodyMouse monoclonal anti- poly-ubiquitinEnzo Life SciencesCat#BML-PW8805, RRID:AB_105414341:200 for IF
AntibodyRabbit polyclonal anti-ref(2)PGabor Juhasz laboratory (Pircs et al., 2012)1:1000 for IF; 1:1000 for WB
AntibodyGuinea pig polyclonal anti-MitfFrancesca Pignoni laboratory (Zhang et al., 2015b)1:500 for IF
AntibodyRat monoclonal anti-HARocheCat# 11867423001, RRID:AB_3909181:200 for IF
AntibodyChicken polyclonal anti-GFPAbcamCat# ab13970, RRID:AB_3007981:1000 for IF; 1:1000 for WB
AntibodyGuinea pig polyclonal anti-Cp1Patrick Dolph laboratory
(Kinser and Dolph, 2012)
1:2500 for WB
AntibodyMouse monoclonal anti- beta actin (clone C4)EMD MilliporeCat# MAB1501, RRID:AB_22230411:1000 for WB
AntibodyRabbit polyclonal anti- TFEBBethyl BiosciencesCat# A303-673A, RRID:AB_112047511:2000 for WB
AntibodyRabbit polyclonal anti-Histone H3Cell SignalingCat# 9715, RRID:AB_3315631:1000 for WB
AntibodyMouse monoclonal anti-FLAGSigma AldrichCat# F3165, RRID:AB_2595291:1000 for IF
Recombinant DNA reagentpSF-CAG-AmpOxford GeneticsCat# 0G504
Sequence-based reagentActin forwardIntegrated DNA Technologiesq-RT-PCR primer5’- GCGCGGTTACTCTTTCACCA-3’
Sequence-based reagentActin reverseIntegrated DNA Technologiesq-RT-PCR primer5’- ATGTCACGGACGATTTCACG-3’
Sequence-based reagentG4C2 repeats forward (UAS-30R)Integrated DNA Technologiesq-RT-PCR primer5’- GGGATCTAGCCACCATGGAG-3’
Sequence-based reagentG4C2 repeats reverse (UAS-30R)Integrated DNA Technologiesq-RT-PCR primer5’- TACCGTCGACTGCAGAGATTC-3’
Sequence-based reagentMitf forwardIntegrated DNA Technologiesq-RT-PCR primer5’-AGTATCGGAGTAGATGTGCCAC-3’
Sequence-based reagentMitf reverseIntegrated DNA Technologiesq-RT-PCR primer5’- CGCTGAGATATTGCCTCACTTG-3’
Sequence-based reagentVha16-1 forwardIntegrated DNA Technologiesq-RT-PCR primer5’- TCTATGGCCCCTTCTTCGGA-3’
Sequence-based reagentVha16-1 reverseIntegrated DNA Technologiesq-RT-PCR primer5’- AATGGCAATGATACCCGCCA-3’
Sequence-based reagentVha68-2 forwardIntegrated DNA Technologiesq-RT-PCR primer5’- CAAATATGGACGTGTCTTCGCT-3’
Sequence-based reagentVha68-2 reverseIntegrated DNA Technologiesq-RT-PCR primer5’- CCGGATCTCCGACAGTTACG-3’
Sequence-based reagentVha55 forwardIntegrated DNA Technologiesq-RT-PCR primer5’- CGGGACTTTATCTCCCAGCC-3’
Sequence-based reagentVha55 reverseIntegrated DNA Technologiesq-RT-PCR primer5’-TGACCTCATCGAGAATGACCAG-3’
Sequence-based reagentVha44 forwardIntegrated DNA Technologiesq-RT-PCR primer5’- TGGACTCGGAGTACCTGACC-3’
Sequence-based reagentVha44 reverseIntegrated DNA Technologiesq-RT-PCR primer5’- CGTCACGTTGAACAGGCAGTA-3’
Sequence-based reagentVha100-2 forwardIntegrated DNA Technologiesq-RT-PCR primer5’- TGTTCCGTAGTGAGGAGATGG-3’
Sequence-based reagentVha100-2 reverseIntegrated DNA Technologiesq-RT-PCR primer5’- TCACGTTCACATTCAAGTCGC-3’
Sequence-based reagentAtg8a forwardIntegrated DNA Technologiesq-RT-PCR primer5’- GGTCAGTTCTACTTCCTCATTCG-3’
Sequence-based reagentAtg8a reverseIntegrated DNA Technologiesq-RT-PCR primer5’- GATGTTCCTGGTACAGGGAGC-3’
Sequence-based reagentAtg9 forwardIntegrated DNA Technologiesq-RT-PCR primer5’- ACACGCCTCGAAACAGTGG-3’
Sequence-based reagentAtg9 reverseIntegrated DNA Technologiesq-RT-PCR primer5’- TCAAGGTCCTCGATGTGGTTC-3’
Sequence-based reagentref(2)P forwardIntegrated DNA Technologiesq-RT-PCR primer5' - ATGCCGGAGAAGCTGTTGAA - 3'
Sequence-based reagentref(2)P reverseIntegrated DNA Technologiesq-RT-PCR primer5' - ATCAGCGTCGATCCAGAAGG - 3'
Commercial assay or kitSuperScript III First-Strand Synthesis SystemThermo Fischer ScientificCat #18080051
Commercial assay or kitNE-PER Nuclear and Cytoplasmic Extraction KitThermo Fischer ScientificCat #78833
Commercial assay or kitBCA AssayThermo Fischer ScientificCat #23227
Commercial assay or kit4–15% Mini-PROTEAN TGX Precast GelBio-RadCat #4561083
Commercial assay or kitOne Shot TOP10 Chemically Competent E. coliThermo Fischer ScientificCat# C404006
Commercial assay or kitFaststainG-BiosciencesCat #786–34
Commercial assay or kitSYBR Select Master MixThermo Fischer ScientificCat #4472908
Chemical compound, drugBlotting Grade Blocker (nonfat dry milk)Bio-RadCat #1706404
Chemical compound, drugLipofectamine 2000Thermo Fischer ScientificCat #11668019
Chemical compound, drugMifepristone (RU486)Millipore SigmaCat #M8046
Chemical compound, drugRapamycinSelleckchemCat #S1039
Chemical compound, drugD-(+)-Trehalose dihydrateMillipore SigmaCat #T0167
Chemical compound, drugTRIzolThermo Fischer ScientificCat #15596018
Chemical compound, drugProtease Inhibitor CocktailRocheCat#11873580001
Software, algorithmImageJhttps://imagej.nih.gov/ij/
Software, algorithmGraphPad Prism 8https://www.graphpad.com/scientific-software/prism/
Software, algorithmIMARIS 9https://imaris.oxinst.com/
Software, algorithmAdobe Illustrator CC 2018https://www.adobe.com/products/illustrator
Software, algorithmImage Pro Insight 9.1http://www.mediacy.com/imagepro
Software, algorithmWinWCPhttps://pureportal.strath.ac.uk/en/datasets/strathclyde-electrophysiology-software-winwcp-winedr

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

    1. Chen Y
    2. Liu H
    3. Guan Y
    4. Wang Q
    5. Zhou F
    6. Jie L
    7. Ju J
    8. Pu L
    9. Du H
    10. Wang X
    (2015)
    The altered autophagy mediated by TFEB in animal and cell models of amyotrophic lateral sclerosis
    American Journal of Translational Research 7:1574–1587.
    1. Klionsky DJ
    2. Abdelmohsen K
    3. Abe A
    4. Abedin MJ
    5. Abeliovich H
    6. Acevedo Arozena A
    7. Adachi H
    8. Adams CM
    9. Adams PD
    10. Adeli K
    11. Adhihetty PJ
    12. Adler SG
    13. Agam G
    14. Agarwal R
    15. Aghi MK
    16. Agnello M
    17. Agostinis P
    18. Aguilar PV
    19. Aguirre-Ghiso J
    20. Airoldi EM
    21. Ait-Si-Ali S
    22. Akematsu T
    23. Akporiaye ET
    24. Al-Rubeai M
    25. Albaiceta GM
    26. Albanese C
    27. Albani D
    28. Albert ML
    29. Aldudo J
    30. Algül H
    31. Alirezaei M
    32. Alloza I
    33. Almasan A
    34. Almonte-Beceril M
    35. Alnemri ES
    36. Alonso C
    37. Altan-Bonnet N
    38. Altieri DC
    39. Alvarez S
    40. Alvarez-Erviti L
    41. Alves S
    42. Amadoro G
    43. Amano A
    44. Amantini C
    45. Ambrosio S
    46. Amelio I
    47. Amer AO
    48. Amessou M
    49. Amon A
    50. An Z
    51. Anania FA
    52. Andersen SU
    53. Andley UP
    54. Andreadi CK
    55. Andrieu-Abadie N
    56. Anel A
    57. Ann DK
    58. Anoopkumar-Dukie S
    59. Antonioli M
    60. Aoki H
    61. Apostolova N
    62. Aquila S
    63. Aquilano K
    64. Araki K
    65. Arama E
    66. Aranda A
    67. Araya J
    68. Arcaro A
    69. Arias E
    70. Arimoto H
    71. Ariosa AR
    72. Armstrong JL
    73. Arnould T
    74. Arsov I
    75. Asanuma K
    76. Askanas V
    77. Asselin E
    78. Atarashi R
    79. Atherton SS
    80. Atkin JD
    81. Attardi LD
    82. Auberger P
    83. Auburger G
    84. Aurelian L
    85. Autelli R
    86. Avagliano L
    87. Avantaggiati ML
    88. Avrahami L
    89. Awale S
    90. Azad N
    91. Bachetti T
    92. Backer JM
    93. Bae DH
    94. Bae JS
    95. Bae ON
    96. Bae SH
    97. Baehrecke EH
    98. Baek SH
    99. Baghdiguian S
    100. Bagniewska-Zadworna A
    101. Bai H
    102. Bai J
    103. Bai XY
    104. Bailly Y
    105. Balaji KN
    106. Balduini W
    107. Ballabio A
    108. Balzan R
    109. Banerjee R
    110. Bánhegyi G
    111. Bao H
    112. Barbeau B
    113. Barrachina MD
    114. Barreiro E
    115. Bartel B
    116. Bartolomé A
    117. Bassham DC
    118. Bassi MT
    119. Bast RC
    120. Basu A
    121. Batista MT
    122. Batoko H
    123. Battino M
    124. Bauckman K
    125. Baumgarner BL
    126. Bayer KU
    127. Beale R
    128. Beaulieu JF
    129. Beck GR
    130. Becker C
    131. Beckham JD
    132. Bédard PA
    133. Bednarski PJ
    134. Begley TJ
    135. Behl C
    136. Behrends C
    137. Behrens GM
    138. Behrns KE
    139. Bejarano E
    140. Belaid A
    141. Belleudi F
    142. Bénard G
    143. Berchem G
    144. Bergamaschi D
    145. Bergami M
    146. Berkhout B
    147. Berliocchi L
    148. Bernard A
    149. Bernard M
    150. Bernassola F
    151. Bertolotti A
    152. Bess AS
    153. Besteiro S
    154. Bettuzzi S
    155. Bhalla S
    156. Bhattacharyya S
    157. Bhutia SK
    158. Biagosch C
    159. Bianchi MW
    160. Biard-Piechaczyk M
    161. Billes V
    162. Bincoletto C
    163. Bingol B
    164. Bird SW
    165. Bitoun M
    166. Bjedov I
    167. Blackstone C
    168. Blanc L
    169. Blanco GA
    170. Blomhoff HK
    171. Boada-Romero E
    172. Böckler S
    173. Boes M
    174. Boesze-Battaglia K
    175. Boise LH
    176. Bolino A
    177. Boman A
    178. Bonaldo P
    179. Bordi M
    180. Bosch J
    181. Botana LM
    182. Botti J
    183. Bou G
    184. Bouché M
    185. Bouchecareilh M
    186. Boucher MJ
    187. Boulton ME
    188. Bouret SG
    189. Boya P
    190. Boyer-Guittaut M
    191. Bozhkov PV
    192. Brady N
    193. Braga VM
    194. Brancolini C
    195. Braus GH
    196. Bravo-San Pedro JM
    197. Brennan LA
    198. Bresnick EH
    199. Brest P
    200. Bridges D
    201. Bringer MA
    202. Brini M
    203. Brito GC
    204. Brodin B
    205. Brookes PS
    206. Brown EJ
    207. Brown K
    208. Broxmeyer HE
    209. Bruhat A
    210. Brum PC
    211. Brumell JH
    212. Brunetti-Pierri N
    213. Bryson-Richardson RJ
    214. Buch S
    215. Buchan AM
    216. Budak H
    217. Bulavin DV
    218. Bultman SJ
    219. Bultynck G
    220. Bumbasirevic V
    221. Burelle Y
    222. Burke RE
    223. Burmeister M
    224. Bütikofer P
    225. Caberlotto L
    226. Cadwell K
    227. Cahova M
    228. Cai D
    229. Cai J
    230. Cai Q
    231. Calatayud S
    232. Camougrand N
    233. Campanella M
    234. Campbell GR
    235. Campbell M
    236. Campello S
    237. Candau R
    238. Caniggia I
    239. Cantoni L
    240. Cao L
    241. Caplan AB
    242. Caraglia M
    243. Cardinali C
    244. Cardoso SM
    245. Carew JS
    246. Carleton LA
    247. Carlin CR
    248. Carloni S
    249. Carlsson SR
    250. Carmona-Gutierrez D
    251. Carneiro LA
    252. Carnevali O
    253. Carra S
    254. Carrier A
    255. Carroll B
    256. Casas C
    257. Casas J
    258. Cassinelli G
    259. Castets P
    260. Castro-Obregon S
    261. Cavallini G
    262. Ceccherini I
    263. Cecconi F
    264. Cederbaum AI
    265. Ceña V
    266. Cenci S
    267. Cerella C
    268. Cervia D
    269. Cetrullo S
    270. Chaachouay H
    271. Chae HJ
    272. Chagin AS
    273. Chai CY
    274. Chakrabarti G
    275. Chamilos G
    276. Chan EY
    277. Chan MT
    278. Chandra D
    279. Chandra P
    280. Chang CP
    281. Chang RC
    282. Chang TY
    283. Chatham JC
    284. Chatterjee S
    285. Chauhan S
    286. Che Y
    287. Cheetham ME
    288. Cheluvappa R
    289. Chen CJ
    290. Chen G
    291. Chen GC
    292. Chen G
    293. Chen H
    294. Chen JW
    295. Chen JK
    296. Chen M
    297. Chen M
    298. Chen P
    299. Chen Q
    300. Chen Q
    301. Chen SD
    302. Chen S
    303. Chen SS
    304. Chen W
    305. Chen WJ
    306. Chen WQ
    307. Chen W
    308. Chen X
    309. Chen YH
    310. Chen YG
    311. Chen Y
    312. Chen Y
    313. Chen Y
    314. Chen YJ
    315. Chen YQ
    316. Chen Y
    317. Chen Z
    318. Chen Z
    319. Cheng A
    320. Cheng CH
    321. Cheng H
    322. Cheong H
    323. Cherry S
    324. Chesney J
    325. Cheung CH
    326. Chevet E
    327. Chi HC
    328. Chi SG
    329. Chiacchiera F
    330. Chiang HL
    331. Chiarelli R
    332. Chiariello M
    333. Chieppa M
    334. Chin LS
    335. Chiong M
    336. Chiu GN
    337. Cho DH
    338. Cho SG
    339. Cho WC
    340. Cho YY
    341. Cho YS
    342. Choi AM
    343. Choi EJ
    344. Choi EK
    345. Choi J
    346. Choi ME
    347. Choi SI
    348. Chou TF
    349. Chouaib S
    350. Choubey D
    351. Choubey V
    352. Chow KC
    353. Chowdhury K
    354. Chu CT
    355. Chuang TH
    356. Chun T
    357. Chung H
    358. Chung T
    359. Chung YL
    360. Chwae YJ
    361. Cianfanelli V
    362. Ciarcia R
    363. Ciechomska IA
    364. Ciriolo MR
    365. Cirone M
    366. Claerhout S
    367. Clague MJ
    368. Clària J
    369. Clarke PG
    370. Clarke R
    371. Clementi E
    372. Cleyrat C
    373. Cnop M
    374. Coccia EM
    375. Cocco T
    376. Codogno P
    377. Coers J
    378. Cohen EE
    379. Colecchia D
    380. Coletto L
    381. Coll NS
    382. Colucci-Guyon E
    383. Comincini S
    384. Condello M
    385. Cook KL
    386. Coombs GH
    387. Cooper CD
    388. Cooper JM
    389. Coppens I
    390. Corasaniti MT
    391. Corazzari M
    392. Corbalan R
    393. Corcelle-Termeau E
    394. Cordero MD
    395. Corral-Ramos C
    396. Corti O
    397. Cossarizza A
    398. Costelli P
    399. Costes S
    400. Cotman SL
    401. Coto-Montes A
    402. Cottet S
    403. Couve E
    404. Covey LR
    405. Cowart LA
    406. Cox JS
    407. Coxon FP
    408. Coyne CB
    409. Cragg MS
    410. Craven RJ
    411. Crepaldi T
    412. Crespo JL
    413. Criollo A
    414. Crippa V
    415. Cruz MT
    416. Cuervo AM
    417. Cuezva JM
    418. Cui T
    419. Cutillas PR
    420. Czaja MJ
    421. Czyzyk-Krzeska MF
    422. Dagda RK
    423. Dahmen U
    424. Dai C
    425. Dai W
    426. Dai Y
    427. Dalby KN
    428. Dalla Valle L
    429. Dalmasso G
    430. D'Amelio M
    431. Damme M
    432. Darfeuille-Michaud A
    433. Dargemont C
    434. Darley-Usmar VM
    435. Dasarathy S
    436. Dasgupta B
    437. Dash S
    438. Dass CR
    439. Davey HM
    440. Davids LM
    441. Dávila D
    442. Davis RJ
    443. Dawson TM
    444. Dawson VL
    445. Daza P
    446. de Belleroche J
    447. de Figueiredo P
    448. de Figueiredo RC
    449. de la Fuente J
    450. De Martino L
    451. De Matteis A
    452. De Meyer GR
    453. De Milito A
    454. De Santi M
    455. de Souza W
    456. De Tata V
    457. De Zio D
    458. Debnath J
    459. Dechant R
    460. Decuypere JP
    461. Deegan S
    462. Dehay B
    463. Del Bello B
    464. Del Re DP
    465. Delage-Mourroux R
    466. Delbridge LM
    467. Deldicque L
    468. Delorme-Axford E
    469. Deng Y
    470. Dengjel J
    471. Denizot M
    472. Dent P
    473. Der CJ
    474. Deretic V
    475. Derrien B
    476. Deutsch E
    477. Devarenne TP
    478. Devenish RJ
    479. Di Bartolomeo S
    480. Di Daniele N
    481. Di Domenico F
    482. Di Nardo A
    483. Di Paola S
    484. Di Pietro A
    485. Di Renzo L
    486. DiAntonio A
    487. Díaz-Araya G
    488. Díaz-Laviada I
    489. Diaz-Meco MT
    490. Diaz-Nido J
    491. Dickey CA
    492. Dickson RC
    493. Diederich M
    494. Digard P
    495. Dikic I
    496. Dinesh-Kumar SP
    497. Ding C
    498. Ding WX
    499. Ding Z
    500. Dini L
    501. Distler JH
    502. Diwan A
    503. Djavaheri-Mergny M
    504. Dmytruk K
    505. Dobson RC
    506. Doetsch V
    507. Dokladny K
    508. Dokudovskaya S
    509. Donadelli M
    510. Dong XC
    511. Dong X
    512. Dong Z
    513. Donohue TM
    514. Doran KS
    515. D'Orazi G
    516. Dorn GW
    517. Dosenko V
    518. Dridi S
    519. Drucker L
    520. Du J
    521. Du LL
    522. Du L
    523. du Toit A
    524. Dua P
    525. Duan L
    526. Duann P
    527. Dubey VK
    528. Duchen MR
    529. Duchosal MA
    530. Duez H
    531. Dugail I
    532. Dumit VI
    533. Duncan MC
    534. Dunlop EA
    535. Dunn WA
    536. Dupont N
    537. Dupuis L
    538. Durán RV
    539. Durcan TM
    540. Duvezin-Caubet S
    541. Duvvuri U
    542. Eapen V
    543. Ebrahimi-Fakhari D
    544. Echard A
    545. Eckhart L
    546. Edelstein CL
    547. Edinger AL
    548. Eichinger L
    549. Eisenberg T
    550. Eisenberg-Lerner A
    551. Eissa NT
    552. El-Deiry WS
    553. El-Khoury V
    554. Elazar Z
    555. Eldar-Finkelman H
    556. Elliott CJ
    557. Emanuele E
    558. Emmenegger U
    559. Engedal N
    560. Engelbrecht AM
    561. Engelender S
    562. Enserink JM
    563. Erdmann R
    564. Erenpreisa J
    565. Eri R
    566. Eriksen JL
    567. Erman A
    568. Escalante R
    569. Eskelinen EL
    570. Espert L
    571. Esteban-Martínez L
    572. Evans TJ
    573. Fabri M
    574. Fabrias G
    575. Fabrizi C
    576. Facchiano A
    577. Færgeman NJ
    578. Faggioni A
    579. Fairlie WD
    580. Fan C
    581. Fan D
    582. Fan J
    583. Fang S
    584. Fanto M
    585. Fanzani A
    586. Farkas T
    587. Faure M
    588. Favier FB
    589. Fearnhead H
    590. Federici M
    591. Fei E
    592. Felizardo TC
    593. Feng H
    594. Feng Y
    595. Feng Y
    596. Ferguson TA
    597. Fernández ÁF
    598. Fernandez-Barrena MG
    599. Fernandez-Checa JC
    600. Fernández-López A
    601. Fernandez-Zapico ME
    602. Feron O
    603. Ferraro E
    604. Ferreira-Halder CV
    605. Fesus L
    606. Feuer R
    607. Fiesel FC
    608. Filippi-Chiela EC
    609. Filomeni G
    610. Fimia GM
    611. Fingert JH
    612. Finkbeiner S
    613. Finkel T
    614. Fiorito F
    615. Fisher PB
    616. Flajolet M
    617. Flamigni F
    618. Florey O
    619. Florio S
    620. Floto RA
    621. Folini M
    622. Follo C
    623. Fon EA
    624. Fornai F
    625. Fortunato F
    626. Fraldi A
    627. Franco R
    628. Francois A
    629. François A
    630. Frankel LB
    631. Fraser ID
    632. Frey N
    633. Freyssenet DG
    634. Frezza C
    635. Friedman SL
    636. Frigo DE
    637. Fu D
    638. Fuentes JM
    639. Fueyo J
    640. Fujitani Y
    641. Fujiwara Y
    642. Fujiya M
    643. Fukuda M
    644. Fulda S
    645. Fusco C
    646. Gabryel B
    647. Gaestel M
    648. Gailly P
    649. Gajewska M
    650. Galadari S
    651. Galili G
    652. Galindo I
    653. Galindo MF
    654. Galliciotti G
    655. Galluzzi L
    656. Galluzzi L
    657. Galy V
    658. Gammoh N
    659. Gandy S
    660. Ganesan AK
    661. Ganesan S
    662. Ganley IG
    663. Gannagé M
    664. Gao FB
    665. Gao F
    666. Gao JX
    667. García Nannig L
    668. García Véscovi E
    669. Garcia-Macía M
    670. Garcia-Ruiz C
    671. Garg AD
    672. Garg PK
    673. Gargini R
    674. Gassen NC
    675. Gatica D
    676. Gatti E
    677. Gavard J
    678. Gavathiotis E
    679. Ge L
    680. Ge P
    681. Ge S
    682. Gean PW
    683. Gelmetti V
    684. Genazzani AA
    685. Geng J
    686. Genschik P
    687. Gerner L
    688. Gestwicki JE
    689. Gewirtz DA
    690. Ghavami S
    691. Ghigo E
    692. Ghosh D
    693. Giammarioli AM
    694. Giampieri F
    695. Giampietri C
    696. Giatromanolaki A
    697. Gibbings DJ
    698. Gibellini L
    699. Gibson SB
    700. Ginet V
    701. Giordano A
    702. Giorgini F
    703. Giovannetti E
    704. Girardin SE
    705. Gispert S
    706. Giuliano S
    707. Gladson CL
    708. Glavic A
    709. Gleave M
    710. Godefroy N
    711. Gogal RM
    712. Gokulan K
    713. Goldman GH
    714. Goletti D
    715. Goligorsky MS
    716. Gomes AV
    717. Gomes LC
    718. Gomez H
    719. Gomez-Manzano C
    720. Gómez-Sánchez R
    721. Gonçalves DA
    722. Goncu E
    723. Gong Q
    724. Gongora C
    725. Gonzalez CB
    726. Gonzalez-Alegre P
    727. Gonzalez-Cabo P
    728. González-Polo RA
    729. Goping IS
    730. Gorbea C
    731. Gorbunov NV
    732. Goring DR
    733. Gorman AM
    734. Gorski SM
    735. Goruppi S
    736. Goto-Yamada S
    737. Gotor C
    738. Gottlieb RA
    739. Gozes I
    740. Gozuacik D
    741. Graba Y
    742. Graef M
    743. Granato GE
    744. Grant GD
    745. Grant S
    746. Gravina GL
    747. Green DR
    748. Greenhough A
    749. Greenwood MT
    750. Grimaldi B
    751. Gros F
    752. Grose C
    753. Groulx JF
    754. Gruber F
    755. Grumati P
    756. Grune T
    757. Guan JL
    758. Guan KL
    759. Guerra B
    760. Guillen C
    761. Gulshan K
    762. Gunst J
    763. Guo C
    764. Guo L
    765. Guo M
    766. Guo W
    767. Guo XG
    768. Gust AA
    769. Gustafsson ÅB
    770. Gutierrez E
    771. Gutierrez MG
    772. Gwak HS
    773. Haas A
    774. Haber JE
    775. Hadano S
    776. Hagedorn M
    777. Hahn DR
    778. Halayko AJ
    779. Hamacher-Brady A
    780. Hamada K
    781. Hamai A
    782. Hamann A
    783. Hamasaki M
    784. Hamer I
    785. Hamid Q
    786. Hammond EM
    787. Han F
    788. Han W
    789. Handa JT
    790. Hanover JA
    791. Hansen M
    792. Harada M
    793. Harhaji-Trajkovic L
    794. Harper JW
    795. Harrath AH
    796. Harris AL
    797. Harris J
    798. Hasler U
    799. Hasselblatt P
    800. Hasui K
    801. Hawley RG
    802. Hawley TS
    803. He C
    804. He CY
    805. He F
    806. He G
    807. He RR
    808. He XH
    809. He YW
    810. He YY
    811. Heath JK
    812. Hébert MJ
    813. Heinzen RA
    814. Helgason GV
    815. Hensel M
    816. Henske EP
    817. Her C
    818. Herman PK
    819. Hernández A
    820. Hernandez C
    821. Hernández-Tiedra S
    822. Hetz C
    823. Hiesinger PR
    824. Higaki K
    825. Hilfiker S
    826. Hill BG
    827. Hill JA
    828. Hill WD
    829. Hino K
    830. Hofius D
    831. Hofman P
    832. Höglinger GU
    833. Höhfeld J
    834. Holz MK
    835. Hong Y
    836. Hood DA
    837. Hoozemans JJ
    838. Hoppe T
    839. Hsu C
    840. Hsu CY
    841. Hsu LC
    842. Hu D
    843. Hu G
    844. Hu HM
    845. Hu H
    846. Hu MC
    847. Hu YC
    848. Hu ZW
    849. Hua F
    850. Hua Y
    851. Huang C
    852. Huang HL
    853. Huang KH
    854. Huang KY
    855. Huang S
    856. Huang S
    857. Huang WP
    858. Huang YR
    859. Huang Y
    860. Huang Y
    861. Huber TB
    862. Huebbe P
    863. Huh WK
    864. Hulmi JJ
    865. Hur GM
    866. Hurley JH
    867. Husak Z
    868. Hussain SN
    869. Hussain S
    870. Hwang JJ
    871. Hwang S
    872. Hwang TI
    873. Ichihara A
    874. Imai Y
    875. Imbriano C
    876. Inomata M
    877. Into T
    878. Iovane V
    879. Iovanna JL
    880. Iozzo RV
    881. Ip NY
    882. Irazoqui JE
    883. Iribarren P
    884. Isaka Y
    885. Isakovic AJ
    886. Ischiropoulos H
    887. Isenberg JS
    888. Ishaq M
    889. Ishida H
    890. Ishii I
    891. Ishmael JE
    892. Isidoro C
    893. Isobe K
    894. Isono E
    895. Issazadeh-Navikas S
    896. Itahana K
    897. Itakura E
    898. Ivanov AI
    899. Iyer AK
    900. Izquierdo JM
    901. Izumi Y
    902. Izzo V
    903. Jäättelä M
    904. Jaber N
    905. Jackson DJ
    906. Jackson WT
    907. Jacob TG
    908. Jacques TS
    909. Jagannath C
    910. Jain A
    911. Jana NR
    912. Jang BK
    913. Jani A
    914. Janji B
    915. Jannig PR
    916. Jansson PJ
    917. Jean S
    918. Jendrach M
    919. Jeon JH
    920. Jessen N
    921. Jeung EB
    922. Jia K
    923. Jia L
    924. Jiang H
    925. Jiang H
    926. Jiang L
    927. Jiang T
    928. Jiang X
    929. Jiang X
    930. Jiang X
    931. Jiang Y
    932. Jiang Y
    933. Jiménez A
    934. Jin C
    935. Jin H
    936. Jin L
    937. Jin M
    938. Jin S
    939. Jinwal UK
    940. Jo EK
    941. Johansen T
    942. Johnson DE
    943. Johnson GV
    944. Johnson JD
    945. Jonasch E
    946. Jones C
    947. Joosten LA
    948. Jordan J
    949. Joseph AM
    950. Joseph B
    951. Joubert AM
    952. Ju D
    953. Ju J
    954. Juan HF
    955. Juenemann K
    956. Juhász G
    957. Jung HS
    958. Jung JU
    959. Jung YK
    960. Jungbluth H
    961. Justice MJ
    962. Jutten B
    963. Kaakoush NO
    964. Kaarniranta K
    965. Kaasik A
    966. Kabuta T
    967. Kaeffer B
    968. Kågedal K
    969. Kahana A
    970. Kajimura S
    971. Kakhlon O
    972. Kalia M
    973. Kalvakolanu DV
    974. Kamada Y
    975. Kambas K
    976. Kaminskyy VO
    977. Kampinga HH
    978. Kandouz M
    979. Kang C
    980. Kang R
    981. Kang TC
    982. Kanki T
    983. Kanneganti TD
    984. Kanno H
    985. Kanthasamy AG
    986. Kantorow M
    987. Kaparakis-Liaskos M
    988. Kapuy O
    989. Karantza V
    990. Karim MR
    991. Karmakar P
    992. Kaser A
    993. Kaushik S
    994. Kawula T
    995. Kaynar AM
    996. Ke PY
    997. Ke ZJ
    998. Kehrl JH
    999. Keller KE
    1000. Kemper JK
    1001. Kenworthy AK
    1002. Kepp O
    1003. Kern A
    1004. Kesari S
    1005. Kessel D
    1006. Ketteler R
    1007. Kettelhut IC
    1008. Khambu B
    1009. Khan MM
    1010. Khandelwal VK
    1011. Khare S
    1012. Kiang JG
    1013. Kiger AA
    1014. Kihara A
    1015. Kim AL
    1016. Kim CH
    1017. Kim DR
    1018. Kim DH
    1019. Kim EK
    1020. Kim HY
    1021. Kim HR
    1022. Kim JS
    1023. Kim JH
    1024. Kim JC
    1025. Kim JH
    1026. Kim KW
    1027. Kim MD
    1028. Kim MM
    1029. Kim PK
    1030. Kim SW
    1031. Kim SY
    1032. Kim YS
    1033. Kim Y
    1034. Kimchi A
    1035. Kimmelman AC
    1036. Kimura T
    1037. King JS
    1038. Kirkegaard K
    1039. Kirkin V
    1040. Kirshenbaum LA
    1041. Kishi S
    1042. Kitajima Y
    1043. Kitamoto K
    1044. Kitaoka Y
    1045. Kitazato K
    1046. Kley RA
    1047. Klimecki WT
    1048. Klinkenberg M
    1049. Klucken J
    1050. Knævelsrud H
    1051. Knecht E
    1052. Knuppertz L
    1053. Ko JL
    1054. Kobayashi S
    1055. Koch JC
    1056. Koechlin-Ramonatxo C
    1057. Koenig U
    1058. Koh YH
    1059. Köhler K
    1060. Kohlwein SD
    1061. Koike M
    1062. Komatsu M
    1063. Kominami E
    1064. Kong D
    1065. Kong HJ
    1066. Konstantakou EG
    1067. Kopp BT
    1068. Korcsmaros T
    1069. Korhonen L
    1070. Korolchuk VI
    1071. Koshkina NV
    1072. Kou Y
    1073. Koukourakis MI
    1074. Koumenis C
    1075. Kovács AL
    1076. Kovács T
    1077. Kovacs WJ
    1078. Koya D
    1079. Kraft C
    1080. Krainc D
    1081. Kramer H
    1082. Kravic-Stevovic T
    1083. Krek W
    1084. Kretz-Remy C
    1085. Krick R
    1086. Krishnamurthy M
    1087. Kriston-Vizi J
    1088. Kroemer G
    1089. Kruer MC
    1090. Kruger R
    1091. Ktistakis NT
    1092. Kuchitsu K
    1093. Kuhn C
    1094. Kumar AP
    1095. Kumar A
    1096. Kumar A
    1097. Kumar D
    1098. Kumar D
    1099. Kumar R
    1100. Kumar S
    1101. Kundu M
    1102. Kung HJ
    1103. Kuno A
    1104. Kuo SH
    1105. Kuret J
    1106. Kurz T
    1107. Kwok T
    1108. Kwon TK
    1109. Kwon YT
    1110. Kyrmizi I
    1111. La Spada AR
    1112. Lafont F
    1113. Lahm T
    1114. Lakkaraju A
    1115. Lam T
    1116. Lamark T
    1117. Lancel S
    1118. Landowski TH
    1119. Lane DJ
    1120. Lane JD
    1121. Lanzi C
    1122. Lapaquette P
    1123. Lapierre LR
    1124. Laporte J
    1125. Laukkarinen J
    1126. Laurie GW
    1127. Lavandero S
    1128. Lavie L
    1129. LaVoie MJ
    1130. Law BY
    1131. Law HK
    1132. Law KB
    1133. Layfield R
    1134. Lazo PA
    1135. Le Cam L
    1136. Le Roch KG
    1137. Le Stunff H
    1138. Leardkamolkarn V
    1139. Lecuit M
    1140. Lee BH
    1141. Lee CH
    1142. Lee EF
    1143. Lee GM
    1144. Lee HJ
    1145. Lee H
    1146. Lee JK
    1147. Lee J
    1148. Lee JH
    1149. Lee JH
    1150. Lee M
    1151. Lee MS
    1152. Lee PJ
    1153. Lee SW
    1154. Lee SJ
    1155. Lee SJ
    1156. Lee SY
    1157. Lee SH
    1158. Lee SS
    1159. Lee SJ
    1160. Lee S
    1161. Lee YR
    1162. Lee YJ
    1163. Lee YH
    1164. Leeuwenburgh C
    1165. Lefort S
    1166. Legouis R
    1167. Lei J
    1168. Lei QY
    1169. Leib DA
    1170. Leibowitz G
    1171. Lekli I
    1172. Lemaire SD
    1173. Lemasters JJ
    1174. Lemberg MK
    1175. Lemoine A
    1176. Leng S
    1177. Lenz G
    1178. Lenzi P
    1179. Lerman LO
    1180. Lettieri Barbato D
    1181. Leu JI
    1182. Leung HY
    1183. Levine B
    1184. Lewis PA
    1185. Lezoualc'h F
    1186. Li C
    1187. Li F
    1188. Li FJ
    1189. Li J
    1190. Li K
    1191. Li L
    1192. Li M
    1193. Li M
    1194. Li Q
    1195. Li R
    1196. Li S
    1197. Li W
    1198. Li W
    1199. Li X
    1200. Li Y
    1201. Lian J
    1202. Liang C
    1203. Liang Q
    1204. Liao Y
    1205. Liberal J
    1206. Liberski PP
    1207. Lie P
    1208. Lieberman AP
    1209. Lim HJ
    1210. Lim KL
    1211. Lim K
    1212. Lima RT
    1213. Lin CS
    1214. Lin CF
    1215. Lin F
    1216. Lin F
    1217. Lin FC
    1218. Lin K
    1219. Lin KH
    1220. Lin PH
    1221. Lin T
    1222. Lin WW
    1223. Lin YS
    1224. Lin Y
    1225. Linden R
    1226. Lindholm D
    1227. Lindqvist LM
    1228. Lingor P
    1229. Linkermann A
    1230. Liotta LA
    1231. Lipinski MM
    1232. Lira VA
    1233. Lisanti MP
    1234. Liton PB
    1235. Liu B
    1236. Liu C
    1237. Liu CF
    1238. Liu F
    1239. Liu HJ
    1240. Liu J
    1241. Liu JJ
    1242. Liu JL
    1243. Liu K
    1244. Liu L
    1245. Liu L
    1246. Liu Q
    1247. Liu RY
    1248. Liu S
    1249. Liu S
    1250. Liu W
    1251. Liu XD
    1252. Liu X
    1253. Liu XH
    1254. Liu X
    1255. Liu X
    1256. Liu X
    1257. Liu Y
    1258. Liu Y
    1259. Liu Z
    1260. Liu Z
    1261. Liuzzi JP
    1262. Lizard G
    1263. Ljujic M
    1264. Lodhi IJ
    1265. Logue SE
    1266. Lokeshwar BL
    1267. Long YC
    1268. Lonial S
    1269. Loos B
    1270. López-Otín C
    1271. López-Vicario C
    1272. Lorente M
    1273. Lorenzi PL
    1274. Lõrincz P
    1275. Los M
    1276. Lotze MT
    1277. Lovat PE
    1278. Lu B
    1279. Lu B
    1280. Lu J
    1281. Lu Q
    1282. Lu SM
    1283. Lu S
    1284. Lu Y
    1285. Luciano F
    1286. Luckhart S
    1287. Lucocq JM
    1288. Ludovico P
    1289. Lugea A
    1290. Lukacs NW
    1291. Lum JJ
    1292. Lund AH
    1293. Luo H
    1294. Luo J
    1295. Luo S
    1296. Luparello C
    1297. Lyons T
    1298. Ma J
    1299. Ma Y
    1300. Ma Y
    1301. Ma Z
    1302. Machado J
    1303. Machado-Santelli GM
    1304. Macian F
    1305. MacIntosh GC
    1306. MacKeigan JP
    1307. Macleod KF
    1308. MacMicking JD
    1309. MacMillan-Crow LA
    1310. Madeo F
    1311. Madesh M
    1312. Madrigal-Matute J
    1313. Maeda A
    1314. Maeda T
    1315. Maegawa G
    1316. Maellaro E
    1317. Maes H
    1318. Magariños M
    1319. Maiese K
    1320. Maiti TK
    1321. Maiuri L
    1322. Maiuri MC
    1323. Maki CG
    1324. Malli R
    1325. Malorni W
    1326. Maloyan A
    1327. Mami-Chouaib F
    1328. Man N
    1329. Mancias JD
    1330. Mandelkow EM
    1331. Mandell MA
    1332. Manfredi AA
    1333. Manié SN
    1334. Manzoni C
    1335. Mao K
    1336. Mao Z
    1337. Mao ZW
    1338. Marambaud P
    1339. Marconi AM
    1340. Marelja Z
    1341. Marfe G
    1342. Margeta M
    1343. Margittai E
    1344. Mari M
    1345. Mariani FV
    1346. Marin C
    1347. Marinelli S
    1348. Mariño G
    1349. Markovic I
    1350. Marquez R
    1351. Martelli AM
    1352. Martens S
    1353. Martin KR
    1354. Martin SJ
    1355. Martin S
    1356. Martin-Acebes MA
    1357. Martín-Sanz P
    1358. Martinand-Mari C
    1359. Martinet W
    1360. Martinez J
    1361. Martinez-Lopez N
    1362. Martinez-Outschoorn U
    1363. Martínez-Velázquez M
    1364. Martinez-Vicente M
    1365. Martins WK
    1366. Mashima H
    1367. Mastrianni JA
    1368. Matarese G
    1369. Matarrese P
    1370. Mateo R
    1371. Matoba S
    1372. Matsumoto N
    1373. Matsushita T
    1374. Matsuura A
    1375. Matsuzawa T
    1376. Mattson MP
    1377. Matus S
    1378. Maugeri N
    1379. Mauvezin C
    1380. Mayer A
    1381. Maysinger D
    1382. Mazzolini GD
    1383. McBrayer MK
    1384. McCall K
    1385. McCormick C
    1386. McInerney GM
    1387. McIver SC
    1388. McKenna S
    1389. McMahon JJ
    1390. McNeish IA
    1391. Mechta-Grigoriou F
    1392. Medema JP
    1393. Medina DL
    1394. Megyeri K
    1395. Mehrpour M
    1396. Mehta JL
    1397. Mei Y
    1398. Meier UC
    1399. Meijer AJ
    1400. Meléndez A
    1401. Melino G
    1402. Melino S
    1403. de Melo EJ
    1404. Mena MA
    1405. Meneghini MD
    1406. Menendez JA
    1407. Menezes R
    1408. Meng L
    1409. Meng LH
    1410. Meng S
    1411. Menghini R
    1412. Menko AS
    1413. Menna-Barreto RF
    1414. Menon MB
    1415. Meraz-Ríos MA
    1416. Merla G
    1417. Merlini L
    1418. Merlot AM
    1419. Meryk A
    1420. Meschini S
    1421. Meyer JN
    1422. Mi MT
    1423. Miao CY
    1424. Micale L
    1425. Michaeli S
    1426. Michiels C
    1427. Migliaccio AR
    1428. Mihailidou AS
    1429. Mijaljica D
    1430. Mikoshiba K
    1431. Milan E
    1432. Miller-Fleming L
    1433. Mills GB
    1434. Mills IG
    1435. Minakaki G
    1436. Minassian BA
    1437. Ming XF
    1438. Minibayeva F
    1439. Minina EA
    1440. Mintern JD
    1441. Minucci S
    1442. Miranda-Vizuete A
    1443. Mitchell CH
    1444. Miyamoto S
    1445. Miyazawa K
    1446. Mizushima N
    1447. Mnich K
    1448. Mograbi B
    1449. Mohseni S
    1450. Moita LF
    1451. Molinari M
    1452. Molinari M
    1453. Møller AB
    1454. Mollereau B
    1455. Mollinedo F
    1456. Mongillo M
    1457. Monick MM
    1458. Montagnaro S
    1459. Montell C
    1460. Moore DJ
    1461. Moore MN
    1462. Mora-Rodriguez R
    1463. Moreira PI
    1464. Morel E
    1465. Morelli MB
    1466. Moreno S
    1467. Morgan MJ
    1468. Moris A
    1469. Moriyasu Y
    1470. Morrison JL
    1471. Morrison LA
    1472. Morselli E
    1473. Moscat J
    1474. Moseley PL
    1475. Mostowy S
    1476. Motori E
    1477. Mottet D
    1478. Mottram JC
    1479. Moussa CE
    1480. Mpakou VE
    1481. Mukhtar H
    1482. Mulcahy Levy JM
    1483. Muller S
    1484. Muñoz-Moreno R
    1485. Muñoz-Pinedo C
    1486. Münz C
    1487. Murphy ME
    1488. Murray JT
    1489. Murthy A
    1490. Mysorekar IU
    1491. Nabi IR
    1492. Nabissi M
    1493. Nader GA
    1494. Nagahara Y
    1495. Nagai Y
    1496. Nagata K
    1497. Nagelkerke A
    1498. Nagy P
    1499. Naidu SR
    1500. Nair S
    1501. Nakano H
    1502. Nakatogawa H
    1503. Nanjundan M
    1504. Napolitano G
    1505. Naqvi NI
    1506. Nardacci R
    1507. Narendra DP
    1508. Narita M
    1509. Nascimbeni AC
    1510. Natarajan R
    1511. Navegantes LC
    1512. Nawrocki ST
    1513. Nazarko TY
    1514. Nazarko VY
    1515. Neill T
    1516. Neri LM
    1517. Netea MG
    1518. Netea-Maier RT
    1519. Neves BM
    1520. Ney PA
    1521. Nezis IP
    1522. Nguyen HT
    1523. Nguyen HP
    1524. Nicot AS
    1525. Nilsen H
    1526. Nilsson P
    1527. Nishimura M
    1528. Nishino I
    1529. Niso-Santano M
    1530. Niu H
    1531. Nixon RA
    1532. Njar VC
    1533. Noda T
    1534. Noegel AA
    1535. Nolte EM
    1536. Norberg E
    1537. Norga KK
    1538. Noureini SK
    1539. Notomi S
    1540. Notterpek L
    1541. Nowikovsky K
    1542. Nukina N
    1543. Nürnberger T
    1544. O'Donnell VB
    1545. O'Donovan T
    1546. O'Dwyer PJ
    1547. Oehme I
    1548. Oeste CL
    1549. Ogawa M
    1550. Ogretmen B
    1551. Ogura Y
    1552. Oh YJ
    1553. Ohmuraya M
    1554. Ohshima T
    1555. Ojha R
    1556. Okamoto K
    1557. Okazaki T
    1558. Oliver FJ
    1559. Ollinger K
    1560. Olsson S
    1561. Orban DP
    1562. Ordonez P
    1563. Orhon I
    1564. Orosz L
    1565. O'Rourke EJ
    1566. Orozco H
    1567. Ortega AL
    1568. Ortona E
    1569. Osellame LD
    1570. Oshima J
    1571. Oshima S
    1572. Osiewacz HD
    1573. Otomo T
    1574. Otsu K
    1575. Ou JH
    1576. Outeiro TF
    1577. Ouyang DY
    1578. Ouyang H
    1579. Overholtzer M
    1580. Ozbun MA
    1581. Ozdinler PH
    1582. Ozpolat B
    1583. Pacelli C
    1584. Paganetti P
    1585. Page G
    1586. Pages G
    1587. Pagnini U
    1588. Pajak B
    1589. Pak SC
    1590. Pakos-Zebrucka K
    1591. Pakpour N
    1592. Palková Z
    1593. Palladino F
    1594. Pallauf K
    1595. Pallet N
    1596. Palmieri M
    1597. Paludan SR
    1598. Palumbo C
    1599. Palumbo S
    1600. Pampliega O
    1601. Pan H
    1602. Pan W
    1603. Panaretakis T
    1604. Pandey A
    1605. Pantazopoulou A
    1606. Papackova Z
    1607. Papademetrio DL
    1608. Papassideri I
    1609. Papini A
    1610. Parajuli N
    1611. Pardo J
    1612. Parekh VV
    1613. Parenti G
    1614. Park JI
    1615. Park J
    1616. Park OK
    1617. Parker R
    1618. Parlato R
    1619. Parys JB
    1620. Parzych KR
    1621. Pasquet JM
    1622. Pasquier B
    1623. Pasumarthi KB
    1624. Patschan D
    1625. Patterson C
    1626. Pattingre S
    1627. Pattison S
    1628. Pause A
    1629. Pavenstädt H
    1630. Pavone F
    1631. Pedrozo Z
    1632. Peña FJ
    1633. Peñalva MA
    1634. Pende M
    1635. Peng J
    1636. Penna F
    1637. Penninger JM
    1638. Pensalfini A
    1639. Pepe S
    1640. Pereira GJ
    1641. Pereira PC
    1642. Pérez-de la Cruz V
    1643. Pérez-Pérez ME
    1644. Pérez-Rodríguez D
    1645. Pérez-Sala D
    1646. Perier C
    1647. Perl A
    1648. Perlmutter DH
    1649. Perrotta I
    1650. Pervaiz S
    1651. Pesonen M
    1652. Pessin JE
    1653. Peters GJ
    1654. Petersen M
    1655. Petrache I
    1656. Petrof BJ
    1657. Petrovski G
    1658. Phang JM
    1659. Piacentini M
    1660. Pierdominici M
    1661. Pierre P
    1662. Pierrefite-Carle V
    1663. Pietrocola F
    1664. Pimentel-Muiños FX
    1665. Pinar M
    1666. Pineda B
    1667. Pinkas-Kramarski R
    1668. Pinti M
    1669. Pinton P
    1670. Piperdi B
    1671. Piret JM
    1672. Platanias LC
    1673. Platta HW
    1674. Plowey ED
    1675. Pöggeler S
    1676. Poirot M
    1677. Polčic P
    1678. Poletti A
    1679. Poon AH
    1680. Popelka H
    1681. Popova B
    1682. Poprawa I
    1683. Poulose SM
    1684. Poulton J
    1685. Powers SK
    1686. Powers T
    1687. Pozuelo-Rubio M
    1688. Prak K
    1689. Prange R
    1690. Prescott M
    1691. Priault M
    1692. Prince S
    1693. Proia RL
    1694. Proikas-Cezanne T
    1695. Prokisch H
    1696. Promponas VJ
    1697. Przyklenk K
    1698. Puertollano R
    1699. Pugazhenthi S
    1700. Puglielli L
    1701. Pujol A
    1702. Puyal J
    1703. Pyeon D
    1704. Qi X
    1705. Qian WB
    1706. Qin ZH
    1707. Qiu Y
    1708. Qu Z
    1709. Quadrilatero J
    1710. Quinn F
    1711. Raben N
    1712. Rabinowich H
    1713. Radogna F
    1714. Ragusa MJ
    1715. Rahmani M
    1716. Raina K
    1717. Ramanadham S
    1718. Ramesh R
    1719. Rami A
    1720. Randall-Demllo S
    1721. Randow F
    1722. Rao H
    1723. Rao VA
    1724. Rasmussen BB
    1725. Rasse TM
    1726. Ratovitski EA
    1727. Rautou PE
    1728. Ray SK
    1729. Razani B
    1730. Reed BH
    1731. Reggiori F
    1732. Rehm M
    1733. Reichert AS
    1734. Rein T
    1735. Reiner DJ
    1736. Reits E
    1737. Ren J
    1738. Ren X
    1739. Renna M
    1740. Reusch JE
    1741. Revuelta JL
    1742. Reyes L
    1743. Rezaie AR
    1744. Richards RI
    1745. Richardson DR
    1746. Richetta C
    1747. Riehle MA
    1748. Rihn BH
    1749. Rikihisa Y
    1750. Riley BE
    1751. Rimbach G
    1752. Rippo MR
    1753. Ritis K
    1754. Rizzi F
    1755. Rizzo E
    1756. Roach PJ
    1757. Robbins J
    1758. Roberge M
    1759. Roca G
    1760. Roccheri MC
    1761. Rocha S
    1762. Rodrigues CM
    1763. Rodríguez CI
    1764. de Cordoba SR
    1765. Rodriguez-Muela N
    1766. Roelofs J
    1767. Rogov VV
    1768. Rohn TT
    1769. Rohrer B
    1770. Romanelli D
    1771. Romani L
    1772. Romano PS
    1773. Roncero MI
    1774. Rosa JL
    1775. Rosello A
    1776. Rosen KV
    1777. Rosenstiel P
    1778. Rost-Roszkowska M
    1779. Roth KA
    1780. Roué G
    1781. Rouis M
    1782. Rouschop KM
    1783. Ruan DT
    1784. Ruano D
    1785. Rubinsztein DC
    1786. Rucker EB
    1787. Rudich A
    1788. Rudolf E
    1789. Rudolf R
    1790. Ruegg MA
    1791. Ruiz-Roldan C
    1792. Ruparelia AA
    1793. Rusmini P
    1794. Russ DW
    1795. Russo GL
    1796. Russo G
    1797. Russo R
    1798. Rusten TE
    1799. Ryabovol V
    1800. Ryan KM
    1801. Ryter SW
    1802. Sabatini DM
    1803. Sacher M
    1804. Sachse C
    1805. Sack MN
    1806. Sadoshima J
    1807. Saftig P
    1808. Sagi-Eisenberg R
    1809. Sahni S
    1810. Saikumar P
    1811. Saito T
    1812. Saitoh T
    1813. Sakakura K
    1814. Sakoh-Nakatogawa M
    1815. Sakuraba Y
    1816. Salazar-Roa M
    1817. Salomoni P
    1818. Saluja AK
    1819. Salvaterra PM
    1820. Salvioli R
    1821. Samali A
    1822. Sanchez AM
    1823. Sánchez-Alcázar JA
    1824. Sanchez-Prieto R
    1825. Sandri M
    1826. Sanjuan MA
    1827. Santaguida S
    1828. Santambrogio L
    1829. Santoni G
    1830. Dos Santos CN
    1831. Saran S
    1832. Sardiello M
    1833. Sargent G
    1834. Sarkar P
    1835. Sarkar S
    1836. Sarrias MR
    1837. Sarwal MM
    1838. Sasakawa C
    1839. Sasaki M
    1840. Sass M
    1841. Sato K
    1842. Sato M
    1843. Satriano J
    1844. Savaraj N
    1845. Saveljeva S
    1846. Schaefer L
    1847. Schaible UE
    1848. Scharl M
    1849. Schatzl HM
    1850. Schekman R
    1851. Scheper W
    1852. Schiavi A
    1853. Schipper HM
    1854. Schmeisser H
    1855. Schmidt J
    1856. Schmitz I
    1857. Schneider BE
    1858. Schneider EM
    1859. Schneider JL
    1860. Schon EA
    1861. Schönenberger MJ
    1862. Schönthal AH
    1863. Schorderet DF
    1864. Schröder B
    1865. Schuck S
    1866. Schulze RJ
    1867. Schwarten M
    1868. Schwarz TL
    1869. Sciarretta S
    1870. Scotto K
    1871. Scovassi AI
    1872. Screaton RA
    1873. Screen M
    1874. Seca H
    1875. Sedej S
    1876. Segatori L
    1877. Segev N
    1878. Seglen PO
    1879. Seguí-Simarro JM
    1880. Segura-Aguilar J
    1881. Seki E
    1882. Sell C
    1883. Seiliez I
    1884. Semenkovich CF
    1885. Semenza GL
    1886. Sen U
    1887. Serra AL
    1888. Serrano-Puebla A
    1889. Sesaki H
    1890. Setoguchi T
    1891. Settembre C
    1892. Shacka JJ
    1893. Shajahan-Haq AN
    1894. Shapiro IM
    1895. Sharma S
    1896. She H
    1897. Shen CK
    1898. Shen CC
    1899. Shen HM
    1900. Shen S
    1901. Shen W
    1902. Sheng R
    1903. Sheng X
    1904. Sheng ZH
    1905. Shepherd TG
    1906. Shi J
    1907. Shi Q
    1908. Shi Q
    1909. Shi Y
    1910. Shibutani S
    1911. Shibuya K
    1912. Shidoji Y
    1913. Shieh JJ
    1914. Shih CM
    1915. Shimada Y
    1916. Shimizu S
    1917. Shin DW
    1918. Shinohara ML
    1919. Shintani M
    1920. Shintani T
    1921. Shioi T
    1922. Shirabe K
    1923. Shiri-Sverdlov R
    1924. Shirihai O
    1925. Shore GC
    1926. Shu CW
    1927. Shukla D
    1928. Sibirny AA
    1929. Sica V
    1930. Sigurdson CJ
    1931. Sigurdsson EM
    1932. Sijwali PS
    1933. Sikorska B
    1934. Silveira WA
    1935. Silvente-Poirot S
    1936. Silverman GA
    1937. Simak J
    1938. Simmet T
    1939. Simon AK
    1940. Simon HU
    1941. Simone C
    1942. Simons M
    1943. Simonsen A
    1944. Singh R
    1945. Singh SV
    1946. Singh SK
    1947. Sinha D
    1948. Sinha S
    1949. Sinicrope FA
    1950. Sirko A
    1951. Sirohi K
    1952. Sishi BJ
    1953. Sittler A
    1954. Siu PM
    1955. Sivridis E
    1956. Skwarska A
    1957. Slack R
    1958. Slaninová I
    1959. Slavov N
    1960. Smaili SS
    1961. Smalley KS
    1962. Smith DR
    1963. Soenen SJ
    1964. Soleimanpour SA
    1965. Solhaug A
    1966. Somasundaram K
    1967. Son JH
    1968. Sonawane A
    1969. Song C
    1970. Song F
    1971. Song HK
    1972. Song JX
    1973. Song W
    1974. Soo KY
    1975. Sood AK
    1976. Soong TW
    1977. Soontornniyomkij V
    1978. Sorice M
    1979. Sotgia F
    1980. Soto-Pantoja DR
    1981. Sotthibundhu A
    1982. Sousa MJ
    1983. Spaink HP
    1984. Span PN
    1985. Spang A
    1986. Sparks JD
    1987. Speck PG
    1988. Spector SA
    1989. Spies CD
    1990. Springer W
    1991. Clair DS
    1992. Stacchiotti A
    1993. Staels B
    1994. Stang MT
    1995. Starczynowski DT
    1996. Starokadomskyy P
    1997. Steegborn C
    1998. Steele JW
    1999. Stefanis L
    2000. Steffan J
    2001. Stellrecht CM
    2002. Stenmark H
    2003. Stepkowski TM
    2004. Stern ST
    2005. Stevens C
    2006. Stockwell BR
    2007. Stoka V
    2008. Storchova Z
    2009. Stork B
    2010. Stratoulias V
    2011. Stravopodis DJ
    2012. Strnad P
    2013. Strohecker AM
    2014. Ström AL
    2015. Stromhaug P
    2016. Stulik J
    2017. Su YX
    2018. Su Z
    2019. Subauste CS
    2020. Subramaniam S
    2021. Sue CM
    2022. Suh SW
    2023. Sui X
    2024. Sukseree S
    2025. Sulzer D
    2026. Sun FL
    2027. Sun J
    2028. Sun J
    2029. Sun SY
    2030. Sun Y
    2031. Sun Y
    2032. Sun Y
    2033. Sundaramoorthy V
    2034. Sung J
    2035. Suzuki H
    2036. Suzuki K
    2037. Suzuki N
    2038. Suzuki T
    2039. Suzuki YJ
    2040. Swanson MS
    2041. Swanton C
    2042. Swärd K
    2043. Swarup G
    2044. Sweeney ST
    2045. Sylvester PW
    2046. Szatmari Z
    2047. Szegezdi E
    2048. Szlosarek PW
    2049. Taegtmeyer H
    2050. Tafani M
    2051. Taillebourg E
    2052. Tait SW
    2053. Takacs-Vellai K
    2054. Takahashi Y
    2055. Takáts S
    2056. Takemura G
    2057. Takigawa N
    2058. Talbot NJ
    2059. Tamagno E
    2060. Tamburini J
    2061. Tan CP
    2062. Tan L
    2063. Tan ML
    2064. Tan M
    2065. Tan YJ
    2066. Tanaka K
    2067. Tanaka M
    2068. Tang D
    2069. Tang D
    2070. Tang G
    2071. Tanida I
    2072. Tanji K
    2073. Tannous BA
    2074. Tapia JA
    2075. Tasset-Cuevas I
    2076. Tatar M
    2077. Tavassoly I
    2078. Tavernarakis N
    2079. Taylor A
    2080. Taylor GS
    2081. Taylor GA
    2082. Taylor JP
    2083. Taylor MJ
    2084. Tchetina EV
    2085. Tee AR
    2086. Teixeira-Clerc F
    2087. Telang S
    2088. Tencomnao T
    2089. Teng BB
    2090. Teng RJ
    2091. Terro F
    2092. Tettamanti G
    2093. Theiss AL
    2094. Theron AE
    2095. Thomas KJ
    2096. Thomé MP
    2097. Thomes PG
    2098. Thorburn A
    2099. Thorner J
    2100. Thum T
    2101. Thumm M
    2102. Thurston TL
    2103. Tian L
    2104. Till A
    2105. Ting JP
    2106. Titorenko VI
    2107. Toker L
    2108. Toldo S
    2109. Tooze SA
    2110. Topisirovic I
    2111. Torgersen ML
    2112. Torosantucci L
    2113. Torriglia A
    2114. Torrisi MR
    2115. Tournier C
    2116. Towns R
    2117. Trajkovic V
    2118. Travassos LH
    2119. Triola G
    2120. Tripathi DN
    2121. Trisciuoglio D
    2122. Troncoso R
    2123. Trougakos IP
    2124. Truttmann AC
    2125. Tsai KJ
    2126. Tschan MP
    2127. Tseng YH
    2128. Tsukuba T
    2129. Tsung A
    2130. Tsvetkov AS
    2131. Tu S
    2132. Tuan HY
    2133. Tucci M
    2134. Tumbarello DA
    2135. Turk B
    2136. Turk V
    2137. Turner RF
    2138. Tveita AA
    2139. Tyagi SC
    2140. Ubukata M
    2141. Uchiyama Y
    2142. Udelnow A
    2143. Ueno T
    2144. Umekawa M
    2145. Umemiya-Shirafuji R
    2146. Underwood BR
    2147. Ungermann C
    2148. Ureshino RP
    2149. Ushioda R
    2150. Uversky VN
    2151. Uzcátegui NL
    2152. Vaccari T
    2153. Vaccaro MI
    2154. Váchová L
    2155. Vakifahmetoglu-Norberg H
    2156. Valdor R
    2157. Valente EM
    2158. Vallette F
    2159. Valverde AM
    2160. Van den Berghe G
    2161. Van Den Bosch L
    2162. van den Brink GR
    2163. van der Goot FG
    2164. van der Klei IJ
    2165. van der Laan LJ
    2166. van Doorn WG
    2167. van Egmond M
    2168. van Golen KL
    2169. Van Kaer L
    2170. van Lookeren Campagne M
    2171. Vandenabeele P
    2172. Vandenberghe W
    2173. Vanhorebeek I
    2174. Varela-Nieto I
    2175. Vasconcelos MH
    2176. Vasko R
    2177. Vavvas DG
    2178. Vega-Naredo I
    2179. Velasco G
    2180. Velentzas AD
    2181. Velentzas PD
    2182. Vellai T
    2183. Vellenga E
    2184. Vendelbo MH
    2185. Venkatachalam K
    2186. Ventura N
    2187. Ventura S
    2188. Veras PS
    2189. Verdier M
    2190. Vertessy BG
    2191. Viale A
    2192. Vidal M
    2193. Vieira HL
    2194. Vierstra RD
    2195. Vigneswaran N
    2196. Vij N
    2197. Vila M
    2198. Villar M
    2199. Villar VH
    2200. Villarroya J
    2201. Vindis C
    2202. Viola G
    2203. Viscomi MT
    2204. Vitale G
    2205. Vogl DT
    2206. Voitsekhovskaja OV
    2207. von Haefen C
    2208. von Schwarzenberg K
    2209. Voth DE
    2210. Vouret-Craviari V
    2211. Vuori K
    2212. Vyas JM
    2213. Waeber C
    2214. Walker CL
    2215. Walker MJ
    2216. Walter J
    2217. Wan L
    2218. Wan X
    2219. Wang B
    2220. Wang C
    2221. Wang CY
    2222. Wang C
    2223. Wang C
    2224. Wang C
    2225. Wang D
    2226. Wang F
    2227. Wang F
    2228. Wang G
    2229. Wang HJ
    2230. Wang H
    2231. Wang HG
    2232. Wang H
    2233. Wang HD
    2234. Wang J
    2235. Wang J
    2236. Wang M
    2237. Wang MQ
    2238. Wang PY
    2239. Wang P
    2240. Wang RC
    2241. Wang S
    2242. Wang TF
    2243. Wang X
    2244. Wang XJ
    2245. Wang XW
    2246. Wang X
    2247. Wang X
    2248. Wang Y
    2249. Wang Y
    2250. Wang Y
    2251. Wang YJ
    2252. Wang Y
    2253. Wang Y
    2254. Wang YT
    2255. Wang Y
    2256. Wang ZN
    2257. Wappner P
    2258. Ward C
    2259. Ward DM
    2260. Warnes G
    2261. Watada H
    2262. Watanabe Y
    2263. Watase K
    2264. Weaver TE
    2265. Weekes CD
    2266. Wei J
    2267. Weide T
    2268. Weihl CC
    2269. Weindl G
    2270. Weis SN
    2271. Wen L
    2272. Wen X
    2273. Wen Y
    2274. Westermann B
    2275. Weyand CM
    2276. White AR
    2277. White E
    2278. Whitton JL
    2279. Whitworth AJ
    2280. Wiels J
    2281. Wild F
    2282. Wildenberg ME
    2283. Wileman T
    2284. Wilkinson DS
    2285. Wilkinson S
    2286. Willbold D
    2287. Williams C
    2288. Williams K
    2289. Williamson PR
    2290. Winklhofer KF
    2291. Witkin SS
    2292. Wohlgemuth SE
    2293. Wollert T
    2294. Wolvetang EJ
    2295. Wong E
    2296. Wong GW
    2297. Wong RW
    2298. Wong VK
    2299. Woodcock EA
    2300. Wright KL
    2301. Wu C
    2302. Wu D
    2303. Wu GS
    2304. Wu J
    2305. Wu J
    2306. Wu M
    2307. Wu M
    2308. Wu S
    2309. Wu WK
    2310. Wu Y
    2311. Wu Z
    2312. Xavier CP
    2313. Xavier RJ
    2314. Xia GX
    2315. Xia T
    2316. Xia W
    2317. Xia Y
    2318. Xiao H
    2319. Xiao J
    2320. Xiao S
    2321. Xiao W
    2322. Xie CM
    2323. Xie Z
    2324. Xie Z
    2325. Xilouri M
    2326. Xiong Y
    2327. Xu C
    2328. Xu C
    2329. Xu F
    2330. Xu H
    2331. Xu H
    2332. Xu J
    2333. Xu J
    2334. Xu J
    2335. Xu L
    2336. Xu X
    2337. Xu Y
    2338. Xu Y
    2339. Xu ZX
    2340. Xu Z
    2341. Xue Y
    2342. Yamada T
    2343. Yamamoto A
    2344. Yamanaka K
    2345. Yamashina S
    2346. Yamashiro S
    2347. Yan B
    2348. Yan B
    2349. Yan X
    2350. Yan Z
    2351. Yanagi Y
    2352. Yang DS
    2353. Yang JM
    2354. Yang L
    2355. Yang M
    2356. Yang PM
    2357. Yang P
    2358. Yang Q
    2359. Yang W
    2360. Yang WY
    2361. Yang X
    2362. Yang Y
    2363. Yang Y
    2364. Yang Z
    2365. Yang Z
    2366. Yao MC
    2367. Yao PJ
    2368. Yao X
    2369. Yao Z
    2370. Yao Z
    2371. Yasui LS
    2372. Ye M
    2373. Yedvobnick B
    2374. Yeganeh B
    2375. Yeh ES
    2376. Yeyati PL
    2377. Yi F
    2378. Yi L
    2379. Yin XM
    2380. Yip CK
    2381. Yoo YM
    2382. Yoo YH
    2383. Yoon SY
    2384. Yoshida K
    2385. Yoshimori T
    2386. Young KH
    2387. Yu H
    2388. Yu JJ
    2389. Yu JT
    2390. Yu J
    2391. Yu L
    2392. Yu WH
    2393. Yu XF
    2394. Yu Z
    2395. Yuan J
    2396. Yuan ZM
    2397. Yue BY
    2398. Yue J
    2399. Yue Z
    2400. Zacks DN
    2401. Zacksenhaus E
    2402. Zaffaroni N
    2403. Zaglia T
    2404. Zakeri Z
    2405. Zecchini V
    2406. Zeng J
    2407. Zeng M
    2408. Zeng Q
    2409. Zervos AS
    2410. Zhang DD
    2411. Zhang F
    2412. Zhang G
    2413. Zhang GC
    2414. Zhang H
    2415. Zhang H
    2416. Zhang H
    2417. Zhang H
    2418. Zhang J
    2419. Zhang J
    2420. Zhang J
    2421. Zhang J
    2422. Zhang JP
    2423. Zhang L
    2424. Zhang L
    2425. Zhang L
    2426. Zhang L
    2427. Zhang MY
    2428. Zhang X
    2429. Zhang XD
    2430. Zhang Y
    2431. Zhang Y
    2432. Zhang Y
    2433. Zhang Y
    2434. Zhang Y
    2435. Zhao M
    2436. Zhao WL
    2437. Zhao X
    2438. Zhao YG
    2439. Zhao Y
    2440. Zhao Y
    2441. Zhao YX
    2442. Zhao Z
    2443. Zhao ZJ
    2444. Zheng D
    2445. Zheng XL
    2446. Zheng X
    2447. Zhivotovsky B
    2448. Zhong Q
    2449. Zhou GZ
    2450. Zhou G
    2451. Zhou H
    2452. Zhou SF
    2453. Zhou XJ
    2454. Zhu H
    2455. Zhu H
    2456. Zhu WG
    2457. Zhu W
    2458. Zhu XF
    2459. Zhu Y
    2460. Zhuang SM
    2461. Zhuang X
    2462. Ziparo E
    2463. Zois CE
    2464. Zoladek T
    2465. Zong WX
    2466. Zorzano A
    2467. Zughaier SM
    (2016) Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition)
    Autophagy 12:1–222.
    https://doi.org/10.1080/15548627.2015.1100356

Article and author information

Author details

  1. Kathleen M Cunningham

    Cellular and Molecular Medicine Program, School of Medicine, Johns Hopkins University, Baltimore, United States
    Contribution
    Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-1347-9087
  2. Kirstin Maulding

    Cellular and Molecular Medicine Program, School of Medicine, Johns Hopkins University, Baltimore, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2012-9747
  3. Kai Ruan

    Department of Neurology, School of Medicine, Johns Hopkins University, Baltimore, United States
    Contribution
    Formal analysis, Investigation, Visualization, Writing - review and editing
    Competing interests
    No competing interests declared
  4. Mumine Senturk

    Program in Developmental Biology, Baylor College of Medicine (BCM), Houston, United States
    Contribution
    Conceptualization, Investigation, Visualization
    Competing interests
    No competing interests declared
  5. Jonathan C Grima

    1. Brain Science Institute, School of Medicine, Johns Hopkins University, Baltimore, United States
    2. Solomon H. Snyder Department of Neuroscience, School of Medicine, Johns Hopkins University, Baltimore, United States
    Contribution
    Resources, Methodology
    Competing interests
    No competing interests declared
  6. Hyun Sung

    Department of Neurology, School of Medicine, Johns Hopkins University, Baltimore, United States
    Contribution
    Investigation, Visualization
    Competing interests
    No competing interests declared
  7. Zhongyuan Zuo

    Department of Molecular and Human Genetics, BCM, Houston, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  8. Helen Song

    Department of Neurology, School of Medicine, Johns Hopkins University, Baltimore, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  9. Junli Gao

    Department of Neuroscience, Mayo Clinic, Jacksonville, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  10. Sandeep Dubey

    Department of Neurology, School of Medicine, Johns Hopkins University, Baltimore, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  11. Jeffrey D Rothstein

    1. Cellular and Molecular Medicine Program, School of Medicine, Johns Hopkins University, Baltimore, United States
    2. Department of Neurology, School of Medicine, Johns Hopkins University, Baltimore, United States
    3. Brain Science Institute, School of Medicine, Johns Hopkins University, Baltimore, United States
    4. Solomon H. Snyder Department of Neuroscience, School of Medicine, Johns Hopkins University, Baltimore, United States
    Contribution
    Supervision
    Competing interests
    No competing interests declared
  12. Ke Zhang

    Department of Neuroscience, Mayo Clinic, Jacksonville, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Investigation, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4794-8355
  13. Hugo J Bellen

    1. Program in Developmental Biology, Baylor College of Medicine (BCM), Houston, United States
    2. Department of Molecular and Human Genetics, BCM, Houston, United States
    3. Department of Neuroscience, BCM, Houston, United States
    4. Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital, Houston, United States
    5. Howard Hughes Medical Institute, Houston, United States
    Contribution
    Conceptualization, Resources, Supervision, Investigation, Methodology, Writing - review and editing
    Competing interests
    Reviewing editor, eLife
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-5992-5989
  14. Thomas E Lloyd

    1. Cellular and Molecular Medicine Program, School of Medicine, Johns Hopkins University, Baltimore, United States
    2. Department of Neurology, School of Medicine, Johns Hopkins University, Baltimore, United States
    3. Solomon H. Snyder Department of Neuroscience, School of Medicine, Johns Hopkins University, Baltimore, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    tlloyd4@jhmi.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4756-3700

Funding

National Institute of Neurological Disorders and Stroke (R01NS082563)

  • Thomas E Lloyd

Amyotrophic Lateral Sclerosis Association (17-IIP-370)

  • Thomas E Lloyd

National Institutes of Health (P40OD018537)

  • Hugo J Bellen

Howard Hughes Medical Institute

  • Hugo J Bellen

National Institute of Neurological Disorders and Stroke (R01NS094239)

  • Jeffrey D Rothstein
  • Thomas E Lloyd

National Institute of Neurological Disorders and Stroke (P30NS050274)

  • Thomas E Lloyd

National Institute of Neurological Disorders and Stroke (F31NS100401)

  • Kathleen M Cunningham

ALSA

  • Jeffrey D Rothstein
  • Ke Zhang
  • Thomas E Lloyd

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

This work was supported by NINDS R01NS082563 (TEL), R01NS094239 (TEL and JDR), F31 NS100401 (KMC), ALSA (TEL, KZ and JDR), and Target ALS (TEL, KZ, JDR, and HJB). KMC is a recipient of the PEO Scholar Award. HJB is an Investigator of the Howard Hughes Medical Institute. We thank Francesca Pignoni, Udai Pandey, Peng Jin, Adrian Isaacs, Eric Baehrecke, Helmut Kramer, Francesca Pignoni, Gábor Juhász, Patrick Dolph, L Miguel Martins, the Bloomington Drosophila Stock Center (NIH P40ODO18537) and Vienna Drosophila Research Center for Drosophila lines and/or antibodies and Shawn Ferguson and Davide Trotti for cell lines and constructs. The Johns Hopkins NINDS Multiphoton Imaging Core (NS050274) provided imaging equipment and expertise.

Ethics

Human subjects: The use of human tissue and associated decedents' demographic information was approved by the Johns Hopkins University Institutional Review Board and ethics committee (HIPAA Form 5 exemption, Application 11-02-10-01RD) and from the Ravitz Laboratory (UCSD) through the Target ALS Consortium.

Copyright

© 2020, Cunningham et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 5,205
    views
  • 709
    downloads
  • 62
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Citations by DOI

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Kathleen M Cunningham
  2. Kirstin Maulding
  3. Kai Ruan
  4. Mumine Senturk
  5. Jonathan C Grima
  6. Hyun Sung
  7. Zhongyuan Zuo
  8. Helen Song
  9. Junli Gao
  10. Sandeep Dubey
  11. Jeffrey D Rothstein
  12. Ke Zhang
  13. Hugo J Bellen
  14. Thomas E Lloyd
(2020)
TFEB/Mitf links impaired nuclear import to autophagolysosomal dysfunction in C9-ALS
eLife 9:e59419.
https://doi.org/10.7554/eLife.59419

Share this article

https://doi.org/10.7554/eLife.59419