An ABA-GA bistable switch can account for natural variation in the variability of Arabidopsis seed germination time
- The Sainsbury Laboratory, University of Cambridge, United Kingdom
Figures
Figure 1 with 1 supplement
There is variation in variability in germination times in Arabidopsis.
(A) Examples of distributions of germination time for natural accessions and MAGIC lines. Each row shows the germination time distribution of a seed batch from a different parent plant of a …
-
Figure 1—source data 1
Figure 1_A_ExampleGermDistributions.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig1-data1-v1.tds
-
Figure 1—source data 2
Figure 1_B_MAGICsAccessionsTraitSummaries.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig1-data2-v1.tds
-
Figure 1—source data 3
Figure 1_C_MAGICExperimentComparison.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig1-data3-v1.tds
Figure 1—figure supplement 1
Reproducibility of germination time distributions.
(A, B) Coefficient of variations (CVs) of germination time for MAGIC parental accession seeds stored in dry conditions for different lengths of time following harvest (x and y axes labels indicate …
-
Figure 1—figure supplement 1—source data 1
Figure1_figure supplement 1_A_B_MagicParentsCVvsDAR.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig1-figsupp1-data1-v1.tds
-
Figure 1—figure supplement 1—source data 2
Figure1_figure supplement 1_CtoF_HighVarLinesReproducibility.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig1-figsupp1-data2-v1.tds
-
Figure 1—figure supplement 1—source data 3
Figure1_figure supplement 1_G_SoilvsPlates.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig1-figsupp1-data3-v1.tds
Figure 2 with 1 supplement
The full range of germination times can be found in individual siliques.
(A) Germination time distributions for a very high variability line, M178. Each row is the distribution obtained using a sample of pooled seeds from one plant, with different rows showing data from …
-
Figure 2—source data 1
Figure2_A_M178WholePlant.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig2-data1-v1.tds
-
Figure 2—source data 2
Figure2_B_M178SingleSiliques.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig2-data2-v1.tds
-
Figure 2—source data 3
Figure2_C_M178HalfSiliques.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig2-data3-v1.tds
Figure 2—figure supplement 1
Germination time distributions for whole plants and single siliques for high variability lines.
Germination time distributions for M182 (A) and M53 (B) for samples of seeds pooled from whole plants and for single siliques separated into top and bottom halves. Seeds from whole plants and half …
-
Figure 2—figure supplement 1—source data 1
Figure2_figure supplement 1_AtoC_WholePlant.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig2-figsupp1-data1-v1.tds
-
Figure 2—figure supplement 1—source data 2
Figure2_figure supplement 1_A_B_M182_M53_halfSiliques.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig2-figsupp1-data2-v1.tds
-
Figure 2—figure supplement 1—source data 3
Figure2_figure supplement 1_C_M4_singleSilique.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig2-figsupp1-data3-v1.tds
-
Figure 2—figure supplement 1—source data 4
Figure2_figure supplement 1_D_TopBottomSiliqueComparison.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig2-figsupp1-data4-v1.tds
Figure 3 with 2 supplements
Variability is weakly coupled to modal germination time.
(A) Scatter plots of coefficient of variation (CV) of germination time versus mode days to germination for 341 MAGIC lines. Each point is a specific MAGIC line, and in the majority of cases, the CV …
-
Figure 3—source data 1
Figure3_AllMAGICsTraitSummaries.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig3-data1-v1.tds
-
Figure 3—source data 2
Figure3_MAGICIndividualLinesGermPerDay.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig3-data2-v1.tds
Figure 3—figure supplement 1
Variability is weakly coupled to percentage germination.
(A) Scatter plots of coefficient of variation (CV) of germination time versus percentage germination for 341 MAGIC lines. Each point is a specific MAGIC line, and in the majority of cases, the CV …
Figure 3—figure supplement 2
The relationship between coefficient of variation (CV), mode days to germination and percentage germination in natural accessions.
(A) Scatter plot of CV of germination time versus mode days to germination for the 19 parental accessions of the MAGIC lines and 10 Spanish accessions. Each point is a specific accession, and the CV …
-
Figure 3—figure supplement 2—source data 1
Figure3_figure supplement 2_A_B_AccessionsTraitSummaries.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig3-figsupp2-data1-v1.tds
-
Figure 3—figure supplement 2—source data 2
Figure3_figure supplement 2_C_AccessionsCt_Mad_GermPerDay.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig3-figsupp2-data2-v1.tds
Figure 4 with 5 supplements
Quantitative trait locus (QTL) and bulk segregant mapping reveals two QTL underlying coefficient of variation (CV) of germination time.
(A, B) Manhattan plots showing the QTL association results for each single nucleotide polymorphism (SNP) marker individually (black line) and for each marker when the Chr3 QTL SNP marker was added …
Figure 4—figure supplement 1
Quantitative trait locus mapping for germination traits, with and without bimodal MAGIC lines.
(A) is for all 341 MAGIC lines that were phenotyped, and (B) is for 333 of these lines (the full set minus the eight bimodal lines with very high coefficient of variation [CV]). The y-axis shows the …
Figure 4—figure supplement 2
Accession-specific quantitative trait locus (QTL) effects on coefficient of variation (CV), mode and percentage germination.
(A) Predicted accession effects at the two putative QTL on Chr3 and Chr5 (Figure 4). The effects of the 19 parental accession haplotypes were estimated by calculating the mean CV of MAGIC lines …
Figure 4—figure supplement 3
Germination time distributions and DNA-seq pools of Col-0 × No-0 F2.
Eight batches of Col-0 × No-0 F2 seeds, each containing ~1100 seeds and collected from a different F1 parent plant, were sown on soil. Seeds from parental accessions Col-0 and No-0 were also …
-
Figure 4—figure supplement 3—source data 1
Figure4_FigureSupplement3_A_B_ColNoMappingF2_GermDistributions.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig4-figsupp3-data1-v1.tds
Figure 4—figure supplement 4
Germination phenotypes of F3 seeds from Col-0 × No-0 F2 parent plants that themselves germinated early or late.
Coefficient of variation (CV) (i), mean (ii), mode (iii) and percentage germination (iv) for F3 seed batches collected from F2 plants that themselves germinated at different times (x-axis). Batches …
-
Figure 4—figure supplement 4—source data 1
Figure4_FigureSupplement4_ColNoF3_GermDistributions.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig4-figsupp4-data1-v1.tds
Figure 4—figure supplement 5
Germination time distributions and abscisic acid (ABA) dose responses in quantitative trait locus candidate gene mutants.
(A, B) dog1-3 mutant in the Col-0 background, for seeds that were 5 days after harvest (DAH) (left panels) or 30 DAH (right panels). Histograms show germination time distributions for replicate seed …
-
Figure 4—figure supplement 5—source data 1
Figure4_FigureSupplement5_QTLcandidateMutantsGerm.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig4-figsupp5-data1-v1.tds
Figure 5 with 5 supplements
Model of the abscisic acid–gibberellic acid (ABA-GA) bistable switch and effect of ABA sensitivity parameter on germination traits.
(A) Model scheme of the ABA-GA network. Normal arrows represent effective promotion and blunt arrows represent effective inhibition. We represent the inhibitors of germination – DELLAs, ABI4 and …
Figure 5—figure supplement 1
Dynamics of the components of the abscisic acid–gibberellic acid (ABA-GA) model in monostable and bistable regimes.
Modelling results showing representative behaviour of the model when it is in the monostable (A–G) and two bistable scenarios (H–U) after the rise of GA production (referred to as monostable and …
Figure 5—figure supplement 2
Effect of model parameters on germination traits.
(A–D) show the effects on coefficient of variation (CV), mode and percentage germination of simulated germination time distributions as single parameter values are changed. Each panel shows the …
Figure 5—figure supplement 3
Simulated germination time distributions illustrating the effects of parameter value changes.
Histograms in (A), (B), (C) and (D) correspond to points in the plots in Figure 5—figure supplement 2 from (A), (B), (C) and (D), respectively. (A) Simulated germination time distributions for three …
Figure 5—figure supplement 4
Exploring the effects of model parameters on coefficient of variation (CV), mode and percentage germination.
Each panel shows a result from a 2D parameter exploration for a pair of parameters, such that each parameter is varied for a range of values of a second parameter. (A) Effect of abscisic acid (ABA) …
Figure 5—figure supplement 5
Coefficient of variation (CV), mode of germination times and percentage germination in bistable and monostable regions of the model after the rise in GA production.
Simulation results across the different 2D parameter explorations shown in Figure 5—figure supplement 4A—G. In panels (A)-(G), points represent simulation results for different combinations of …
Figure 6 with 4 supplements
Exogenous addition of abscisic acid (ABA) to high and low variability lines.
(A) Simulations of addition of increasing doses of exogenous ABA (x-axes), starting from a point in the parameter space that shows higher seed germination time variability (left) and lower …
-
Figure 6—source data 1
Figure6_ABAGAdosesGermSummaries.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig6-data1-v1.tds
Figure 6—figure supplement 1
Exogenous addition of gibberellic acid (GA) to high and low variability lines.
(A) Simulations of addition of increasing doses of exogenous GA (x-axes), starting from a point in the parameter space that shows higher seed germination time variability (left) and lower …
Figure 6—figure supplement 2
Simulated germination time distributions for a range of concentrations of exogenous abscisic acid (ABA) and gibberellic acid (GA).
Simulation results of adding increasing concentrations of exogenous ABA (A) or GA (B), showing germination time distributions and the coefficient of variation (CV), mode and percentage germination …
Figure 6—figure supplement 3
Results of nullcline analysis for abscisic acid (ABA) and gibberellic acid (GA) dose responses applied to the high variability parameter set.
Plots are for example cases from Figure 6 and Figure 6—figure supplement 1. (A) Examples of nullcline analyses for two doses of exogenous ABA. Left-hand panels (i and iii) show the cases at the …
Figure 6—figure supplement 4
Effects of abscisic acid (ABA) and gibberellic acid (GA) on germination time distributions for example high and low variability lines.
(A) Effect of increasing exogenous ABA concentration on the distribution of germination times for the high variability MAGIC line, M182 (left panels), and the low variability accession, Col-0 (right …
-
Figure 6—figure supplement 4—source data 1
Figure6_FigureSupplement4_ColM182_ABA_GA.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig6-figsupp4-data1-v1.tds
Figure 7
Mutants with altered levels of abscisic acid (ABA) and gibberellic acid (GA) have altered germination time variability.
Distributions of germination times for indicated genotypes. cyp707a1-1 and cyp707a1-1 cyp707a2-1 mutants lack enzymes involved in ABA catabolism, while ga3ox-3 and ga3ox1-3 ga3ox2-1 mutants lack …
-
Figure 7—source data 1
Figure7_MutantsGerm.
- https://cdn.elifesciences.org/articles/59485/elife-59485-fig7-data1-v1.tds
Author response image 1
Tables
Table 1
High and low variability lines used for abscisic acid (ABA) and gibberellic acid (GA) dose responses and their haplotypes at the Chr3 and Chr5 quantitative trait loci .
Haplotypes were classified according to their estimated effect on coefficient of variation (CV), as shown in Figure 4—figure supplement 2. Haplotype effect is classified as low/high when its average …
| Line | H/L variability | Chr3 haplotype | Chr3 haplotype effect on CV | Chr5 haplotype | Chr5 haplotype effect on CV | |
|---|---|---|---|---|---|---|
| 143 | High | Can | Medium | Zu | High | |
| 178 | High | Wu | High | Rsch | Medium | |
| 182 | High | Edi | Medium | Hi | Medium | |
| 285 | High | Ler | High | Zu | High | |
| 393 | High | Ler | High | Kn | High | |
| 53 | High | Sf | High | Rsch | Medium | |
| 108 | Low | Tsu | Low | Rsch | Medium | |
| 123 | Low | Bur | Medium | Wu | Medium | |
| 151 | Low | Bur | Medium | Wu | Medium | |
| 213 | Low | Wil | Low | Can | Medium | |
| 467 | Low | Wil | Low | Edi | Low | |
| Col-0 | Low | Col-0 | Low | Col-0 | Medium |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological samples (Arabidopsis thaliana) | MAGIC lines | NASC | NASC ID: N782242 | PMID:19593375 |
| Biological samples (Arabidopsis thaliana) | MAGIC parental accessions | NASC | IDs of individual parental accessions: http://arabidopsis.info/CollectionInfo?id=112 | PMID:19593375 |
| Biological samples (Arabidopsis thaliana) | Spanish accessions | NASC | PMID:26991665 | |
| Biological sample (Arabidopsis thaliana) | cyp707a1-1 | PMID:16543410 | Eiji Nambara, University of Toronto | |
| Biological sample (Arabidopsis thaliana) | cyp707a1-1 cyp707a2-1 | PMID:16543410 | Eiji Nambara, University of Toronto | |
| Biological sample (Arabidopsis thaliana) | ga3ox1-3 | NASC | NASC ID: N6943 | PMID:16460513 |
| Biological sample (Arabidopsis thaliana) | ga3ox1-3 ga3ox2-1 | NASC | NASC ID: N6944 | PMID:16460513 |
| Biological sample (Arabidopsis thaliana) | dog1-3 (Col-0) (SALK 000867) | NASC | NASC ID: N500867 | PMID:17065317 |
| Biological sample (Arabidopsis thaliana) | anac060 (SALK 012554C) | NASC | NASC ID: N665285 | PMID:24625790 |
| Biological sample (Arabidopsis thaliana) | ahg1-5 | PMID:28706187 | Guillaume Née, University of Münster | |
| Biological sample (Arabidopsis thaliana) | dog1 (No-0) (dog1 mutant in No-0 background) | RIKEN | BRC number: pst21966 Line number: 15-3980-1 | |
| Sequence-based reagent | DOG1N_F | This paper | PCR primers | GAAATCCGCTCCTTGTACCG See Supplementary file 4 |
| Sequence-based reagent | DOG1N_R | This paper | PCR primers | GCATCCCTGAGCTCAAACAA See Supplementary file 4 |
| Sequence-based reagent | Ds5-2a | PMID:14996221 | PCR primers | TCCGTTCCGTTTTCGTTTTTTAC See Supplementary file 4 |
| Sequence-based reagent | DOG1-3 F | This paper | PCR primers | TTCCAGGAACGTTGTCGTATC See Supplementary file 4 |
| Sequence-based reagent | DOG1-3 R | This paper | PCR primers | AGTTTGTGACCCACACAAAGC See Supplementary file 4 |
| Sequence-based reagent | LBb1.3 | http://signal.salk.edu/tdnaprimers.2.html | PCR primers | ATTTTGCCGATTTCGAAC See Supplementary file 4 |
| Sequence-based reagent | ANAC060 F | This paper | PCR primers | TGGACTCTGTTTGAAGCCTTG See Supplementary file 4 |
| Sequence-based reagent | ANAC060 R | This paper | PCR primers | TATGCCTGTCCTGATTTGCTC See Supplementary file 4 |
| Sequence-based reagent | AHG1 LP | PMID:28706187 | PCR primers | ACCGACACGTGTTCTGTCTTC See Supplementary file 4 |
| Sequence-based reagent | AHG1 RP | PMID:28706187 | PCR primers | CTAAAACTCGACCACCAGCTG See Supplementary file 4 |
| Chemical compound, drug | Gibberellin A4 | Sigma Aldrich | G7276 | |
| Chemical compound, drug | Abscisic acid | Sigma Aldrich | A1049 | |
| Commercial assay, kit | NEB Next Ultra DNA Library Prep Kit | New England BioLabs | E7370L | |
| Software, algorithm | Organism | PMID:15961462 | https://gitlab.com/slcu/teamHJ/Organism | |
| Software, algorithm | R | R Foundation for Statistical Computing | https://www.R-project.org/ | |
| Software, algorithm | Python | Python Software Foundation | Version: Python 2.7 https://www.python.org/download/releases/2.7/ | |
| Software, algorithm | Data analysis and modelling scripts | This paper | https://gitlab.com/slcu/teamJL/abley_formosa_etal_2020 ; Abley et al., 2021 copy archived at swh:1:rev:0a97b841e58b128c174d93fc759b28f1df2966a2 |
Table 2
Default values for each parameter in our mathematical model and varying parameters used in figures showing 1D parameter scans.
βX: production rate for X; vX: degradation rate for X; θX,Y: threshold above which Y has an effect on X; CX,Y: coefficient for regulatory functions of Y acting on X; h: exponent of regulatory …
| Default | Figure 5B–D | Figure 5—figure supplement 2A | Figure 5—figure supplement 2B | Figure 5—figure supplement 2C | Figure 5—figure supplement 2D | |
|---|---|---|---|---|---|---|
| βABA | 1 | Varying | ||||
| βGA | 0.3 | |||||
| βGA,Z | 0.01 | |||||
| βZ | 39 | |||||
| βI | 0.3 | |||||
| vABA | 1 | 1.58 | ||||
| vGA | 1 | |||||
| vZ | 0.1 | |||||
| vI | 0.4 | |||||
| θABA,I | 3.7 | |||||
| θGA,I | 1.2 | |||||
| θI,ABA | 6.5 | Varying | 10 | 10 | ||
| θI,GA | 6 | Varying | Varying | |||
| CABA,I | 10 | |||||
| CGA,I | 4 | |||||
| CI,ABA | 10 | |||||
| CI,GA | 6 | |||||
| h | 4 | |||||
| V | 30 | 100 | Varying |
Additional files
-
Supplementary file 1
Supplementary_File1_MAGICs.
- https://cdn.elifesciences.org/articles/59485/elife-59485-supp1-v1.csv
-
Supplementary file 2
Supplementary_File2_MAGICParents.
- https://cdn.elifesciences.org/articles/59485/elife-59485-supp2-v1.csv
-
Supplementary file 3
Supplementary_File3_SpanishAccessions.
- https://cdn.elifesciences.org/articles/59485/elife-59485-supp3-v1.csv
-
Supplementary file 4
Genotyping primers.
- https://cdn.elifesciences.org/articles/59485/elife-59485-supp4-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/59485/elife-59485-transrepform-v1.docx
