Systematic functional analysis of rab GTPases reveals limits of neuronal robustness to environmental challenges in flies

  1. Friederike E Kohrs
  2. Ilsa-Maria Daumann
  3. Bojana Pavlovic
  4. Eugene Jennifer Jin
  5. F Ridvan Kiral
  6. Shih-Ching Lin
  7. Filip Port
  8. Heike Wolfenberg
  9. Thomas F Mathejczyk
  10. Gerit A Linneweber
  11. Chih-Chiang Chan
  12. Michael Boutros
  13. P Robin Hiesinger  Is a corresponding author
  1. Division of Neurobiology, Institute for Biology, Freie Universität Berlin, Germany
  2. German Cancer Research Center (DKFZ), Division of Signaling and Functional Genomics and Heidelberg University, Germany
  3. National Taiwan University, Taiwan
7 figures, 2 tables and 5 additional files

Figures

Figure 1 with 3 supplements
Generation and viability analysis of the rab null mutant collection.

(A) List of all 26 Drosophila rab null mutants, sorted by expression pattern from 'nervous system-enriched' to ubiquitous based on Chan et al., 2011; Jin et al., 2012. Two-thirds of the rab mutants …

Figure 1—figure supplement 1
Design of newly generated rab mutants.

(A and C) Schematic depiction of the inserted knock-in cassettes. For ends-out homologous recombination a Gal4-3xP3-RFP-Kanamycin cassette, with loxP-sites flanking the 3xP3-RFP-Kan region, was …

Figure 1—figure supplement 2
Pupal expression patterns of nervous system-enriched Rabs based on endogenously tagged Rabs generated by Dunst et al., 2015.

(A) Schematic of the main optic neuropils and retina of the developing pupal brain. (B) Expression pattern of EYFP-tagged Rabs (green) in ~P+40% pupal brains. Immunolabeling of pupal photoreceptor …

Figure 1—figure supplement 3
Adult expression patterns of nervous system-enriched Rabs based on endogenously tagged Rabs generated by Dunst et al., 2015.

Dunst et al., 2015. (A) Illustrations of the main anterior, inner and posterior neuropil regions of the adult brain exhibit strong Rab expression (shown in B). (B) Expression pattern of EYFP-tagged …

Figure 2 with 3 supplements
Developmental analyses of all viable rab mutants at different temperatures.

(A–C) Developmental time from embryogenesis to adults at 18°C (A), 25°C (B), and 29°C (C) for all homozygous viable rab mutants. (D, G, and J) Developmental time at 18°C for all homozygous viable rab

Figure 2—figure supplement 1
Validation of developmental timing phenotypes of viable rab mutants at different temperatures.

(A–C) Total developmental time of control and viable rab mutants at 18°C (A), 25°C (B) and 29°C (C). 0, 1, or 2 indicate if the specific phenotype could not be validated (0), could be validated by …

Figure 2—figure supplement 2
Wing surface area measurement for all homozygous viable rab mutants at 18°C and 29°C.

(A–B) Wing surface area measurement for all homozygous viable rab mutants at 18°C (A) and 29°C (B). Wild type (brown) and rab mutant (gray) wing size. Significantly reduced (red) and increased wing …

Figure 2—figure supplement 3
Examples of wing defects after development at different temperatures.

(A–J) Wing sizes of rab mutants at 18°C and 29°C. Flies at 29°C have on average 30% smaller wings than flies at 18°C (A–B). At 18°C, rabX1 has significantly larger wings than control, while rab19

Analysis of neuronal function and maintenance based on electroretinograms.

(A–B) Sensitization curves for light stimulated (orange curve) and dark-reared (black curve) wild type flies generated by electroretinogram (ERG) recordings. ‘on’ transient signal is lost after 4 …

Figure 4 with 1 supplement
Viable rab mutants show no apoptosis based on DCP-1 immunolabeling but display morphological changes in rhabdomeres after continuous light stimulation.

(A–B) Examples of rab mutant retinas which show rhabdomere changes and no increased levels in the apoptotic marker DCP-1 after 2 days of light stimulation compared to control (B) and newly hatched …

Figure 4—figure supplement 1
No viable rab mutants show apoptosis based on DCP-1 immunolabeling, some display morphological changes in rhabdomeres after 2 days of continuous light stimulation.

Labeling of newly hatched wild type and rab mutant retinas with Phalloidin and DCP-1 reveals normal rhabdomere development and no indication of apoptosis. No apoptotic cell death can be observed …

Figure 5 with 1 supplement
Analyses of morphology, recycling endosomal function (Rab11) and autophagy (Atg8) at photoreceptor axon terminals after continuous light stimulation.

(A) Examples of Chaoptin-labeling (Chp) of 0 day and 2 days light stimulated wild type and rab mutant photoreceptor projections (overview top panel, R1-R6 middle panel, R7-R8 bottom panel). The rabX1

Figure 5—figure supplement 1
Systematic analysis of photoreceptor axon morphology of newly eclosed adults and after 2 days of continuous light stimulation.

(A) Labeling of newly hatched wild type and mutant photoreceptor projections with Chaoptin (Chp) reveals no noticeable morphological differences. Chaoptin-positive accumulations in non-photoreceptor …

Figure 6 with 1 supplement
Loss of rab26 does not discernibly affect markers for synaptic vesicles or autophagy in the adult brain.

(A) Representative ERG traces of recordings of 2 days light stimulated wild type, rab26 mutant, and Rab26 GTP-locked overexpression flies. Only the Rab26 GTP-locked flies show a complete loss of …

Figure 6—figure supplement 1
Rab26 colocalizes with synaptic vesicle and endosomal markers at larval neuromuscular junction (NMJ) boutons.

(A) Immunolabeling of Rab26 (magenta) reveals its presence in NMJ boutons labeled by the active zone marker nc82 (green). The loss of Rab26 seems to have no effect on the overall NMJ morphology. …

Figure 7 with 1 supplement
Rab26 is required for membrane receptor turnover associated with cholinergic synapses.

(A–D) rab26 mutant R1-R6 photoreceptor terminals (B) exhibit Chaoptin-positive accumulations in the proximal lamina after 4 days of light stimulation (highlighted with white boxes), which are …

Figure 7—figure supplement 1
Rab26 RNAi recapitulates the null mutant lamina phenotype.

Endogenous Rab26 protein localizes to Lawf2-neurons in the lamina and strongly colocalizes with choline acetyl transferase throughout the adult brain. (A–B) Rab26 RNAi leads to reduced anti-Rab26 …

Tables

Table 1
Summary of functional analyses.
Viability and developmentTemp. sens.Neuronal function
ViabilityTotal dev.EmbryoLarvaPupaLethalWingSyn 2dDepol 2dSyn darkDepol darkRhabd. 2dAxon morphRab11Atg8
Rab3only 18°Conly 18°C18°C
RabX4Reduced18°C18°C
Rab2718°CArea
Rab26Shape
Rab1929°CShape
Rab32Reducedonly 18°Conly 18°C29°CArea
RabX1Reduced18°C
RabX6only 18°C29°C
Rab40Reducedonly 18°CArea
Rab23ReducedShape
Rab21Area
Rab929°C
Rab4only 18°Conly 18°CArea
Rab14Reduced
Rab39only 18°C
Rab18Area
Rab10Infertile18°C
Rab30InfertileArea
Rab7Lethal
Rab8Lethal
Rab2Lethal
Rab1Lethal
Rab6Lethal
Rab35Semi-lethal
Rab5Lethal
Rab11Lethal
  1. Overview of analyses (‘Viability and Development’, ‘Temperature sensitivity’ and ‘Neuronal Function’) done in this study for the indicated Rab GTPases. Abbreviations: bc = backcrossed rab mutants, depol = depolarization, dev. = development, Df = deficiency, morph = morphology, Rhabdom = rhabdomere, sens = sensitivity, syn = synaptic, temp = temperature, 2d = 2 days.

    Color code: green denotes no difference to control; grey through yellow and orange denotes increasing deviation from controls in functional analyses.

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (D. melanogaster)Rab2FlyBase ID:FBgn0014009Sequence location: 2R:6,696,739.6,699,469 [+]
Gene (D. melanogaster)Rab4FlyBase ID:FBgn0016701Sequence location: 2R:17,573,462.17,574,979 [+]
Gene (D. melanogaster)Rab9FlyBase ID:FBgn0032782Sequence location: 2L:19,432,574.19,435,841 [+]
Gene (D. melanogaster)Rab10FlyBase ID:FBgn0015789Sequence location:
X:20,251,338.20,254,691 [+]
Gene (D. melanogaster)Rab14FlyBase ID:FBgn0015791Sequence location: 2L:14,355,145.14,358,764 [+]
Gene (D. melanogaster)Rab18FlyBase ID:FBgn0015794Sequence location: X:5,670,827.5,671,812 [-]
Gene (D. melanogaster)Rab19FlyBase ID:FBgn0015793Sequence location: 3L:8,297,018.8,298,506 [+]
Gene (D. melanogaster)Rab21FlyBase ID:FBgn0039966Sequence location: X:23,012,140.23,013,409 [-]
Gene (D. melanogaster)Rab23FlyBase ID:FBgn0037364Sequence location: 3R:5,680,054.5,685,434 [-]
Gene (D. melanogaster)Rab26FlyBase ID:FBgn0086913Sequence location: 3L:21,318,774.21,335,027 [+]
Gene (D. melanogaster)Rab30FlyBase ID:FBgn0031882Sequence location: 2L:7,030,493.7,032,606 [-]
Gene (D. melanogaster)Rab35FlyBase ID:FBgn0031090Sequence location: X:20,155,766.20,159,872 [-]
Gene (D. melanogaster)Rab39FlyBase ID:FBgn0029959Sequence location:X:7,734,923.7,736,756 [+]
Gene (D. melanogaster)Rab40FlyBase ID:FBgn0030391Sequence location: X:12,459,796.12,463,112 [-]
Gene (D. melanogaster)RabX1FlyBase ID:FBgn0015372Sequence location: 2R:23,519,839.23,523,613 [-]
Gene (D. melanogaster)RabX4FlyBase ID:FBgn0051118Sequence location: 3R:24,826,665.24,828,409 [-]
Gene (D. melanogaster)RabX6FlyBase ID: FBgn0035155Sequence location: 3L:690,517.691,951 [+]
Strain, strain background (D. melanogaster)ywyw;;
Strain, strain background (D. melanogaster)w1118w1118;;
Genetic reagent (D. melanogaster)rab30- Gal4-KI, UAS-YFP-Rab30WTHiesinger lab stock
Genetic reagent (D. melanogaster)rab3-DfBloomington Drosophila Stock Center (BDSC)BDSC:8909Deficiency line for rab3
Genetic reagent (D. melanogaster)rab4-DfBloomington Drosophila Stock CenterBDSC:38465Deficiency line for rab4
Genetic reagent (D. melanogaster)rab9-DfBloomington Drosophila Stock CenterBDSC:7849Deficiency line for rab9
Genetic reagent (D. melanogaster)rab10-DfBloomington Drosophila Stock CenterBDSC:29995Deficiency line for rab10
Genetic reagent (D. melanogaster)rab14-DfBloomington Drosophila Stock CenterBDSC:7518Deficiency line for rab14
Genetic reagent (D. melanogaster)rab19-DfBloomington Drosophila Stock CenterBDSC:7591Deficiency line for rab19
Genetic reagent (D. melanogaster)rab32-DfBloomington Drosophila Stock CenterBDSC:23664Deficiency line for rab32
Genetic reagent (D. melanogaster)rab39-DfBloomington Drosophila Stock CenterBDSC:26563Deficiency line for rab39
Genetic reagent (D. melanogaster)rab40-DfBloomington Drosophila Stock CenterBDSC:26578Deficiency line for rab40
Genetic reagent (D. melanogaster)rabX1-DfBloomington Drosophila Stock CenterBDSC:26513Deficiency line for rabX1
Genetic reagent (D. melanogaster)rabX4-DfBloomington Drosophila Stock CenterBDSC:25024Deficiency line for rabX4
Genetic reagent (D. melanogaster)rabX6-DfBloomington Drosophila Stock CenterBDSC:8048Deficiency line for rabX6
Genetic reagent (D. melanogaster)EYFP-Rab3Dunst et al., 2015FlyBase ID:FBst0062541; BDSC:62541FlyBase Genotype: w1118; TI{TI}Rab3EYFP
Genetic reagent (D. melanogaster)EYFP-Rab4Dunst et al., 2015FlyBase ID:FBst0062542;
BDSC:62542
FlyBase Genotype: y1w1118; TI{TI}Rab4EYFP
Genetic reagent (D. melanogaster)EYFP-Rab9Dunst et al., 2015FlyBase ID:FBst0062547;
BDSC:62547
FlyBase Genotype: w1118; TI{TI}Rab9EYFP
Genetic reagent (D. melanogaster)EYFP-Rab19Dunst et al., 2015FlyBase ID:FBst0062552;
BDSC:62552
FlyBase Genotype: w1118; TI{TI}Rab19EYFP
Genetic reagent (D. melanogaster)EYFP-Rab21Dunst et al., 2015FlyBase ID:FBst0062553;
BDSC:62553
FlyBase Genotype:y1 w1118 TI{TI}Rab21EYFP
Genetic reagent (D. melanogaster)EYFP-Rab23Dunst et al., 2015FlyBase ID:FBst0062554;
BDSC:62554
FlyBase Genotype: y1 w1118; TI{TI}Rab23EYFP
Genetic reagent (D. melanogaster)EYFP-Rab26Dunst et al., 2015FlyBase ID:FBst0062555;
BDSC:62555
FlyBase Genotype: y1 w1118; TI{TI}Rab26EYFP
Genetic reagent (D. melanogaster)EYFP-Rab27Dunst et al., 2015FlyBase ID:FBst0062556;
BDSC:62556
FlyBase Genotype: y1 TI{TI}Rab27EYFP w1118
Genetic reagent (D. melanogaster)EYFP-Rab32Dunst et al., 2015FlyBase ID:FBst0062558;
BDSC:62558
FlyBase Genotype: w1118; TI{TI}Rab32EYFP
Genetic reagent (D. melanogaster)EYFP-Rab40Dunst et al., 2015FlyBase ID:FBst0062561;
BDSC:62561
FlyBase Genotype: y1 w1118 TI{TI}Rab40EYFP
Genetic reagent (D. melanogaster)EYFP-RabX1Dunst et al., 2015FlyBase ID:FBst0062562;
BDSC:62562
FlyBase Genotype: w1118; TI{TI}RabX1EYFP
Genetic reagent (D. melanogaster)EYFP-RabX4Dunst et al., 2015FlyBase ID:FBst0062563;
BDSC:62563
Heterozygous flies used; FlyBase Genotype: w1118; TI{TI}RabX4EYFP
Genetic reagent (D. melanogaster)EYFP-RabX6Dunst et al., 2015FlyBase ID:FBst0062565;
BDSC:62565
FlyBase Genotype: w1118; TI{TI}RabX6EYFP
Genetic reagent (D. melanogaster)rab2This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab4This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab9This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab10This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab14This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab18This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab19This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab21This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab23This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab26This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab30This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab35This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab39This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab40This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rabX1This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rabX4This paperFly stock maintained in Hiesinger lab; see Materials and methods
genetic reagent (D. melanogaster)rabX6This paperFly stock maintained in Hiesinger lab; see Materials and methods
Genetic reagent (D. melanogaster)rab1Thibault et al., 2004FlyBase ID:FBst0017936;
BDSC:17936
FlyBase Genotype: w1118; PBac{RB}Rab1e01287/TM6B, Tb1
Genetic reagent (D. melanogaster)rab3Graf et al., 2009FlyBase ID:FBst0078045;
BDSC:78045
FlyBase Genotype: w*; Rab3rup
Genetic reagent (D. melanogaster)rab5Wucherpfennig et al., 2003FlyBase ID:FBal0182047w; Rab52 P{neoFRT}40A/CyO;
Genetic reagent (D. melanogaster)rab6Purcell and Artavanis-Tsakonas, 1999FlyBase ID:FBst0005821;
BDSC:5821
FlyBase Genotype: w*; Rab6D23D/CyO; ry506
Genetic reagent (D. melanogaster)rab7Cherry et al., 2013FlyBase ID:FBal0294205Fly stock maintained in Hiesinger lab; “;Sp/CyO; P{neoFRT}82B, Rab7Gal4-KO
/TM3’
Genetic reagent (D. melanogaster)rab8Giagtzoglou et al., 2012FlyBase ID:FBst0026173;
BDSC:26173
FlyBase Genotype: Rab81 red1 e4/TM6B, Sb1 Tb1 ca1
Genetic reagent (D. melanogaster)rab11Bellen et al., 2004FlyBase ID:FBst0042708;
BDSC:42708
FlyBase Genotype: w*; P{EP}Rab11EP3017/TM6B, Tb1
Genetic reagent (D. melanogaster)rab27Chan et al., 2011Fly stock maintained in Hiesinger lab; rab27Gal4-KO;;
Genetic reagent (D. melanogaster)rab32Ma et al., 2004FlyBase ID:FBst0000338;
BDSC:338
FlyBase Genotype: Rab321
Genetic reagent (D. melanogaster)lGMR-Gal4, UAS-white RNAiHiesinger lab stockFly stock maintained in Hiesinger lab; long version of GMR
Genetic reagent (D. melanogaster)UAS-YFP-Rab26WTZhang et al., 2007BDSC:23245YFP-tagged, wild type form of Rab26
Genetic reagent (D. melanogaster)UAS-YFP-Rab26CAZhang et al., 2007BDSC:9809YFP-tagged, constitutively active form of Rab26
Genetic reagent (D. melanogaster)UAS-YFP-Rab26DNZhang et al., 2007BDSC:9807YFP-tagged, dominant negative form of Rab26
Genetic reagent (D. melanogaster)elav-Gal4Bloomington Drosophila Stock CenterFlyBase ID:FBst0008765;
BDSC:8765
FlyBase Genotype: P{GAL4-elav.L}2/CyO
Genetic reagent (D. melanogaster)sGMR-Gal4Bloomington Drosophila Stock CenterFlyBase ID:FBst0001104;
BDSC:1104
FlyBase Genotype: w*; P{GAL4-ninaE.GMR}12
Genetic reagent (D. melanogaster)UAS-Rab26 RNAiVienna Drosophila Resource Center (VDRC)VDRC:101330Rab26 RNAi line KK107584
Genetic reagent (D. melanogaster)rab26exon1-Gal4Chan et al., 2011Fly stock is maintained in Hiesinger lab
Genetic reagent (D. melanogaster)UAS-CD4-tdGFPBloomington Drosophila Stock CenterFlyBase ID:FBst0035839;
BDSC:35839
FlyBase Genotype: y1w*; P{UAS-CD4-tdGFP}8 M2
Genetic reagent (D. melanogaster)31C06-Gal4 (L4-Gal4)Bloomington Drosophila Stock CenterFlyBase ID:FBst0049883;
BDSC:49883
FlyBase Genotype: w1118; P{GMR31C06-GAL4}attP2
Genetic reagent (D. melanogaster)Lawf1-Split-GalTuthill et al., 2013R11G01AD attP40; R17C11DBD attP2; ‘SS00772’
Genetic reagent (D. melanogaster)Lawf2-Split-GalTuthill et al., 2013R11D03AD attP40; R19C10DBD attP2; ‘SS00698’
Genetic reagent (D. melanogaster)UAS-rye RNAi; UAS-Dicer2Gift from Amita SehgalDα4 receptor subunit RNAi line
Genetic reagent (D. melanogaster)rdgC306Bloomington Drosophila Stock CenterFlyBase ID:FBst0003601;
BDSC:3601
FlyBase Genotype: w1118; rdgC306 kar1 ry1/TM3, Sb1 Ser1
AntibodyAnti-Rab5 (Rabbit polyclonal)Abcam (Cambridge, UK)Cat #: ab31261; RRID: AB_882240IHC (1:1000)
AntibodyAnti-Rab7 (Rabbit polyclonal)Gift from Patrick DolphIHC (1:1000)
AntibodyAnti-Rab11 (Mouse monoclonal)BD Biosciences (San Jose, CA, USA)clone47; RRID:AB_397983IHC (1:500)
AntibodyAnti-Rab26 (Guinea pig polyclonal)This paperSee Materials and methods; IHC (1:2000); WB (1:1000)
AntibodyAnti-Syt1 (Mouse monoclonal)Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA)3H2 2D7; RRID:AB_528483IHC (1:500)
AntibodyAnti-GABARAP+GABARAPL1+GABARAPL2 (Atg8) (Rabbit monoclonal)Abcam (Cambridge, UK)Cat #: ab109364; RRID:AB_10861928IHC (1:100)
AntibodyAnti-Syx7/Avalanche (Rabbit polyclonal)Gift from Helmut KramerIHC (1:1000)
AntibodyAnti-Hrs (Guinea pig polyclonal)Gift from Hugo BellenIHC (1:300)
AntibodyAnti-HRP (Rabbit polyclonal)Jackson ImmunoResearch Laboratories (West Grove, PA, USA)RRID:AB_2314648IHC (1:500)
AntibodyAnti-DPAK (Rabbit polyclonal)IHC (1:2000)
AntibodyAnti-Dα7 (Rat polyclonal)Gift from Hugo BellenIHC (1:2000)
AntibodyAnti-nCadherin (Rat monoclonal)Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA)DN-Ex #8;
RRID:AB_528121
IHC (1:100)
AntibodyAnti-V100 (Guinea pig polyclonal)Hiesinger et al., 2005IHC (1:1000)
AntibodyAnti-CSP (Mouse monoclonal)Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA)DCSP-2 (6D6); RRID:AB_528183IHC (1:50)
AntibodyAnti-ChAT (Mouse monoclonal)Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA)ChAT4B1; RRID:AB_528122IHC (1:100)
AntibodyAnti-nc82 (Mouse monoclonal)Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA)RRID: AB_2314866IHC (1:20)
AntibodyAnti-ebony (Rabbit polyclonal)IHC (1:200)
AntibodyAnti-Chaoptin (Mouse monoclonal)Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA)24B10; RRID: AB_528161IHC (1:50)
AntibodyAnti-DCP-1 (Rabbit polyclonal)Cell Signaling Technology (Danvers, MA, USA)Asp216; Cat#: 9578; RRID:AB_2721060IHC (1:100)
AntibodyDyLight 405 AffiniPure Donkey Anti-Mouse igG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)715-475-150; RRID:AB_2340839IHC (1:500)
AntibodyAlexa Fluor 488 AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)115-545-003; RRID: AB_2338840IHC (1:500)
AntibodyAlexa Fluor 488 AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)115-545-166; RRID: AB_2338852Minimal cross-reactive; IHC (1:500)
AntibodyAlexa Fluor 488 AffiniPure Goat Anti-Rat IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)112-545-167; RRID: AB_2338362Minimal cross-reactive; IHC (1:500)
AntibodyAlexa Fluor 488 AffiniPure Goat Anti-Guinea Pig IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)106-545-003; RRID: AB_2337438IHC (1:500)
AntibodyCy3 AffiniPure Goat Anti-Rabbit IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)111-165-003; RRID: AB_2338000IHC (1:500)
AntibodyAlexa Fluor 647 AffiniPure Goat Anti-Rabbit IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)111-605-045; RRID: AB_2338075IHC (1:500)
AntibodyAlexa Fluor 647 AffiniPure Goat Anti-Rat IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)112-605-003; RRID: AB_2338393IHC (1:500)
AntibodyGoat Anti-Guinea pig IgG H&L (Cy5)Abcam (Cambridge, UK)Cat. #: ab102372; RRID: AB_10710629IHC (1:500)
AntibodyCy5 AffiniPure Goat Anti-Mouse IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)115-175-166;
RRID: AB_2338714
Minimal cross-reactive; IHC (1:500)
AntibodyCy5 AffiniPure Goat Anti-Rat IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)112-175-167; RRID: AB_2338264Minimal cross-reactive; IHC (1:500)
AntibodyPeroxidase AffiniPure Goat Anti-Guinea Pig IgG (H+L)Jackson ImmunoResearch (West Grove, PA, USA)106-035-003; RRID: AB_2337402WB (1:5000)
Sequence-based reagent rab2This paperPCR primersFwd: 5’-TGGCCACACTGTCGCTAGCC;
Rev: 5’-CGCCTCCTCTACGTTGGCAG
Sequence-based reagentrab3This paperPCR primersFwd: 5’-ACACTGAGGCGAGCTTACGC;
Rev: 5’-CTACTACCGAGGAGCGATGGG
Sequence-based reagentrab4This paperPCR primersFwd: 5’- GGTTTTGATCGTGTCCTGCG;
Rev: 5’-AGACAACTCTTACCGCTGCC
Sequence-based reagentrab9This paperPCR primersFwd: 5’- GGCACTATGACGAACATGCGG;
Rev: 5’-tttgcagcactgggaaatccg
Sequence-based reagentrab10This paperPCR primersFwd: 5’- atatctcttgtcacctgcgcc;
Rev: 5’-cgaccaccatccatcgttcgg
Sequence-based reagentrab14This paperPCR primersFwd: 5’-gggGCCAGTTCGAGAAAGGG;
Rev: 5’-CACGAGCACTGATCCTTGGC
Sequence-based reagentrab18This paperPCR primersFwd: 5’- AAACAAAGCAGCAAGGTGGC;
Rev: 5’-CTCCTCGTCGATCTTGTTGCC
Sequence-based reagentrab19This paperPCR primersFwd: 5’- CCAGTTAACGGCCAGAACGG;
Rev: 5’-TTGCCTCTCTGAGCATTGCC
Sequence-based reagentrab21This paperPCR primersFwd: 5’- CAATGGGAACGGCTAAATGCC;
Rev: 5’-caacatttaTCGCCGAGTGCC
Sequence-based reagentrab23This paperPCR primersFwd: 5’- CACCTGCCGGCTTAGATGCG;
Rev: 5’-GAGATATCGGAACCGGCCCG
Sequence-based reagentrab26This paperPCR primersFwd: 5’- CGATGAAGTGGACATGCACCC;
Rev: 5’-tgcacttgaacttcactggcg
Sequence-based reagentrab30This paperPCR primersFwd: 5’- ACCCAGCGACTCAAAAACCC;
Rev: 5’-GCTGCACAGTTTCCAGATCCG
Sequence-based reagentrab32This paperPCR primersFwd: 5’-GTAGACACGGGTCATGTTGCC;
Rev: 5’-accagcaaatctcagtgcgg
Sequence-based reagentrab35This paperPCR primersFwd: 5’- CGAATCGTAAGCCAAGAACCC;
Rev: 5’-ACTAATGGTGACGCACTGGC
Sequence-based reagentrab39This paperPCR primersFwd: 5’- TAACAACCACCAGCGACAGCC; Rev: 5’-CGTATACCTCGTGTGACTGGC
Sequence-based reagentrab40This paperPCR primersFwd: 5’- caatgagtaaacccctagcgg;
Rev: 5’-TGGGTATGGGTATGGTATGGG
Sequence-based reagentrabX1This paperPCR primersFwd: 5’- GTGCCCAAGAAATCAGACGC;
Rev: 5’-AGTCAGATGGGCTTAGAGCG
Sequence-based reagentrabX4This paperPCR primersFwd: 5’- CTGTAACCGAAAACCTCCGC;
Rev: 5’-CAACTTGCTCAGGTTCTGCG
Sequence-based reagentrabX6This paperPCR primersFwd: 5’- GTCGCACTGTTGTTGTCGCC;
Rev: 5’-CTCTGCGTGAGCATTGAGCC
Sequence-based reagentReverse primer in Gal4-regionThis paperPCR primers5’-CGGTGAGTGCACGATAGGGC
Sequence-based reagentSecond reverse primer in Gal4-regionThis paperPCR primers5’-CAATGGCACAGGTGAAGGCC
Sequence-based reagentReverse primer in RFP-regionThis paperPCR primers5’- GCTGCACAGGCTTCTTTGCC
Sequence-based reagentSecond reverse primer in RFP-regionThis paperPCR primers5’- ACAATCGCATGCTTGACGGC
Sequence-based reagentForward primer in RFP-regionThis paperPCR primers5’- GGCTCTGAAGCTGAAAGACGG
Sequence-based reagentForward primer in dsRed-regionThis paperPCR primers5’- ATGGTTACAAATAAAGCAATAGCATC
Sequence-based reagentReverse primer behind right-arm of inserted dsRed-cassetteThis paperPCR primers5’-AAACCACAGCCCATAGACG
Commercial assay or kitSapphireAmp Fast PCR Master MixTakara Bio GroupCat. #:
RR350A
Commercial assay or kitPhusion High-Fidelity PCR kitThermo Fisher Scientific Inc (Waltham, MA, USA)Cat. #:
F553S
Commercial assay or kitNucleoSpin Gel and PCR Clean–upMacherey-Nagel (Düren, Germany)Cat. #: 740609.50Mini kit for gel extraction and PCR clean-up
Software, algorithmImageJNational Institutes of Health (NIH)https://imagej.nih.gov/ij/
Software, algorithmImarisBitplane (Zurich, Switzerland)https://imaris.oxinst.com/packages
Software, algorithmAmiraThermo Fisher Scientific Inc (Waltham, MA, USA)https://www.thermofisher.com/de/de/home/industrial/electron-microscopy/electron-microscopy-instruments-workflow-solutions/3d-visualization-analysis-software.html
Software, algorithmAdobe PhotoshopAdobe Inc (San Jose, CA, USA)https://www.adobe.com/products/photoshop.html
Software, algorithmAdobe IllustratorAdobe Inc (San Jose, CA, USA)https://www.adobe.com/products/illustrator.html
Software, algorithmRStudioRStudio Inc (Boston, MA, USA)https://rstudio.com/products/rstudio/
Software, algorithmGraphPad PrismGraphPad Software Inc (San Diego, CA, USA)https://www.graphpad.com/scientific-software/prism/
Software, algorithmAxoScopeMolecular Devices LLC. (San Jose, CA, USA)https://www.moleculardevices.com/
Software, algorithmSnapGeneGSL Biotech LLC (Chicago, IL, USA)https://www.snapgene.com/
OtherToto-3 stainThermo Fisher Scientific Inc (Waltham, MA, USA)Cat. #: T3604TOTO-3 Iodide (642/660); IHC (1:1000)
OtherPhalloidin stainAbcam (Cambridge, UK)Cat. #: ab176752Phalloidin-iFluor 405; IHC (1:250)
OtherSDS-polyacrylamide GelBio-Rad Laboratories, Inc (Hercules, CA, USA)Cat. #: 45610834–15% Mini-PROTEAN TGX Precast Gels
OtherPVDF membraneBio-Rad Laboratories, Inc (Hercules, CA, USA)Cat. #: 162–0177
OtherClarity Western ECL SubstrateBio-Rad Laboratories, Inc (Hercules, CA, USA)Cat. #: 170–5060
OtherInsect needlesEntomoravia (Slavkov u Brna, Czech Republic)https://entomoravia.eu/Austerlitz insect needles; ø 0.1 mm

Additional files

Supplementary file 1

Notes on pupal and adult expression patterns of nervous system-enriched Rabs based on endogenously tagged Rabs generated by Dunst et al., 2015.

(A) Expression notes on optic lobe expression at 40% pupal development. (B) Expression notes on adult brains. The expression patterns are shown in Figure 1—figure supplements 23.

https://cdn.elifesciences.org/articles/59594/elife-59594-supp1-v2.docx
Supplementary file 2

Tissue localization of Rab proteins in humans, rodents (mus musculus, rattus norvegicus, white New Zealand rabbits (Oryctolagus cuniculus)) and Drosophila melanogaster based on RNA- and protein-level expression.

For the human protein atlas (www.proteinatlas.org based on Fagerberg et al., 2014) 27 tissues were analyzed. The data was summarized in the following way: “ubiquitous” (detected in all tissue/region/cell types), “widespread” (detected in at least a third but not all tissue/region/cell types), “restricted” (detected in more than one but less than one third of tissue/region/cell types). The classifications “tissue specific”, “tissue enriched”, “group enriched” and “uncertain” were used as described in the human protein atlas. Regarding the data of the mouse embryo (E 14.5) transcriptome atlas (www.eurexpress.org based on Diez-Roux et al., 2011) the original classifications were adopted: “regional signal” (signal detected in a limited number of discrete locations), “no regional signal” (in all tissues or not detectable) or “not detected”. Out of the analyzed tissues “brain, spinal cord, CNS nerves, peripheral nervous system, ganglia” were grouped as nervous system and “gut, stomach, liver, pancreas” as intestines. For the flyatlas2 (www.flyatlas.gla.ac.uk, see also based on Leader et al., 2018) only data of female adults were considered. “Head, brain and thoracicoabdominal ganglion” were grouped as “nervous system high”. The following abbreviations were used: human (H), rodent (R), Drosophila melanogaster (Dm), embryo (E), larva (L), adult (A), Mus musculus (Mm), Rattus norvegicus (Rn), Oryctolagus cuniculus (Oc), cell culture (CC). Asterisks indicate if the Rab is specific to Hominidae (*), specific to primates (**) or specific to primates and dolphins (***).

https://cdn.elifesciences.org/articles/59594/elife-59594-supp2-v2.docx
Supplementary file 3

Function, subcellular localization, and mutant viability of Rab GTPases in mammals, Saccharomyces cerevisiae and Drosophila melanogaster.

Mouse knockout models were listed for the mammalian rab GTPase mutants. Among primary publications, the International Mouse Phenotype Consortium (https://www.mousephenotype.org/) was used for information on the viability of mouse knockout models Information on Drosophila mutant viability is based on this study, if not stated otherwise in the table. Only viability / lethality for homozygous mutants was listed. The following abbreviations were used: Drosophila melanogaster (Dm), endoplasmic reticulum (ER), glucose transporter type 4 (GLUT4), insulin-producing cells (IPCs), Jun-N-terminal kinase (JNK), knockout (KO), mammals (M), matrix metalloproteinases (MMP), multivesicular bodies(MVBs), neuromuscular junction (NMJ), planar cell polarity (PCP), plasma membrane (PM), Saccharomyces cerevisiae(Sc), trans-Golgi network (TGN), 37tyrosinase-related protein-1 (Tyrp-1), ventral nerve cord (VNC). Asterisks indicate if the Rab isspecific to Hominidae (*), specific to primates (**) or specific to primates and dolphins (***).

https://cdn.elifesciences.org/articles/59594/elife-59594-supp3-v2.docx
Supplementary file 4

Quantitative analysis of the developmental timing assay at different temperatures.

(A) Summary of developmental time for wild type and all fertile, homozygous viable rab mutants at 18°C, 25°C, and 29°C. Listed are number of days (after 24 hr of egg collection) until first 1st instar larvae, pupae, or adults appear, as well as total number of adults hatched and number of adults per vial. Days are given in mean ± SEM. (B) Summary of developmental time for wild type and tested backcrossed rab mutants at 18°C, 25°C, and 29°C. Listed are number of days (after 24 hr of egg collection) until first 1st instar larvae, pupae, or adults appear, as well as total number of adults hatched and number of adults per vial. Days are given in mean ± SEM. (C) Summary of developmental time for wild type and tested rab mutants over deficiencies at 18°C, 25°C and 29°C. Listed are number of days (after 24 hr of egg collection) until first 1st instar larvae, pupae, or adults appear, as well as total number of adults hatched and number of adults per vial. Days are given in mean ± SEM.

https://cdn.elifesciences.org/articles/59594/elife-59594-supp4-v2.docx
Transparent reporting form
https://cdn.elifesciences.org/articles/59594/elife-59594-transrepform-v2.docx

Download links