EXOC1 plays an integral role in spermatogonia pseudopod elongation and spermatocyte stable syncytium formation in mice
- Master’s Program in Medical Sciences, Graduate School of Comprehensive Human Sciences, University of Tsukuba, Japan
- Laboratory Animal Resource Center, Trans-border Medical Research Center, University of Tsukuba, Japan
- School of Medical Sciences, University of Tsukuba, Japan
- Ph.D Program in Human Biology, School of Integrative and Global Majors, University of Tsukuba, Japan
- Division of Germ Cell Biology, National Institute for Basic Biology, National Institutes of Natural Sciences, Japan
- Department of Basic Biology, School of Life Science, Graduate University for Advanced Studies (Sokendai), Japan
- Department of Comparative and Experimental Medicine, Nagoya City University Graduate School of Medical Sciences, Japan
- Doctoral program in Biomedical Sciences, Graduate School of Comprehensive Human Sciences, University of Tsukuba, Japan
- Doctoral program in Medical Sciences, Graduate School of Comprehensive Human Sciences, University of Tsukuba, Japan
- Department of Stem Cells and Human Disease Models, Research Center for Animal Life Science, Shiga University of Medical Science, Japan
Figures
Figure 1 with 3 supplements
Confirmation of EXOC1 expression in testes using the PA-Tag knock-in mouse.
(A) Generation of PA-Tag knock-in mice. In the Exoc1PA-C allele, the LG3-linker connected PA-tag gene fragment was knocked-in just before the stop codon of Exoc1 using CRISPR-Cas9. In the Exoc1PA-N …
-
Figure 1—source data 1
Raw data of the in vivo western blot.
- https://cdn.elifesciences.org/articles/59759/elife-59759-fig1-data1-v1.pptx
Figure 1—figure supplement 1
Expression of mRNA for each Exocyst subunit and EXOC1 protein in adult mouse male germ cells.
(A) The expression data of each Exocyst subunit were extracted from the open data source, GSE112393 (Green et al., 2018). GC1 is spermatogonia, GC2 and GC3 are preleptotene stages, GC4–GC8 are …
Figure 1—figure supplement 2
Expression of Exocyst subunits in Sertoli cells of adult mice.
The expression data of each Exocyst subunit in Sertoli cells (from 9 weeks mouse) was extracted from the open data source, GSM3069461 (Green et al., 2018). The y-axis is the expression level of all …
Figure 1—figure supplement 3
The production of Exoc1 flox mice.
The Exoc1 flox strain was from the Exoc1tm1a(EUCOMM)Hmgu mouse. The Exoc1tm1a(EUCOMM)Hmgu allele was changed to the Exoc1tm1c(EUCOMM)Hmgu (is equal to Exoc1flox) allele by mating with the Flpe …
Figure 2 with 2 supplements
Impaired spermatogenesis in Exoc1 cKO mice.
(A) PNA-lectin staining of the Exoc1 adult cKO testis. Signals of PNA-lectin, an acrosomal marker was not observed in the Exoc1 cKO testis. Scale bars: 50 μm. (B) The macroscopic images for H and E …
Figure 2—figure supplement 1
The occurrence frequency of aggregates of syncytia (AGS) in the Exoc1 cKO.
(A) Classification reference image of cross-sections of seminiferous tubules to evaluate the incidence of AGS. Cross-sections with AGS indicated by arrowheads were classified as ‘Section containing …
Figure 2—figure supplement 2
Normal meiotic chromosome synapsis in Exoc1 cKO mice.
Meiotic chromosome synapsis was confirmed by immunofluorescence. In pachytene stage, both the homologous pairing (marked by Sycp3) and synaptonemal complex (marked by Sycp1) were normal in Exoc1 cKO …
Figure 3 with 2 supplements
EXOC1 regulates ICB formation in cooperation with STX2 and SNAP23.
(A) Co-immunoprecipitation of EXOC1-STX2-SNAP23 complex in vitro. FLAG-tagged mouse EXOC1, HA-tagged mouse STX2, and Myc-tagged mouse SNAP23 were co-overexpressed in HEK293T cells. The binding of …
-
Figure 3—source data 1
Raw data of the in vitro immunoprecipitation.
- https://cdn.elifesciences.org/articles/59759/elife-59759-fig3-data1-v1.pptx
-
Figure 3—source data 2
Raw data of the in vivo immunoprecipitation.
- https://cdn.elifesciences.org/articles/59759/elife-59759-fig3-data2-v1.pptx
-
Figure 3—source data 3
Occurrence rate of AGS per area in the extracted Section containing AGS.
- https://cdn.elifesciences.org/articles/59759/elife-59759-fig3-data3-v1.xlsx
Figure 3—figure supplement 1
The production of Snap23 flox mice.
Snap23 flox mice were from the Snap23tm1a(EUCOMM)Wtsi frozen sperms. Snap23tm1a(EUCOMM)Wtsi frozen sperms were thawed and fertilized to wild-type oocyte in vitro. Flpe mRNA was electroplated into …
Figure 3—figure supplement 2
The occurrence frequency of aggregates of syncytia (AGS) in the Snap23 cKO.
(A) Results of classifying the cross-section of the seminiferous tubules of adult Snap23 cKO (n = 3) using the same criteria as in Figure 3—figure supplement 1A. (B) Graph is based on Figure …
Figure 4 with 1 supplement
EXOC1 regulates pseudopod elongation via Rac1 inactivation.
(A) A representative image of GFRα1+ undifferentiated spermatogonia in Exoc1 cKO and Stx2 KO. Pseudopod elongation was impaired in Exoc1 cKO, but not in Stx2 KO. Scale bars: 10 μm. (B) Pseudopod …
-
Figure 4—source data 1
Measurement of the length of the pseudopodia of GFRα1+ cells in section observation.
- https://cdn.elifesciences.org/articles/59759/elife-59759-fig4-data1-v1.xlsx
-
Figure 4—source data 2
Measurement of the length of the pseudopodia of GFRα1+ cells in whole-mount observation.
- https://cdn.elifesciences.org/articles/59759/elife-59759-fig4-data2-v1.xlsx
-
Figure 4—source data 3
Intensity of active Rac1 signal in each cell.
- https://cdn.elifesciences.org/articles/59759/elife-59759-fig4-data3-v1.xlsx
Figure 4—figure supplement 1
The production of the Stx2 KO.
(A) Stx2 KO mice generated by the CRISPR-Cas9 genome editing in mouse zygotes. Two CRISPR targets located 482 bp upstream and 148 bp downstream of exon 5 of Stx2. Arrows indicate long and short PCR …
Figure 5 with 1 supplement
The balance of spermatogonial differentiation is perturbed in Exoc1 cKO.
(A) Representative immunofluorescence image of adult Exoc1 cKO seminiferous tubule. GFRα1+ spermatogonia (arrow) density in the cKO was higher than that in control mice. RARγ+ spermatogonia …
-
Figure 5—source data 1
The number of GFRα1+ and RARγ+ cells.
- https://cdn.elifesciences.org/articles/59759/elife-59759-fig5-data1-v1.xlsx
-
Figure 5—source data 2
The number of c-Kit+ cells.
- https://cdn.elifesciences.org/articles/59759/elife-59759-fig5-data2-v1.xlsx
Figure 5—figure supplement 1
The number of Kit+ differentiating spermatogonia are reduced in Exoc1 cKO.
The number of Kit+ spermatogonia in each one cross-section of seminiferous tubule in adult mice (n = 3 in each genotype, 20 sections in each mouse). *p=0.000012, Student’s t-test. Control: Exoc1flox/…
Author response image 1
Author response image 2
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus) | C57BL/6J | Charles River Laboratories Japan | Stock No: 000664 | |
| Strain, strain background (M. musculus) | Crl:CD1(ICR) | Charles River Laboratories Japan | ||
| Genetic reagent (M. musculus) | Exoc1 flox | This paper | This is from the Exoc1tm1a(EUCOMM)Hmgu. IKMC Project #78575 | |
| Genetic reagent (M. musculus) | Exoc1PA-C | This paper | ||
| Genetic reagent (M. musculus) | Exoc1PA-N | This paper | ||
| Genetic reagent (M. musculus) | Snap23 flox | This paper | This is from the Snap23tm1a(EUCOMM)Wts. Colony Name BLA3054 | |
| Genetic reagent (M. musculus) | Stx2 KO | This paper | ||
| Genetic reagent (M. musculus) | Nanos3tm2 (cre)Ysa | Suzuki et al., 2008 | Prof. Saga, RIKEN BRC (RDB13130) | RBRC02568 |
| Genetic reagent (M. musculus) | B6;SJL-Tg(ACTFLPe)9205Dym/J | The Jackson Laboratory | Stock No: 003800 | |
| Cell line (Human) | HEK293T cell | ATCC | ATCC Sales Order: SO0623448 | FTA Barcode: STRB4056 |
| Antibody | Monoclonal anti-PA-tag, Biotin conjugated (Rat) | FUJIFILM Wako Chemicals | Cat#017–27731 | WB (1:500) |
| Antibody | Polyclonal anti-b-actin (Rabbit) | MEDICAL and BIOLOGICAL LABORATORIES | Cat#PM053 | WB (1:3000) |
| Antibody | Monoclonal anti-DYKDDDDK tag (Mouse) | FUJIFILM Wako Chemicals | Cat# 018–22381 | WB (1:2000) |
| Antibody | Monoclonal anti-DYKDDDDK tag (Rat) | FUJIFILM Wako Chemicals | Cat# 018–23621 | WB (1:2000) |
| Antibody | Monoclonal anti-HA-tag (Rabbit) | Cell Signaling Technology | Cat#3724 | WB (1:2000) |
| Antibody | Monoclonal anti-HA-tag (Mouse) | BioLegend | Cat#901513 | WB (1:1000) |
| Antibody | Monoclonal anti-Myc (Mouse) | MEDICAL and BIOLOGICAL LABORATORIES | Cat#M192-3 | WB (1:1000) |
| Antibody | Monoclonal anti-SNAP23 (Mouse) | Santa Cruz Biotechnology | Cat#sc-166244 | WB (1:1000) |
| Antibody | Anti-Rat IgG, HRP-linked (Goat) | GE Healthcare | Cat#NA935V | WB (1:30000) |
| Antibody | Anti-Rabbit IgG, HRP-linked (Donkey) | GE Healthcare | Cat#NA934V | WB (1:30000) |
| Antibody | Anti-Mouse IgG, HRP-linked (Sheep) | GE Healthcare | Cat#NA931V | WB (1:30000) |
| Antibody | Normal IgG (Rabbit) | FUJIFILM Wako Chemicals | Cat#148–09551 | Co-IP |
| Antibody | Polyclonal anti-SNAP23 (Rabbit) | Abcam | Cat#ab3340 | Co-IP |
| Antibody | Monoclonal anti-PA-tag (Rat) | FUJIFILM Wako Chemicals | Cat#016–25861 | IF (1:1000) |
| Antibody | Monoclonal anti-γH2AX (Mouse) | Merck-Millipore | Cat#05–636 | IF (1:100) |
| Antibody | Polyclonal anti-SYCP1 (Rabbit) | Novus Biological | Cat#NB300-299 | IF (1:50) |
| Antibody | Monoclonal anti-SYCP3 (Mouse) | Santa Cruz Biotechnology | Cat#sc-74569 | IF (1:50) |
| Antibody | Polyclonal anti-GFRα1 (Goat) | R and D systems | Cat#AF560 | IF (1:400 for section) IF (1:1000 for whole mount) |
| Antibody | Monoclonal anti-RARγ1 (Rabbit) | Cell Signaling Technology | Cat#8965S | IF (1:200) |
| Antibody | Monoclonal anti-active rac1 (Mouse) | NewEast Biosciences | Cat#26903 | IF (1:1000) |
| Antibody | Polyclonal anti-Exoc1 (Rabbit) | Proteintech | Cat#11690–1-AP | IF (1:50) |
| Antibody | Polyclonal anti-Exoc1 (Rabbit) | Atlas Antibodies | Cat#HPA037706 | IF (1:50) |
| Antibody | Anti-Goat IgG, Alexa Fluor 488 (Chicken) | Thermo Fisher Scientific | Cat#A21467 | IF (1:200 for section) |
| Antibody | Anti-Goat IgG, Alexa Fluor 594 (Chicken) | Thermo Fisher Scientific | Cat#A21468 | IF (1:400 for whole mount) |
| Antibody | Anti-Rat IgG, Alexa Fluor 555 (Donkey) | Abcam | Cat#ab150154 | IF (1:1000) |
| Antibody | Anti-Mouse IgG, Alexa Fluor 555 (Goat) | Thermo Fisher Scientific | Cat#A28180 | IF (1:200) |
| Antibody | Anti-Mouse IgG, Alexa Fluor 555 (Donkey) | Thermo Fisher Scientific | Cat#A31570 | IF (1:200) |
| Antibody | Anti-Rabbit IgG, Alexa Fluor 647 (Goat) | Thermo Fisher Scientific | Cat#A27040 | IF (1:200) |
| Recombinant DNA reagent | pcDNA3.1 (+) Mammalian Expression Vector | Invitrogen | V79020 | |
| Recombinant DNA reagent | T7-NLS hCas9-pA plasmid | Yoshimi et al., 2016 | RIKEN BRC (RDB13130) | |
| Recombinant DNA reagent | pCAG-Flpe | Matsuda and Cepko, 2007 | Addgene (Plasmid #13787) | |
| Recombinant DNA reagent | pT7-Flpe-pA | This paper | RIKEN BRC (RDB16011) | |
| Sequence-based reagent | All primers in Supplementary file 1b | Thermo Fisher Scientific | ||
| Sequence-based reagent | All primers in Supplementary file 1b | Thermo Fisher Scientific | ||
| Sequence-based reagent | Exoc1 PA-C ssODN | Integrated DNA Technologies | GAATTCACTATTCAGGACATTCTGGATTATTGCTCCAGCATCGCACAGTCCCACGGCTCAACCAGCGGATCTGGTAAGCCAGGTAGTGGAGAAGGCAGCACCAAGCCTGGCGGCGTCGCCATGCCTGGAGCCGAGGATGATGTCGTGTAAGCCCTAGGAAAGAGGAGAAAGAAGTGAGCATGCATTCTCAGTCCAGCAAA | |
| Sequence-based reagent | Exoc1 PA-N ssODN | Integrated DNA Technologies | GGAGGGCAGTGGTTTTGAGAATTATTCTAAATGTTTTTCAGCTGAGAAAAGATGGGCGTCGCCATGCCTGGAGCCGAGGATGATGTCGTGGGCTCAACCAGCGGATCTGGTAAGCCAGGTAGTGGAGAAGGCAGCACCAAGCCTGGCACAGCAATCAAGCATGCGCTGCAGAGAGATATCTTCACACCAAATGATGAACG | |
| Software, algorithm | The R Foundation | https://www.r-project.org/foundation/ | ||
| Other | Streptavidin-HRP | Nichirei Biosciences | Cat#426061 | WB (1:1000 in 2% BSA/TBS-T) |
| Other | Lectin from Arachis hypogaea, FITC | Sigma-Adrich | Cat#L7381 | Lectin staining (1:100) |
Additional files
-
Supplementary file 1
Data of differentiating spermatogonia aggregation and primers for genotyping.
(a) Differentiating spermatogonia are not aggregated. Examination of aggregated Kit+ differentiating spermatogonia in adult Exoc1 cKO mice. Aggregation was determined by observation of immunofluorescence images with anti-Kit antibody. (b) Primers for genotyping The following is a list of primers used for genotyping or vector construction.
- https://cdn.elifesciences.org/articles/59759/elife-59759-supp1-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/59759/elife-59759-transrepform-v1.docx
