A bacterial membrane sculpting protein with BAR domain-like activity
- U.S. Army DEVCOM Chemical Biological Center, BioSciences Division, BioChemistry Branch, United States
- Oak Ridge Institute for Science and Education, United States
- University of Southern California, Department of Physics and Astronomy, United States
- Materials and Manufacturing Directorate, Air Force Research Laboratory, Wright-Patterson Air Force Base, United States
- University of Southern California, Department of Biological Sciences, United States
- Center for Bio/Molecular Science and Engineering, Naval Research Laboratory, United States
- California Institute of Technology, Division of Biology and Biological Engineering, United States
- Department of Chemistry and Biochemistry, Brigham Young University, United States
- University of Southern California, Department of Chemistry, United States
Figures
Figure 1 with 1 supplement
Redox active vesicles are enriched with Bin/Amphiphysin/RVS (BAR) domain-like protein BdpA.
(A) Representative cryoelectron tomography image of Shewanella oneidensis MR-1 outer membrane vesicles (OMVs) (scale = 200 nm). (B) Cyclic voltammetry (scan rate of 10 mV/s) of vesicles adhered to …
Figure 1—figure supplement 1
Locations of proteins associated with vesicles and cell outer membrane predicted by PSORTb (CYT = cytoplasm, IM = inner membrane, OM = outer membrane, Peri = periplasm).
Note: There was disagreement between PSORTb and other protein prediction services.
Figure 2 with 3 supplements
BdpA is responsible for maintaining vesicle size but does not alter the combined frequency of cells producing membrane structures.
(A) Outer membrane vesicle (OMV) size distribution by dynamic light scattering (DLS) from the Shewanella oneidensis wild-type (WT) strain (top left, n = 11), deletion strain (ΔbdpA) (middle left, n …
Figure 2—figure supplement 1
Growth of Shewanella oneidensis strains in Luria Bertani (LB) (top) or Shewanella defined medium (SDM) (bottom) in response to DAPG exposure and BdpA induction.
Error bars are standard deviation of three biological replicates (independent cultures).
Figure 2—figure supplement 2
Anaerobic ferrihydrite reduction over time by Shewanella oneidensis strains.
Concentration of Fe(II) was determined by ferrozine assay. Error bars are standard deviation of three biological replicates (independent cultures).
Figure 2—figure supplement 3
Example image of an outer membrane extension (OME) and a large vesicle produced by Shewanella oneidensis ΔbdpA after 3 hr during perfusion flow conditions. Scale = 2 µm.
Figure 3
BdpA promotes outer membrane extension (OME) maturation into ordered tubules.
(A) Fluorescence images of Shewanella oneidensis wild-type (WT) (top), ΔbdpA (middle), and ΔbdpA+ bdpA with 12.5 µM DAPG (bottom) OMEs. Scale = 2 µm. All cells were counted manually and categorized …
Figure 4 with 1 supplement
Heterologous expression of BdpA promotes outer membrane extension (OME) formation.
(A) Induction (1 hr) of BdpA expression with 12.5 µM DAPG during planktonic, non-attached growth results in OME formation in Shewanella oneidensis (left, wild type [WT] + bdpA), Marinobacter …
Figure 4—figure supplement 1
Variability in outer membrane extension (OME) phenotypes following BdpA induction in Marinobacter atlanticus CP1+ bdpA cells. Cells displayed an array of membrane curvature phenotypes, ranging from tubule-like OMEs (A–F), membrane vesicles or blebbing (C,F), and branched, web-like OME/outer membrane vesicle (OMV) chains (F). Frequencies of each phenotype are shown in Figure 4. Scale = 2 µm.
Figure 5 with 1 supplement
Comparative phylogenetic analysis of BdpA with bacterial homologs, membrane curvature-associated bacterial proteins, and eukaryotic Bin/Amphiphysin/RVS (BAR) domains.
Maximum likelihood evolutionary histories were inferred from 1000 bootstrap replicates, and the percentage of trees in which the taxa clustered together is shown next to the branches. Arrows …
Figure 5—figure supplement 1
BdpA has homologs in other bacterial species.
A phylogenetic tree of the 23 Bin/Amphiphysin/RVS (BAR) domain sequences that seed the BAR domain hidden Markov model (HMM) predictions, Shewanella oneidensis BdpA, and conserved BdpA orthologs in …
Videos
Video 1
Epifluorescence time course imaging of a single frame of Shewanella oneidensis wild-type (WT) cells during perfusion flow over a 5 hr duration, collecting images at 5 min intervals.
Scale = 5 µm.
Video 2
Epifluorescence time course imaging of ΔbdpA cells during perfusion flow over a 5 hr duration, collecting images at 5 min intervals.
Scale = 5 µm.
Video 3
Epifluorescence imaging of Shewanella oneidensis wild-type (WT) cells 3 hr post-deposition onto the surface of a chambered cover glass.
Images were collected of a single field of view for a 20 s duration. Scale = 5 µm.
Video 4
Epifluorescence imaging of Shewanella oneidensis ΔbdpA cells 3 hr post-deposition onto the surface of a chambered cover glass.
Images were collected of a single field of view for a 20 s duration. Scale = 5 µm.
Video 5
Epifluorescence imaging of Shewanella oneidensis ΔbdpA+ bdpA cells 3 hr post-deposition onto the surface of a chambered cover glass.
Images were collected of a single field of view for a 20 s duration. Scale = 5 µm.
Video 6
Confocal imaging of Shewanella oneidensis MR-1 p452-bdpA cells after 1 hr planktonic induction of BdpA with 12.5 µM DAPG.
Cells with apparent outer membrane extensions (OMEs) can be seen moving through the field of view. Scale = 5 µm.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Shewanella oneidensis) | bdpA | GenBank | AE014299.2 | locus tag SO_1507 |
| Strain, strain background (S. oneidensis MR-1) | WT | Myers and Nealson, 1988 | Wild type | |
| Strain, strain background (S. oneidensis MR-1) | WT+ pBBR1-mcs2 | This paper | Wild type with the pBBR1-mcs2 empty vector | |
| Strain, strain background (S. oneidensis MR-1) | WT + bdpA | This paper | Wild type with an extra copy of bdpA in trans under inducible control by DAPG on the p452-bdpA plasmid | |
| Strain, strain background (S. oneidensis MR-1) | ΔbdpA | This paper | bdpA scarless deletion | |
| Strain, strain background (S. oneidensis MR-1) | ΔbdpA + pBBR1-mcs2 | This paper | bdpA knockout strain with the pBBR1-mcs2 empty vector | |
| Strain, strain background (S. oneidensis MR-1) | ΔbdpA+ bdpA | This paper | bdpA scarless deletion with bdpA under inducible control by DAPG in the p452-bdpA plasmid | |
| Strain, strain background (S. oneidensis MR-1) | JG1194 (∆Mtr) | Coursolle and Gralnick, 2010 | S. oneidensis with the extracellular electron transfer pathway proteins deleted (ΔmtrC/ΔomcA/ΔmtrF/ΔmtrA/ ΔmtrD/ΔdmsE/ΔSO4360/ΔcctA/ΔrecA) | |
| Strain, strain background (S. oneidensis MR-1) | JG1194 (∆Mtr)+ pBBR1-mcs2 | This paper | White strain harboring the pBBR1-mcs2 empty vector | |
| Strain, strain background (Marinobacter atlanticus CP1) | CP1 | Bird et al., 2018 | Wild type | |
| Strain, strain background (M. atlanticus CP1) | CP1+ bdpA | This paper | Heterologous expression strain of bdpA under inducible control by DAPG from the p452-bdpA plasmid in M. atlanticus CP1 | |
| Strain, strain background (Escherichia coli) | BL21(DE3) | PMID:3537305 | OneShot E. coli BL21(DE3) | |
| Strain, strain background (E. coli) | BL21+ bdpA | This paper | E. coli BL21(DE3) with bdpA under inducible control by DAPG in the p452-bdpA plasmid | |
| Strain, strain background (E. coli) | UQ950 | Saltikov and Newman, 2003 | Cloning strain | |
| Strain, strain background (E. coli) | BW29427 (WM3064) | Saltikov and Newman, 2003 | Conjugation strain | |
| Recombinant DNA reagent | pBBR1-mcs2 (plasmid) | Kovach et al., 1995 | Empty vector | |
| Recombinant DNA reagent | pBBJM (plasmid) | This paper | Cloning backbone | |
| Recombinant DNA reagent | pSMV3 (plasmid) | Simon et al., 1983 | Suicide vector | |
| Recombinant DNA reagent | pBBJM-452 (plasmid) | Yates et al., 2021; Meyer et al., 2019 | Marionette sensor with yellow fluorescent protein (YFP) under inducible control of DAPG in the pBBR1-mcs2 backbone | |
| Recombinant DNA reagent | pSMV3_1507KO (plasmid) | This paper | Contains up- and downstream regions of open reading frame SO_1507 (bdpA) | |
| Recombinant DNA reagent | p452-bdpA (plasmid) | This paper | DAPG inducible bdpA in the pBBJM-452 plasmid instead of YFP | |
| Sequence-based reagent | pAJMF2 | This paper | PCR primers | TTAACGCGAATTTTAACAAAATATTAACGC cccgcttaacgatcgttggctg |
| Sequence-based reagent | pAJMR3 | This paper | PCR primers | AGCGGATAACAATTTCACACAGGAAACAGC Tacctcagataaaatatttgc |
| Sequence-based reagent | pBBRF3 | This paper | PCR primers | gggctcatgagcaaatattttatctgaggt AGCTGTTTCCTGTGTGAAATTG |
| Sequence-based reagent | pBBRR2 | This paper | PCR primers | acccgcgctcagccaacgatcgttaagcggg GCGTTAATATTTTGTTAAAATTCGC |
| Sequence-based reagent | 1507 F_insert | This paper | PCR primers | ttaatactagagaaagaggggaaatactag ATGCGCACCGCTGC |
| Sequence-based reagent | 1507 R_insert | This paper | PCR primers | gaggcctcttttctggaatttggtaccgagC TACATAAAGGCTTTAGTAAAGGCTT |
| Sequence-based reagent | BBJMV_reverse | This paper | PCR primers | CAGCATTGAGATGACTGCAGCGGTGCGCAT ctagtatttcccctctttctctagtat |
| Sequence-based reagent | BBJMV_forward | This paper | PCR primers | AAGGAAGCCTTTACTAAAGCCTTTATGTAG ctcggtaccaaattccagaaaag |
| Sequence-based reagent | pSMV3_R | This paper | PCR primers | GCTAATCCAAAGGGAAACACCACA ATAAACGATCCCCCGGGCTG |
| Sequence-based reagent | pSMV3_F | This paper | PCR primers | Caagacattattgaaattaagcaaagcacacactagttctagagcggccg |
| Sequence-based reagent | bdpAUpstream1kb_F | This paper | PCR primers | tgatatcgaattcctgcagcccgggggatcgtttattgtggtgtttccctttgga |
| Sequence-based reagent | bdpAUpstream1kb_R | This paper | PCR primers | AAGCCCAGTAAACCTTTCTATAACAAGTCGAAAAGCCT CATAAAACATAAATAACATACGAAG |
| Sequence-based reagent | bdpAdwnstream1kb_F | This paper | PCR primers | cgtatgttatttatgttttatgaggcttttcgacttgttatagaaaggtttactggg |
| Sequence-based reagent | bdpAdwnstream1kb_R | This paper | PCR primers | ACCGCGGTGGCGGCCGCTCTAGAACTAGTGTGTGC TTTGCTTAATTTCAATAATGTCTTG |
| Other | FM 4–64 | Invitrogen | T13320 | (0.25 µg/mL) |
Additional files
-
Supplementary file 1
Protein enrichment within the outer membrane vesicle (OMV) proteome relative to the proteome of the Shewanella oneidensis outer membrane (OM).
- https://cdn.elifesciences.org/articles/60049/elife-60049-supp1-v2.xlsx
-
Supplementary file 2
Alignment of BdpA homologs with bacterial membrane curvature associated proteins and eukaryotic Bin/Amphiphysin/RVS (BAR) domains.
- https://cdn.elifesciences.org/articles/60049/elife-60049-supp2-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/60049/elife-60049-transrepform1-v2.docx
