Dynamics of nevus development implicate cell cooperation in the growth arrest of transformed melanocytes
- Center for Complex Biological Systems, University of California, Irvine, United States
- Department of Developmental and Cell Biology, University of California, Irvine, United States
- Department of Dermatology, University of California, Irvine, United States
- Beckman Laser Institute, University of California, Irvine, United States
- Department of Mathematics, University of California, Irvine, United States
- Department of Biological Chemistry, University of California, Irvine, United States
Figures
Figure 1 with 1 supplement
Dynamics of nevus growth.
(A-D) Visualization of nevi on BrafV600E mice. (A) Live imaging of back skin at telogen-stage (P50), following hair depilation. Scale bar = 5 mm. (B) Live imaging of a sample like that in panel A …
Figure 1—figure supplement 1
Dynamics of nevus growth.
(A) Nevus development on the ventral surface of the glabrous paw. Images were taken at the indicated age. (B–C) Identification of dividing or non-dividing melanocytes with the premelanosome protein …
Figure 2 with 1 supplement
Single-cell RNA sequencing of mouse dorsal skin to transcriptionally characterize melanocytes.
(A) Skin cell types are visualized with tSNE (cells = 35,141) from mice at P30 (n[BrafWT]=2 mice, n[BrafV600E]=2 mice) and P50 (n[BrafWT]=3 mice, n[BrafV600E]=3 mice). Melanocytes are outlined with …
Figure 2—figure supplement 1
Single cell RNA sequencing of mouse dorsal skin, to transcriptionally characterize cells.
(A) Heat map depicting the average gene expression of canonical markers for known cell types found in the skin. (B) Using gene expression of the indicated genes to identify cell-type clusters.
Figure 3 with 3 supplements
Gene expression fails to identify nevus melanocytes as senescent.
Transcriptomes of clusters identified in Figure 2 were compared with proposed ‘signatures’ of senescence.( A) Gene expression data for clusters in Figure 2A and B were averaged by cluster and, for …
Figure 3—figure supplement 1
Heat maps for other signatures associated with senescence or proliferation.
The single-cell transcriptomes analyzed in Figure 3 were compared with each of the signatures in Source data 1. (A–D) Summary (A–C) and detailed (D) comparisons for the four melanocytes subclusters. …
Figure 3—figure supplement 2
Comparing proliferation-associated gene expression in cluster 3 (hair follicle) melanocytes from wildtype and Braf-mutant animals.
As shown in Figure 3 and Figure 3—figure supplement 1, Mel 3 melanocytes score higher for expression of proliferation genes (meta-PCNA signature) that those of clusters Mel 0 and Mel 1. Here, …
Figure 3—figure supplement 3
Comparing mouse nevus melanocyte gene expression with effects of BRAFV600E on cultured human melanocytes.
(A-B) In the scatter plots, values on the abscissa are gene expression fold-change data from microarray data of Pawlikowski et al., 2013, comparing gene expression in cultured BrafV600E-transduced …
-
Figure 3—figure supplement 3—source data 1
Data are derived from Table S1 of Pawlikowski et al., 2013, and relate to Figure 3—figure supplement 3.
The data were first converted from Affymetrix probe set IDs to current gene symbols using DAVID (https://david.ncifcrf.gov/). Fold-change data were log2-transformed. When multiple probesets mapped to the same gene, log2-fold changes were averaged, and the lowest FDR value was retained. Human gene symbols were then converted to mouse ortholog symbols (using https://www.genenames.org/ and http://www.informatics.jax.org) wherever unambiguous assignments could be made. ‘BH FDR’=Benjamini Hochberg false discovery rate.
- https://cdn.elifesciences.org/articles/61026/elife-61026-fig3-figsupp3-data1-v1.xlsx
Figure 4 with 1 supplement
Modeling cell-autonomous clonal arrest as a probabilistic process.
(A-D) Monte Carlo simulations were carried out in which a single-cell replicates and arrests with fixed probability, s, per cell cycle. (A) Cell cycles required before proliferation stops in 95% or …
-
Figure 4—source data 1
Raw data used to generate histogram in Figure 4E.
- https://cdn.elifesciences.org/articles/61026/elife-61026-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Size distribution of mouse and human nests.
(A-B) Quantification of nest radii from mice treated with 75 mg/mL of tamoxifen at (A) P21 (mice = 10, nests = 221) or (B) P50 (mice = 18 mice, nests = 428). The black dashed line represents the …
-
Figure 4—figure supplement 1—source data 1
Raw data used to generate histograms in Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/61026/elife-61026-fig4-figsupp1-data1-v1.xlsx
Figure 5 with 1 supplement
Models and evidence for cooperative, feedback-mediated arrest.
(A) A generic integral negative feedback scheme. ‘Renewal probability’, p, is the probability that offspring of cell division remain dividing (i.e. 1−p is the probability that they arrest). (B) …
-
Figure 5—source data 1
Raw data used to generate histograms and permutation tests in Figure 5E–F.
Data are from nests visualized by MPM at postnatal day 21. Analysis was restricted to fields with at least 10 nests.
- https://cdn.elifesciences.org/articles/61026/elife-61026-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Evidence for influence of nevi on each other’s sizes is minimal at long range.
(A–B) The same nest size and location data were analyzed as in Figure 5E–F, except that distributions of mean neighbor sizes up to 150 μm away from (A) large (radius >20 μm) and (B) small (radius <20…
Figure 6
Possible mechanisms of growth arrest.
Three different models of nevus growth arrest are presented, varying from classical OIS (A) to feedback control of proliferative cell renewal (C). The model in the middle panel (B) illustrates a …
Appendix 1—figure 1
Predicting clone sizes at the time of clonal extinction.
(A) Analytical results, under assumptions of different values for the cell-autonomous arrest probability s. (B). A comparison of the analytical results for s = 0.56 with the outcomes of 500,000 …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Braf | Mouse Genome Informatics (MGI) | MGI:88190 | |
| Gene (M. musculus) | Tyr::CreER | MGI | MGI:3641203 | MGI Transgene name: GeneTg(Tyr-cre/ERT2)13Bos |
| Genetic reagent (M. musculus) | B6.Cg-Tg(Tyr-cre/ERT2)13Bos Braftm1Mmcm /BosJ | Dankort et al., 2009 | RRID:MGI:5902125 | |
| Antibody | Anti-Pmel (rabbit monoclonal) | Abcam | Cat#ab137078 RRID:AB_2732921 | Also known as anti-melanoma gp100 IF (1:500) |
| Antibody | Anti-BrdU (rat monoclonal) | Abcam | Cat#ab6326 RRID:AB_305426 | IF (1:500) |
| Antibody | Goat anti-rabbit alexa fluor 594 conjugated (polyclonal) | ThermoFisher Scientific | Cat#A-11012 RRID:AB_2534079 | (1:2000) |
| Antibody | Chicken anti-rat alexa fluor 488 (polyclonal) | ThermoFisher Scientific | Cat#A-21470 RRIB:AB_2535873 | (1:2000) |
| Sequence-based reagent | Braf_F | IDT | PCR primer | 5’-TGAGTATTTTTGTGGCAACTGC −3’ |
| Sequence-based reagent | Braf_R | IDT | PCR primer | 5’-CTCTGCTGGGAAAGCGCC −3’ |
| Sequence-based reagent | Cre_F | IDT | PCR primer | 5’- GGTGTCCAATTTACTGACCGTACA-3’ |
| Sequence-based reagent | Cre_R | IDT | PCR primer | 5’- CGGATCCGCCGCATAACCAGTG −3’ |
| Chemical compound, drug | 4-hydroxytamoxifen | Sigma-Aldrich | Cat#68047-06-3 | |
| Chemical compound, drug | TrueBlack lipofuscin | Biotium | Cat#23007 | |
| Software, algorithm | Mathematica | Wolfram | RRID:SCR_014448 | |
| Software, algorithm | Scanpy | Wolf et al., 2018 | RRID:SCR_018139 | |
| Software, algorithm | Cell Ranger | 10X genomics | RRID:SCR_017344 | |
| Software, algorithm | CompuCell3D | Swat et al., 2012 | RRID:SCR_003052 |
Additional files
-
Source data 1
Gene lists and literature references for gene expression signatures.
- https://cdn.elifesciences.org/articles/61026/elife-61026-data1-v1.xlsx
-
Source data 2
Parameters values used in CompuCell3D modeling.
- https://cdn.elifesciences.org/articles/61026/elife-61026-data2-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/61026/elife-61026-transrepform-v1.docx
