Burst mitofusin activation reverses neuromuscular dysfunction in murine CMT2A
- Department of Internal Medicine, Pharmacogenomics, Washington University School of Medicine, United States
- Department of Cardiology, The First Affiliated Hospital of Xi’an Jiao Tong University, China
- Department of Developmental Biology, Washington University School of Medicine, United States
- Center for Regenerative Medicine, Washington University School of Medicine, United States
- Mossakowski Medical Research Centre, Polish Academy of Sciences, Poland
- Department of Neurology, Washington University School of Medicine, United States
- Department of Neurology, Cedars-Sinai Medical Center, United States
- Department of Neurology, Carver College of Medicine, University of Iowa, United States
Figures
Figure 1 with 3 supplements
Mitochondrial abnormalities in reprogrammed CMT2A patient motor neurons and their improvement after mitofusin activation.
(a) Model structure of MFN2 showing location of CMT2A patient mutations. (b) Schematic depiction of fibroblast reprogramming procedure to produce motor neurons. (c) Mitochondrial testing in …
Figure 1—figure supplement 1
Genotyping of CMT2A patient cells.
Each cell line underwent Sanger sequencing for all 4 MFN2 mutation loci. A representative (of 3) normal control lines is shown. Shaded areas show each mutation locus. Encoded amino acids are on top; …
Figure 1—figure supplement 2
Direct reprogramming of human skin fibroblasts to neurons.
(a) Dual immunolabeling of parental fibroblasts (left) and reprogrammed neurons (right) from normal (top) and CMT2A MFN2 T105M patient (bottom). Red fibroblast-specific protein 1(FSP1) labels …
Figure 1—figure supplement 3
Chemical characteristics and functional profiling of mitofusin activators used in this study.
(a) Chimera C is a member of the original chemical class of mitofusin agonists described in reference 23. (b) MiM111 is the prototype of new chemical class of mitofusin activators having …
Figure 2 with 1 supplement
Characteristics of a neuron-specific MFN2 T105M mouse model of CMT2A.
(a) Schematic depiction Mfn2 <fs-T105M>expression strategy. (b) Immunoblot analysis of MFN2 expression in mouse sciatic nerves. (c) Serial RotaRod latency studies; CMT2A is green squares (n = 16), …
Figure 2—figure supplement 1
Flow cytometric profiling of mitochondrial polarization status in mouse dorsal root ganglion (DRG) neurons.
(a) DRGs from CMT2A MFN2 T105M mice. Left is representative mitochondrial gating by TMRE fluorescence from a single study; green is vehicle; blue is Chimera C (100 nM, 48 hr). Right graph shows …
Figure 3 with 2 supplements
Mitofusin activation reverses neuromuscular dysfunction in MFN2 T105M mice.
(a) Ex vivo mitochondrial motility in CMT2A mouse sciatic nerve axons 4 hr after intramuscular administration of mitofusin activator MiM111 or vehicle. Top panel is kymographs. Bottom panel …
Figure 3—figure supplement 1
In vivo pharmacokinetics and target engagement of MiM111 administered intramuscularly.
(a) Predicted temporal relationship between plasma MiM111 concentration and peripheral nerve mitochondria activation based on published data (reference 25). Green indicates postulated therapeutic …
Figure 3—figure supplement 2
Effects of MiM111 on neuromuscular function in control mice.
(a) RotaRod latency. (b) Neuroelectrophysiologic CMAP amplitude. Each point is a mouse; green is vehicle (n = 3), blue is MiM111 30 mg/kg IM once daily (n = 3). There were no differences (t-test).
Figure 4 with 1 supplement
Mitofusin activation reverses histopathological findings in MFN2 T105M mice.
(a) Toluidine blue stained sections of mouse mid tibial nerves. Arrows show blue-stained damaged axons in CMT2A mice. Quantitative group data for damaged axons and SCG10-regenerating axons (see Figur…
Figure 4—figure supplement 1
Effects of MiM111 on neuromuscular integrity in CMT2A MFN2 T105M mice.
(a) Labeling of regenerating neurons with SCG10 (red). (b) Mitochondria in tibialis muscles of CMT2A mice are normal. Mitochondrial area is quantified from group data on the right. (c) Neuromuscular …
Figure 5 with 2 supplements
Mitofusin activation reverses mitochondrial pathology and stimulates growth of CMT2A dorsal root ganglion neurons in vitro.
(a) Confocal micrographs of CMT2A mouse DRGs cultured for 48 hr with MiM111 or its vehicle. Note greater neuronal process length and branching in MiM111-treated neuron. Exploded insets (right) show …
Figure 5—figure supplement 1
Mitofusin activation with Chimera C reverses mitochondrial pathology and stimulates growth of CMT2A dorsal root ganglion neurons in vitro.
(a) CMT2A mouse DRGs cultured for 48 hr with Chimera C (100 nM) or its vehicle (Me2SO4). Exploded insets show mitochondria expressing mitoDS Red; neuronal processes stained for β-III tubulin are …
Figure 5—figure supplement 2
Time course studies of DRG mitochondria responses to mitofusin activation after aspiration axotomy.
Studies were performed as in Figure 5. *P < 0.05 vs. basal (ANOVA). Three independent studies were performed for each endpoint; each symbol represents the mean value for all three biological …
Figure 6
Mitofusin activation stimulates post-axotomy regrowth of CMT2A cortical neurons in vitro.
(a) Schematic depiction of microfluidic platform. Yellow areas show proximal axon where mitochondrial motility was measured and distal axon where mitochondrial aspect ratio was measured. (b) …
Tables
Table 1
Characteristics and sources of human primary fibroblasts used for motor neuron reprogramming studies.
| Diseases | Mutation | Age | Sex | Passage# | Source | Fibroblast ID |
|---|---|---|---|---|---|---|
| CMT2A | MFN2 Thr105Met | 41 | F | P4-P10 | Dr. Robert H. Baloh | - |
| CMT2A | MFN2 Arg274Trp | 23 | M | P4-P10 | Dr. Barbara Zablocka | - |
| CMT2A | MFN2 His361Tyr | 41 | M | P4-P10 | Dr. Robert H. Baloh | - |
| CMT2A | MFN2 His364Trp | 28 | F | P6-P10 | Dr. Michael E. Shy | - |
| CMT1A | PMP22 DUP | 28 | F | P4-P10 | Coriell Institute | GM05167 |
| CTRL 1 | - | 68 | F | P3-P7 | NINDS | ND34769 |
| CTRL 2 | - | 71 | F | P3-P7 | NINDS | ND36320 |
| CTRL 3 | - | 55 | F | P3-P7 | NINDS | ND29510 |
| CTRL 4 | - | 66 | M | P8-P10 | NINDS | ND29178 |
| CTRL 5 | - | 72 | M | P3-P7 | NINDS | ND34770 |
| CTRL 6 | - | 55 | M | P4-P10 | NINDS | ND38530 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene Mus musculus | Mfn-2 | NCBI Gene | Gene ID: 170731 | MFN2 ENSMUSG00000029020 |
| Gene (Human) | MFN-2 | NCBI Gene | Gene ID: 9927 | MFN2 ENSG00000116688 |
| Genetic reagent (M. musculus) | Rosa-STOP-mMFN Thr105Met (T105M) mice | (C57BL/6 Gt(ROSA) 26 Sortm1 (CAG MFN2*T105M)Dple/) | The Jackson Laboratory: 025322 | C57Bl/6 |
| Genetic reagent M. musculus | HB9-Cre mice | (B6.129S1-Mnx1tm4(cre)Tmj/J) | The Jackson Laboratory : 006600 | C57Bl/6 |
| Genetic reagent M. musculus | C57BL/6J mice | C57Bl/6 | The Jackson Laboratory : 000664 | C57Bl/6 |
| Mfn2 null M. musculus | Mfn2 null MEFs | ATCC | CRL-2994 | Murine embryonic fibroblasts |
| Mfn1/Mfn2 null M. musculus | Mfn1 and Mfn2 double knock out MEFs | ATCC | CRL-2993 | Murine embryonic fibroblasts |
| Mfn1 null M. musculus | Mfn1 null MEFs | ATCC | CRL-2992 | Murine embryonic fibroblasts |
| Cell line (H. sapiens) | Dermal fibroblast (MFN2 T105M) | Dr. Robert H. Baloh (Cedars Sinai) | Female | |
| Cell line (H. sapiens) | Dermal fibroblast (MFN2 H361Y) | Dr. Robert H. Baloh (Cedars Sinai) | Male | |
| Cell line (H. sapiens) | Dermal fibroblast (MFN2 R274W) | Dr. Barbara Zablocka (Mossakowski Med Res Ctr) | PMID:28076385 | Male |
| Cell line (H. sapiens) | Dermal fibroblast (MFN2 R364W) | Dr. Michael E. Shy (University of Iowa) | Female | |
| Cell line (H. sapiens) | Dermal fibroblast (Normal) | NINDS | ND34769 | Female |
| Cell line (H. sapiens) | Dermal fibroblast (Normal) | NINDS | ND36320 | Female |
| Cell line (H. sapiens) | Dermal fibroblast (Normal) | NINDS | ND29510 | Female |
| Transfected construct (Human Adenovirus Type5 (dE1/E3)) | Adenovirus β-galactosidase | Vector Biolabs | Cat#: 1080 | |
| Transfected construct (Human Adenovirus Type5 (dE1/E3)) | Adenovirus Mito-Ds-Red2 | Signagen | Cat#: 12259 | |
| Transfected construct (Human Adenovirus Type5 (dE1/E3)) | Adenovirus Cre-recombinase | Vector Biolabs | Cat#: 1794 | |
| Recombinant DNA reagent | rtTA-N144 (plasmid) | Addgene | Cat#: 66810 | Lentiviral construct to transfect and express the plasmid |
| Recombinant DNA reagent | pTight-9-124-BclxL (plasmid) | Addgene | Cat#: 60857 | Lentiviral construct to transfect and express the plasmid |
| Recombinant DNA reagent | LHX3-N174 and ISL1-N174 (plasmid) | PMID:28886366 | Lentiviral construct to transfect and express the plasmid | |
| Antibody | Anti-Mfn-2 (Mouse monoclonal) | AbCAM | Cat#: ab56889 | (1:1000) |
| Antibody | Anti-COX-IV (Rabbit polyclonal) | AbCAM | Cat#: ab16056 | (1:1000) |
| Antibody | Anti-Stathmin-2 (Rabbit polyclonal) | Novus Biologicals | Cat#: NBP1-49461 | (1:1000) |
| Antibody | Anti-GAPDH (Mouse monoclonal) | AbCAM | Cat#: ab8245 | (1:3000) |
| Antibody | Anti-FSP-1 (Rabbit polyclonal) | Novus Biologicals | Cat#: NBP1-49461 | (1:400) |
| Antibody | Anti-MNX1 (Mouse monoclonal) | DSHB | Cat#: 81.5C10 | (2 µg/ml) |
| Antibody | Anti-β-tubulin III (Mouse monoclonal) | Biolegend | Cat#: 801201 | (1:200) |
| Antibody | Alexa-Fluor 488 (Goat anti-mouse) | ThermoFisher | Cat#: A11029 | (1:400) |
| Antibody | Alexa- Fluor 488 (Goat anti-rabbit) | ThermoFishe | Cat#: A11008 | (1:400) |
| Antibody | (Goat anti-rabbit IgG) | ThermoFisher | Cat#: 31460 | (1:3000) |
| Antibody | Alexa- Fluor 594 (Goat anti rabbit) | ThermoFisher | Cat#: A32740 | (1:400) |
| Antibody | (Peroxidase-conjugated anti-mouse IgG) | Cell Signaling | Cat#: 7076S | (1:3000) |
| Antibody | (α-Bungarotoxin Alexa flour 594) | ThermoFisher | Cat#: B12423 | (0.5 μg/ml) |
| Sequence-based reagent | HB9CRE Fw | The Jackson Laboratory | 006600 | CTAGGCCACAGAATTGAAAGATCT |
| Sequence-based reagent | HB9CRE Rv | The Jackson Laboratory | 006600 | GTAGGTGGAAATTCTAGCATCATCC |
| Sequence-based reagent | HB9CRE TG Fw | The Jackson Laboratory | 006600 | GCGGTCTGGCAGTAAAAACTATC |
| Sequence-based reagent | HB9CRE TG Rv | The Jackson Laboratory | 006600 | GTGAAACAGCATTGCTGTCACTT |
| Sequence-based reagent | Mfn2 T105M M Fw | The Jackson Laboratory | 025322 | GACCCCGTTACCACAGAAGA |
| Sequence-based reagent | Mfn2 T105M M Rv | The Jackson Laboratory | 025322 | AACTTTGTCCCAGAGCATGG |
| Sequence-based reagent | Mfn2 T105M Wt Fw | The Jackson Laboratory | 025322 | AAGGGAGCTGCAGTGGAGTA |
| Sequence-based reagent | Mfn2 T105M Wt Rv | The Jackson Laboratory | 025322 | CCGAAAATCTGTGGGAAGTC |
| Sequence-based reagent | MFN2 T105M Fw | This paper | PCR primers for cell line mutation validation | TTGCACTGAATAGGGCTTTG |
| Sequence-based reagent | MFN2 T105M Rv | This paper | PCR primers for cell line mutation validation | CATTCACCTCCACAGGGTG |
| Sequence-based reagent | MFN2 R274W Fw | This paper | PCR primers for cell line mutation validation | CGTGGTAGGTGTCTACAAGAAGC |
| Sequence-based reagent | MFN2 R274W Rv | This paper | PCR primers for cell line mutation validation | CTGGTGAGGGCTGATGAAAT |
| Sequence-based reagent | MFN2 H361Y and R364W Fw | This paper | PCR primers for cell line mutation validation | CCTGGCAGTGAAAACCAGAG |
| Sequence-based reagent | MFN2 H361Y and R364W Rv | This paper | PCR primers for cell line mutation validation | AAGGCGTGTCCTAACTGCC |
| Chemical compound, drug | Trans-MiM111 | Mitochondria in Motion, Inc | Cpd 13b in PMID:32506913 | |
| Chemical compound, drug | Chimera C | Paraza Pharma | Cpd 2 in PMID:32506913 | |
| Chemical compound, drug | Papain | Sigma | Cat#: P4762 | |
| Chemical compound, drug | Laminin | Sigma | Cat#: L2020 | |
| Chemical compound, drug | Poly-d-Lysine | Sigma | Cat#: P7886 | |
| Chemical compound, drug | Poly-ornithine | Sigma-Aldrich | Cat#: P4957 | |
| Chemical compound, drug | Fibronectin | Sigma-Aldrich | Cat#: F4759 | |
| Chemical compound, drug | Polybrene | Sigma-Aldrich | Cat#: H9268 | |
| Chemical compound, drug | Doxycycline | Sigma-Aldrich | Cat#: D9891 | |
| Chemical compound, drug | G418/Geneticin | Invitrogen | Cat#: 10131-035 | |
| Chemical compound, drug | Retinoic Acid | Sigma | Cat#: R2625 | |
| Chemical compound, drug | BDNF, NT-3, CNTF, GDNF | Peprotech | Cat#: 450-02, Cat#: 450-03, Cat#: 450-13, Cat#: 450-10 | |
| Chemical compound, drug | Dibutyryl cAMP | Sigma | Cat#: D0627 | |
| Chemical compound, drug | Valproic acid | Sigma | Cat#: 676380 | |
| Chemical compound, drug | Puromycin | Invitrogen | Cat#: A11138-03 | |
| Chemical compound, drug | Collagenase | Worthington Biochemical | Cat#: 41J12861 | |
| Chemical compound, drug | (2-Hydroxypropyl)-β-cyclodextrin | Sigma | Cat#: 332607 | |
| Chemical compound, drug | Carbonyl cyanide-p-trifluoromethoxyphenyl hydrazone | Sigma | Cat#: C2759 | |
| Chemical compound, drug | B27 supplement | Gibco | Cat#: 17504-044 | |
| Chemical compound, drug | Insulin-transferrin-sodium selenite | Sigma | Cat#: 1884 | |
| Chemical compound, drug | Glucose | Sigma | Cat#: G5767 | |
| Chemical compound, drug | L-glutamine | Gibco | Cat#: 25030-149 | |
| Chemical compound, drug | Goat serum | Jackson Immunoresearch | Cat#: 005-000121 | |
| Chemical compound, drug | Glutaraldehyde | Electron Microscopy Science | Cat#: 16216 | |
| Chemical compound, drug | MitoTracker Green | Thermo Fisher | Cat#: M7514 | |
| Chemical compound, drug | Calcein AM | Thermo Fisher | Cat#: C3100MP | |
| Chemical compound, drug | Hoechst | Thermo Fisher | Cat#: H3570 | |
| Chemical compound, drug | MitoTracker Orange | Thermo Fisher | Cat#: M7510 | |
| Chemical compound, drug | Tetramethylrhodamine ethyl ester | Thermo Fisher | Cat#: T-669 | |
| Software, algorithm | ImageJ | C. A. Schneider | https://imagej.net/Sholl_Analysis | |
| Software, algorithm | Viasys Healthcare Nicolet Biomedical instrument with Viking Quest version 11.2 software | Middleton | Cat#: OL060954 | |
| Software, algorithm | Gallios instrument with FlowJo 10 software | Beckman Coulter | N/A | |
| Other | RotaRod | Ugo Basile | Cat#: 47650 | |
| Other | XonaChips | Xona Microfluidics | Cat#: XC450 |
