1. Cancer Biology
  2. Genetics and Genomics

Loss of FLCN-FNIP1/2 induces a non-canonical interferon response in human renal tubular epithelial cells

  1. Iris E Glykofridis  Is a corresponding author
  2. Jaco C Knol
  3. Jesper A Balk
  4. Denise Westland
  5. Thang V Pham
  6. Sander R Piersma
  7. Sinéad M Lougheed
  8. Sepide Derakhshan
  9. Puck Veen
  10. Martin A Rooimans
  11. Saskia E van Mil
  12. Franziska Böttger
  13. Pino J Poddighe
  14. Irma van de Beek
  15. Jarno Drost
  16. Fried JT Zwartkruis
  17. Renee X de Menezes
  18. Hanne EJ Meijers-Heijboer
  19. Arjan C Houweling
  20. Connie R Jimenez  Is a corresponding author
  21. Rob MF Wolthuis  Is a corresponding author
  1. Amsterdam UMC, location VUmc, Vrije Universiteit Amsterdam, Clinical Genetics, Cancer Center Amsterdam, Netherlands
  2. Amsterdam UMC, location VUmc, Vrije Universiteit Amsterdam, Medical Oncology, Cancer Center Amsterdam, Netherlands
  3. University Medical Center Utrecht, Center for Molecular Medicine, Molecular Cancer Research, Universiteitsweg, Netherlands
  4. Princess Máxima Center for Pediatric Oncology, Oncode Institute, Heidelberglaan, Netherlands
  5. Amsterdam UMC, location VUmc, Vrije Universiteit Amsterdam, Clinical Genetics, Netherlands
  6. NKI-AvL, Biostatistics Unit, Netherlands
https://doi.org/10.7554/eLife.61630
Share this article
Cite this article
  1. Iris E Glykofridis
  2. Jaco C Knol
  3. Jesper A Balk
  4. Denise Westland
  5. Thang V Pham
  6. Sander R Piersma
  7. Sinéad M Lougheed
  8. Sepide Derakhshan
  9. Puck Veen
  10. Martin A Rooimans
  11. Saskia E van Mil
  12. Franziska Böttger
  13. Pino J Poddighe
  14. Irma van de Beek
  15. Jarno Drost
  16. Fried JT Zwartkruis
  17. Renee X de Menezes
  18. Hanne EJ Meijers-Heijboer
  19. Arjan C Houweling
  20. Connie R Jimenez
  21. Rob MF Wolthuis
(2021)
Loss of FLCN-FNIP1/2 induces a non-canonical interferon response in human renal tubular epithelial cells
eLife 10:e61630.
https://doi.org/10.7554/eLife.61630
  2. Download BibTeX
  3. Download .RIS
9 figures, 2 tables and 3 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
Renal proximal tubular epithelial cells as a model for FLCN loss.

(A) Brightfield images (×50 magnification) of a human renal proximal tubular epithelial cell model (RPTEC/TERT1). Left image shows 2D culture of cells with typical dome formation. Right image shows …

Figure 1—figure supplement 1
Download asset Open asset
Characterization of TP53KO and FLCNKO cell lines.

(A) Sanger sequence chromatograms of genomic DNA isolated from each modified RPTEC cell line. Indel analysis was performed with the on-line Inference of CRISPR Editing (ICE) tool of Synthego. Left …

Figure 2 with 2 supplements
Download asset Open asset
Integrated transcriptomic and proteomic analyses of renal tubular FLCN loss.

(A) Schematic overview of transcriptomic and proteomic workflows. (B) Volcano plot showing significantly increased or decreased expression of genes in FLCNPOS vs. FLCNNEG comparison derived from …

Figure 2—figure supplement 1
Download asset Open asset
Comparative analyses of RPTEC FLCNPOS vs. FLCNNEG cell line pairs.

(A) FLCNPOS and FLCNNEG RPTEC cell lines used for RNAseq. To correct for possible clonal effects on global transcription levels, three single-cell clones (C1, C2, and C3 respectively, derived from …

Figure 2—figure supplement 2
Download asset Open asset
GeLC-MS/MS-based proteomics of RPTEC FLCNPOS vs. FLCNNEG cell line pairs.

(A) Cell lines used as input lysates for proteomic analyses FLCNPOS vs. FLCNNEG RPTECs. (B) Coomassie staining of gel containing samples for proteomic analyses, 5-band fractionation, two technical …

Figure 3 with 1 supplement
Download asset Open asset
FLCN loss results in upregulation of subset of TFE target genes.

(A) Heat map showing k-means Pearson correlation clustering of TMM-normalized RNAseq data of FLCNpos versus FLCNneg RPTECs. We analyzed published TFEB/TFE3 target genes. Yellow boxed cluster three …

Figure 3—source data 1

Raw qRT-PCR values and fold change calculations belonging to Figure 3B and D and Figure —figure supplement 1C.

https://cdn.elifesciences.org/articles/61630/elife-61630-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Download asset Open asset
Comparative analyses of RPTEC FLCNPOS vs. FLCNNEG cell line pairs and validations of TP53WT FLCNKO RPTEC cell line.

(A) Similar volcano plots are shown as described in Figure 2B and C, while here the most significant genes for RNA (p-value<1 ~ E-25) and protein (p-value<1E-5) are annotated. Statistical details …

Figure 4
Download asset Open asset
mTOR localization and signaling in response to starvation does not change upon FLCN loss in RPTEC.

(A) To detect changes in canonical mTOR signaling, phosphorylation levels of S6 kinase (S6K_T389) and AKT/PKB (PKB_S473) and total protein levels of S6K, AKT/PKB, 4E-BP1 were assessed by western …

Figure 5
Download asset Open asset
Gene set enrichment analysis reveals FLCN-dependent biological processes.

(A) For Gene Set Enrichment Analysis (GSEA) genes or proteins were ranked based on p‐values, with genes/proteins that are expressed significantly higher in FLCNNEG RPTECs shown on top of the list …

Figure 6 with 1 supplement
Download asset Open asset
Identification of regulatory elements activated by FLCN loss in RPTEC and BHD tumors.

(A) Identification of transcriptional regulatory elements associated with loss of FLCN expression. Regulons were identified by iRegulon (Janky et al., 2014), using an input a list of differential …

Figure 6—figure supplement 1
Download asset Open asset
Extended GSEA and iRegulon analysis of FLCN loss in RPTEC and BHD tumors.

(A) For Gene Set Enrichment Analysis (GSEA) genes or proteins were ranked based on p‐values, with genes/proteins significantly higher expressed in FLCNNEG RPTEC on top of the list (hallmark gene …

Figure 6—figure supplement 1—source data 1

Raw qRT-PCR values and fold change calculations belonging to Figure 6—figure supplement 1C.

https://cdn.elifesciences.org/articles/61630/elife-61630-fig6-figsupp1-data1-v2.xlsx
Figure 7 with 1 supplement
Download asset Open asset
Inactivation of the FLCN-FNIP1/2 axis activates STAT2 in renal cells.

(A) qRT-PCR levels of genes with ISRE or E-box motif in FNIP1POS/FNIP2POS and FNIP1NEG/FNIP2NEG RPTEC cells reveal that the identified FLCN-dependent gene signature is also induced upon loss of FLCN …

Figure 7—source data 1

Raw qRT-PCR values and fold change calculations belonging to 7A, 7B and 7E.

https://cdn.elifesciences.org/articles/61630/elife-61630-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Download asset Open asset
Validation of FLCNs role in the IFN response in additional cell models.

(A) Validation of FNIP1/FNIP2 knock out in RPTEC/TERT1 tet-on Cas9 TP53KO cells by FNIP1 and FNIP2 sequencing and immunoblotting. Sanger sequence chromatograms of genomic DNA isolated from FNIP1wt …

Figure 8 with 1 supplement
Download asset Open asset
FLCN loss induces an interferon signature which counteracts growth promoting effects of active TFE3 in renal tubular cells.

(A) Expression of a constitutively active SFPQ-TFE3 fusion protein in RPTEC results in upregulation of E-box-associated targets but does not induce enhanced expression of ISRE-associated genes. FLCNK…

Figure 8—source data 1

Raw qRT-PCR values and fold change calculations belonging to Figure 8A and Figure 8—figure supplement 1C and D.

https://cdn.elifesciences.org/articles/61630/elife-61630-fig8-data1-v2.xlsx
Figure 8—figure supplement 1
Download asset Open asset
Creation and validation of FLCNNEG and SFPQ-TFE3 RPTECs.

(A) Validation of FLCN knock out in RPTEC by sequencing. Alignment of Sanger sequence chromatograms of FLCNWT and FLCNKO RPTEC cell line reveals homozygous deletion of 59 nucleotides in the diploid …

Scheme 1
Download asset Open asset
Growth curves of FLCNKO and TP53KO with the fitted curves.

Tables

Table 1
Estimated values and p-value of the random intercept model.
EstimateStandard errorp-Value
β0 (FLCNKO at time 0)1.414 × 1051.079 × 1050.215
β1 (Time)−1.222 × 1041.966 × 1035.07 × 10−10
β2 (Time2)1.284 × 1021.138 × 101<2×10−16
β3 (TP53KO)−1.080 × 1051.462 × 1050.477
(interaction between Time and TP53KO)6.262 × 1039.641 × 1028.31 × 10−11
σb21.506 × 1010
σε26.238 × 1010
Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Homo sapiens)FLCNHUGO Gene Nomenclature CommitteeHGNC:27310
Gene (Homo sapiens)FNIP1HUGO Gene Nomenclature CommitteeHGNC:29418
Gene (Homo sapiens)FNIP2HUGO Gene Nomenclature CommitteeHGNC:29280
Gene (Homo sapiens)TFE3HUGO Gene Nomenclature CommitteeHGNC:11752
Gene (Homo sapiens)TFEBHUGO Gene Nomenclature CommitteeHGNC:11753
Gene (Homo sapiens)STAT1HUGO Gene Nomenclature CommitteeHGNC:11362
Gene (Homo sapiens)STAT2HUGO Gene Nomenclature CommitteeHGNC:11363
Cell line (Homo sapiens)RPE-1 tet on Cas9 TP53KOBenedict et al., 2020PMID:32084359Originally derived from hTERT RPE-1 (ATCC Cat# CRL-4000, RRID:CVCL_4388)
Cell line (Homo sapiens)RPE tet on Cas9 TP53KO FLCNKO C2This paperknock out cell lines, see Material and methods section CRISPR/Cas9 gene editing
Cell line (Homo sapiens)RPTEC/TERT1ATCCATCC Cat# CRL-4031,
RRID:CVCL_K278
Cell line (Homo sapiens)- RPTEC tet on Cas9
- RPTEC tet on Cas9 TP53KO(pool and three clones)
- RPTEC tet on Cas9 TP53KO FLCNKO C1-3
- RPTEC RPTEC tet on Cas9 TP53wt FLCNKO
- RPTEC tet on Cas9 FNIP1/FNIP2KO
- RPTEC FLCNKO		This paperknock out cell lines, see Material and methods section CRISPR/Cas9 gene editing
Cell line (Homo sapiens)- RPTEC SFPQ-TFE3
- RPTEC SFPQ-TFE3 FLCNKO		This paperLentivirally transduced SFPQ-TFE3 mutant, with and without CRISPR mediated FLCN knock out
Sequenced-based reagent (human)siRNA STAT1Dharmacon, Horizon discoveryL-003543-00-0005siRNA pool used for gene knock down experiments
Sequenced-based reagent (human)siRNA STAT2Dharmacon, Horizon discoveryL-012064-00-0005siRNA pool used for gene knock down experiments
Sequenced-based reagent (human)siRNA TFEBDharmacon, Horizon discoveryL-009798-00-0005siRNA pool used for gene knock down experiments
Sequenced-based reagent (human)siRNA TFE3Dharmacon, Horizon discoveryL-009363-00-0005siRNA pool used for gene knock down experiments
Sequenced-based reagent (human)siRNA non-targeting controlDharmacon, Horizon discoveryD-001210-04-05siRNA pool used for gene knock down experiments
Transfected construct (human)pLenti CMVie-IRES-BlastR FLCN cDNAThis paperFLCN rescue by overexpression of cDNA in Addgene plasmid #119863 (Puleo et al., 2019)
Transfected construct (human)pLKO-Ubc SFPQ-TFE3Fumagalli et al., 2017PMID:28270604Patient derived SFPQ-TFE3 fusion sequence transduced in RPTEC
Sequenced-based reagent (Homo sapiens)crRNA FLCN_exon 5 (GTGGCTGACGTATTTAATGG)Dharmacon, Horizon DiscoverySynthetic gRNA for CRISPR/Cas9 mediated gene knock out
Sequenced-based reagent (Homo sapiens)crRNA FLCN_exon 7 (TGTCAGCGATGTCAGCGAGC)Dharmacon, Horizon DiscoverySynthetic gRNA for CRISPR/Cas9 mediated gene knock out
Sequenced-based reagent (Homo sapiens)crRNATP53_exon 4 (CCATTGTTCAATATCGTCCG)Dharmacon, Horizon DiscoverySynthetic gRNA for CRISPR/Cas9 mediated gene knock out
Sequenced-based reagent (Homo sapiens)crRNA FNIP1_exon 2 (GATATACAATCAGTCGAATC)Dharmacon, Horizon DiscoverySynthetic gRNA for CRISPR/Cas9 mediated gene knock out
Sequenced-based reagent (Homo sapiens)crRNA FNIP2_exon 3 (GATGGTTGTACCTGGTACTT)Dharmacon, Horizon DiscoverySynthetic gRNA for CRISPR/Cas9 mediated gene knock out
Sequenced-based reagent (Homo sapiens)FLCN_exon 4 GAGAGCCACGAUGGCAUUCA + modified EZ scaffoldSynthegoSynthetic gRNA for CRISPR/Cas9 mediated gene knock out
Biological sample (Homo sapiens)BHD kidney tumor 1This paperBHD T1 sample for mass spectrometry, see Material and methods section Patient material
Biological sample (Homo sapiens)BHD kidney tumor 2This paperBHD T2 sample for mass spectrometry, see Material and methods section Patient material
Biological sample (Homo sapiens)Human kidney lysate 1Novus BioNB820-59231HK1 sample for mass spectrometry
Biological sample (Homo sapiens)Human kidney lysate 2Santa Cruzsc-363764HK2 sample for mass spectrometry
Antibodies (for westerns)Vinculin (mouse mAb, H-10)Santa Cruzsc-25336(1:1000)
FLCN (rabbit mAb, D14G9)Cell SignallingCST 3697S(1:1000)
Cas9 (mouse mAb, 7A9)EpigentekA-9000–050(1:1000)
AQP1 (mouse mAb, B11)Santa Cruzsc-25287(1:100)
GPNMB (goat pAb)R and D systemsAF2550-SP(0.5 µg/mL)
SQSTM1 (mouse mAb, D5L7G)
Cell SignallingCST 88588(1:1000)
RRAGD (rabbit pAb)Cell SignallingCST 4470S(1:1000)
FNIP1 (rabbit mAb)Abcamab134969(1:1000)
FNIP2 (rabbit pAb)Atlas AntibodiesHPA042779
(1:1000)
STAT2 (rabbit pAb)
GeneTex
GTX103117
(1:1000)
pSTAT1 Y701 (rabbit mAb, D4A7)
Cell SignallingCST 7649S
(1:1000)
TFE3 (rabbit pAb)
Atlas AntibodiesHPA023881
(1:1000)
H3 (rabbit pAb)
Cell Signalling
CST 9715S
(1:1000)
αTubulin (mouse mAb, B-5-1-2)

Santa Cruz
sc-23948
(1:2000)
p70S6Kinase T389 (rabbit pAb)
Cell Signalling
CST 9205
(1:1000)
pAKT S473 (rabbit mAb, D9E)
Cell Signalling
CST 4060
(1:2000)
total p70S6K (rabbit mAb, 49D7)Cell Signalling
CST 2708
(1:1000)
panAKT (mouse mAb 40D4)Cell Signalling
CST 2920
(1:2000)
4E-BP1 (rabbit mAb 53H11)
Cell Signalling
CST 9644
(1:1000)
GAPDH (mouse mAb, 0411)
Santa Cruzsc-47724
(1:5000)
GAPDH (mouse mAb, 6C5)Merck MilliporeMAB374(1:200)
Antibodies (for immunofluorescence)mTOR (rabbit mAb, 7C10),Cell SignallingCST 2983(1:300)
Lamp2 (mouse mAb, H4B4)Abcamab25631(1:400)
TFE3 (rabbit pAb)Cell SignallingCST 14779(1:300)
Sequence-based reagentqRT-PCR and sequencing primersSigma-AldrichDescribed in corresponding material and method sections
Commercial assay or kitLenti-X Tet-On 3G Inducible Expression SystemClontech, Takara Bio631187Creation of lentiviral constructs to generate Doxycycline inducible Cas9 cell line
Commercial assay or kitHigh Pure RNA Isolation KitRoche11828665001RNA isolation kit for RNAseq and qRT-PCR analyses
Commercial assay or kitiScript cDNA Synthesis KitBio-Rad170–8891cDNA synthesis kit for qRT-PCR analyses
Commercial assay or kitIFN-γ Flex Set CBABD Biosciences560111Flow cytometry based Cytometric bead array
Commercial assay or kitVeriKine-HS Human IFN-α All Subtype ELISA kitPBL assay science41115IFN-α Enzyme-Linked Immunosorbent Assay
Chemical compound, drugCrystal Violet1014080025Stain clonogeniticy using a (0,05% solution)
Software, algorithmR/RstudioedgeR (Robinson et al., 2010) ggplot (Wickham, 2016)
Software, algorithmCytoscapeShannon et al., 2003PMID:14597658iRegulon
BinGO
ClusterOne v1.0 (Nepusz et al., 2012)
Software, algorithmGSEA MSigDBSubramanian et al., 2005
Liberzon et al., 2011		PMID:16199517
PMID:26771021		Gene set enrichment analyses
Software, algorithmGraphPad PrismRRID:SCR_002798Rel. 8.2.2, plots and graph design
Software, algorithmAxioVision SE64Carl ZeissRel. 4.9.1Microscope camera software

Additional files

Supplementary file 1

Table showing differential expression analyses of FLCNPOS versus FLCNNEG RPTECs on RNA and protein level.

https://cdn.elifesciences.org/articles/61630/elife-61630-supp1-v2.xlsx
Supplementary file 2

Table showing subset of TFE3 targets upregulated in FLCNNEG RPTEC (cluster 3, boxed yellow in Figure 3A).

https://cdn.elifesciences.org/articles/61630/elife-61630-supp2-v2.xlsx
Transparent reporting form
https://cdn.elifesciences.org/articles/61630/elife-61630-transrepform-v2.docx

Download links