(A) Brightfield images (×50 magnification) of a human renal proximal tubular epithelial cell model (RPTEC/TERT1). Left image shows 2D culture of cells with typical dome formation. Right image shows …
(A) Sanger sequence chromatograms of genomic DNA isolated from each modified RPTEC cell line. Indel analysis was performed with the on-line Inference of CRISPR Editing (ICE) tool of Synthego. Left …
(A) Schematic overview of transcriptomic and proteomic workflows. (B) Volcano plot showing significantly increased or decreased expression of genes in FLCNPOS vs. FLCNNEG comparison derived from …
(A) FLCNPOS and FLCNNEG RPTEC cell lines used for RNAseq. To correct for possible clonal effects on global transcription levels, three single-cell clones (C1, C2, and C3 respectively, derived from …
(A) Cell lines used as input lysates for proteomic analyses FLCNPOS vs. FLCNNEG RPTECs. (B) Coomassie staining of gel containing samples for proteomic analyses, 5-band fractionation, two technical …
(A) Heat map showing k-means Pearson correlation clustering of TMM-normalized RNAseq data of FLCNpos versus FLCNneg RPTECs. We analyzed published TFEB/TFE3 target genes. Yellow boxed cluster three …
Raw qRT-PCR values and fold change calculations belonging to Figure 3B and D and Figure —figure supplement 1C.
(A) Similar volcano plots are shown as described in Figure 2B and C, while here the most significant genes for RNA (p-value<1 ~ E-25) and protein (p-value<1E-5) are annotated. Statistical details …
(A) To detect changes in canonical mTOR signaling, phosphorylation levels of S6 kinase (S6K_T389) and AKT/PKB (PKB_S473) and total protein levels of S6K, AKT/PKB, 4E-BP1 were assessed by western …
(A) For Gene Set Enrichment Analysis (GSEA) genes or proteins were ranked based on p‐values, with genes/proteins that are expressed significantly higher in FLCNNEG RPTECs shown on top of the list …
(A) Identification of transcriptional regulatory elements associated with loss of FLCN expression. Regulons were identified by iRegulon (Janky et al., 2014), using an input a list of differential …
(A) For Gene Set Enrichment Analysis (GSEA) genes or proteins were ranked based on p‐values, with genes/proteins significantly higher expressed in FLCNNEG RPTEC on top of the list (hallmark gene …
Raw qRT-PCR values and fold change calculations belonging to Figure 6—figure supplement 1C.
(A) qRT-PCR levels of genes with ISRE or E-box motif in FNIP1POS/FNIP2POS and FNIP1NEG/FNIP2NEG RPTEC cells reveal that the identified FLCN-dependent gene signature is also induced upon loss of FLCN …
Raw qRT-PCR values and fold change calculations belonging to 7A, 7B and 7E.
(A) Validation of FNIP1/FNIP2 knock out in RPTEC/TERT1 tet-on Cas9 TP53KO cells by FNIP1 and FNIP2 sequencing and immunoblotting. Sanger sequence chromatograms of genomic DNA isolated from FNIP1wt …
(A) Expression of a constitutively active SFPQ-TFE3 fusion protein in RPTEC results in upregulation of E-box-associated targets but does not induce enhanced expression of ISRE-associated genes. FLCNK…
Raw qRT-PCR values and fold change calculations belonging to Figure 8A and Figure 8—figure supplement 1C and D.
(A) Validation of FLCN knock out in RPTEC by sequencing. Alignment of Sanger sequence chromatograms of FLCNWT and FLCNKO RPTEC cell line reveals homozygous deletion of 59 nucleotides in the diploid …
Estimate | Standard error | p-Value | |
---|---|---|---|
(FLCNKO at time 0) | 1.414 × 105 | 1.079 × 105 | 0.215 |
(Time) | −1.222 × 104 | 1.966 × 103 | 5.07 × 10−10 |
(Time2) | 1.284 × 102 | 1.138 × 101 | <2×10−16 |
(TP53KO) | −1.080 × 105 | 1.462 × 105 | 0.477 |
(interaction between Time and TP53KO) | 6.262 × 103 | 9.641 × 102 | 8.31 × 10−11 |
1.506 × 1010 | |||
6.238 × 1010 |
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (Homo sapiens) | FLCN | HUGO Gene Nomenclature Committee | HGNC:27310 | |
Gene (Homo sapiens) | FNIP1 | HUGO Gene Nomenclature Committee | HGNC:29418 | |
Gene (Homo sapiens) | FNIP2 | HUGO Gene Nomenclature Committee | HGNC:29280 | |
Gene (Homo sapiens) | TFE3 | HUGO Gene Nomenclature Committee | HGNC:11752 | |
Gene (Homo sapiens) | TFEB | HUGO Gene Nomenclature Committee | HGNC:11753 | |
Gene (Homo sapiens) | STAT1 | HUGO Gene Nomenclature Committee | HGNC:11362 | |
Gene (Homo sapiens) | STAT2 | HUGO Gene Nomenclature Committee | HGNC:11363 | |
Cell line (Homo sapiens) | RPE-1 tet on Cas9 TP53KO | Benedict et al., 2020 | PMID:32084359 | Originally derived from hTERT RPE-1 (ATCC Cat# CRL-4000, RRID:CVCL_4388) |
Cell line (Homo sapiens) | RPE tet on Cas9 TP53KO FLCNKO C2 | This paper | knock out cell lines, see Material and methods section CRISPR/Cas9 gene editing | |
Cell line (Homo sapiens) | RPTEC/TERT1 | ATCC | ATCC Cat# CRL-4031, RRID:CVCL_K278 | |
Cell line (Homo sapiens) | - RPTEC tet on Cas9 - RPTEC tet on Cas9 TP53KO(pool and three clones) - RPTEC tet on Cas9 TP53KO FLCNKO C1-3 - RPTEC RPTEC tet on Cas9 TP53wt FLCNKO - RPTEC tet on Cas9 FNIP1/FNIP2KO - RPTEC FLCNKO | This paper | knock out cell lines, see Material and methods section CRISPR/Cas9 gene editing | |
Cell line (Homo sapiens) | - RPTEC SFPQ-TFE3 - RPTEC SFPQ-TFE3 FLCNKO | This paper | Lentivirally transduced SFPQ-TFE3 mutant, with and without CRISPR mediated FLCN knock out | |
Sequenced-based reagent (human) | siRNA STAT1 | Dharmacon, Horizon discovery | L-003543-00-0005 | siRNA pool used for gene knock down experiments |
Sequenced-based reagent (human) | siRNA STAT2 | Dharmacon, Horizon discovery | L-012064-00-0005 | siRNA pool used for gene knock down experiments |
Sequenced-based reagent (human) | siRNA TFEB | Dharmacon, Horizon discovery | L-009798-00-0005 | siRNA pool used for gene knock down experiments |
Sequenced-based reagent (human) | siRNA TFE3 | Dharmacon, Horizon discovery | L-009363-00-0005 | siRNA pool used for gene knock down experiments |
Sequenced-based reagent (human) | siRNA non-targeting control | Dharmacon, Horizon discovery | D-001210-04-05 | siRNA pool used for gene knock down experiments |
Transfected construct (human) | pLenti CMVie-IRES-BlastR FLCN cDNA | This paper | FLCN rescue by overexpression of cDNA in Addgene plasmid #119863 (Puleo et al., 2019) | |
Transfected construct (human) | pLKO-Ubc SFPQ-TFE3 | Fumagalli et al., 2017 | PMID:28270604 | Patient derived SFPQ-TFE3 fusion sequence transduced in RPTEC |
Sequenced-based reagent (Homo sapiens) | crRNA FLCN_exon 5 (GTGGCTGACGTATTTAATGG) | Dharmacon, Horizon Discovery | Synthetic gRNA for CRISPR/Cas9 mediated gene knock out | |
Sequenced-based reagent (Homo sapiens) | crRNA FLCN_exon 7 (TGTCAGCGATGTCAGCGAGC) | Dharmacon, Horizon Discovery | Synthetic gRNA for CRISPR/Cas9 mediated gene knock out | |
Sequenced-based reagent (Homo sapiens) | crRNATP53_exon 4 (CCATTGTTCAATATCGTCCG) | Dharmacon, Horizon Discovery | Synthetic gRNA for CRISPR/Cas9 mediated gene knock out | |
Sequenced-based reagent (Homo sapiens) | crRNA FNIP1_exon 2 (GATATACAATCAGTCGAATC) | Dharmacon, Horizon Discovery | Synthetic gRNA for CRISPR/Cas9 mediated gene knock out | |
Sequenced-based reagent (Homo sapiens) | crRNA FNIP2_exon 3 (GATGGTTGTACCTGGTACTT) | Dharmacon, Horizon Discovery | Synthetic gRNA for CRISPR/Cas9 mediated gene knock out | |
Sequenced-based reagent (Homo sapiens) | FLCN_exon 4 GAGAGCCACGAUGGCAUUCA + modified EZ scaffold | Synthego | Synthetic gRNA for CRISPR/Cas9 mediated gene knock out | |
Biological sample (Homo sapiens) | BHD kidney tumor 1 | This paper | BHD T1 sample for mass spectrometry, see Material and methods section Patient material | |
Biological sample (Homo sapiens) | BHD kidney tumor 2 | This paper | BHD T2 sample for mass spectrometry, see Material and methods section Patient material | |
Biological sample (Homo sapiens) | Human kidney lysate 1 | Novus Bio | NB820-59231 | HK1 sample for mass spectrometry |
Biological sample (Homo sapiens) | Human kidney lysate 2 | Santa Cruz | sc-363764 | HK2 sample for mass spectrometry |
Antibodies (for westerns) | Vinculin (mouse mAb, H-10) | Santa Cruz | sc-25336 | (1:1000) |
FLCN (rabbit mAb, D14G9) | Cell Signalling | CST 3697S | (1:1000) | |
Cas9 (mouse mAb, 7A9) | Epigentek | A-9000–050 | (1:1000) | |
AQP1 (mouse mAb, B11) | Santa Cruz | sc-25287 | (1:100) | |
GPNMB (goat pAb) | R and D systems | AF2550-SP | (0.5 µg/mL) | |
SQSTM1 (mouse mAb, D5L7G) | Cell Signalling | CST 88588 | (1:1000) | |
RRAGD (rabbit pAb) | Cell Signalling | CST 4470S | (1:1000) | |
FNIP1 (rabbit mAb) | Abcam | ab134969 | (1:1000) | |
FNIP2 (rabbit pAb) | Atlas Antibodies | HPA042779 | (1:1000) | |
STAT2 (rabbit pAb) | GeneTex | GTX103117 | (1:1000) | |
pSTAT1 Y701 (rabbit mAb, D4A7) | Cell Signalling | CST 7649S | (1:1000) | |
TFE3 (rabbit pAb) | Atlas Antibodies | HPA023881 | (1:1000) | |
H3 (rabbit pAb) | Cell Signalling | CST 9715S | (1:1000) | |
αTubulin (mouse mAb, B-5-1-2) | Santa Cruz | sc-23948 | (1:2000) | |
p70S6Kinase T389 (rabbit pAb) | Cell Signalling | CST 9205 | (1:1000) | |
pAKT S473 (rabbit mAb, D9E) | Cell Signalling | CST 4060 | (1:2000) | |
total p70S6K (rabbit mAb, 49D7) | Cell Signalling | CST 2708 | (1:1000) | |
panAKT (mouse mAb 40D4) | Cell Signalling | CST 2920 | (1:2000) | |
4E-BP1 (rabbit mAb 53H11) | Cell Signalling | CST 9644 | (1:1000) | |
GAPDH (mouse mAb, 0411) | Santa Cruz | sc-47724 | (1:5000) | |
GAPDH (mouse mAb, 6C5) | Merck Millipore | MAB374 | (1:200) | |
Antibodies (for immunofluorescence) | mTOR (rabbit mAb, 7C10), | Cell Signalling | CST 2983 | (1:300) |
Lamp2 (mouse mAb, H4B4) | Abcam | ab25631 | (1:400) | |
TFE3 (rabbit pAb) | Cell Signalling | CST 14779 | (1:300) | |
Sequence-based reagent | qRT-PCR and sequencing primers | Sigma-Aldrich | Described in corresponding material and method sections | |
Commercial assay or kit | Lenti-X Tet-On 3G Inducible Expression System | Clontech, Takara Bio | 631187 | Creation of lentiviral constructs to generate Doxycycline inducible Cas9 cell line |
Commercial assay or kit | High Pure RNA Isolation Kit | Roche | 11828665001 | RNA isolation kit for RNAseq and qRT-PCR analyses |
Commercial assay or kit | iScript cDNA Synthesis Kit | Bio-Rad | 170–8891 | cDNA synthesis kit for qRT-PCR analyses |
Commercial assay or kit | IFN-γ Flex Set CBA | BD Biosciences | 560111 | Flow cytometry based Cytometric bead array |
Commercial assay or kit | VeriKine-HS Human IFN-α All Subtype ELISA kit | PBL assay science | 41115 | IFN-α Enzyme-Linked Immunosorbent Assay |
Chemical compound, drug | Crystal Violet | 1014080025 | Stain clonogeniticy using a (0,05% solution) | |
Software, algorithm | R/Rstudio | edgeR (Robinson et al., 2010) ggplot (Wickham, 2016) | ||
Software, algorithm | Cytoscape | Shannon et al., 2003 | PMID:14597658 | iRegulon BinGO ClusterOne v1.0 (Nepusz et al., 2012) |
Software, algorithm | GSEA MSigDB | Subramanian et al., 2005 Liberzon et al., 2011 | PMID:16199517 PMID:26771021 | Gene set enrichment analyses |
Software, algorithm | GraphPad Prism | RRID:SCR_002798 | Rel. 8.2.2, plots and graph design | |
Software, algorithm | AxioVision SE64 | Carl Zeiss | Rel. 4.9.1 | Microscope camera software |
Table showing differential expression analyses of FLCNPOS versus FLCNNEG RPTECs on RNA and protein level.
Table showing subset of TFE3 targets upregulated in FLCNNEG RPTEC (cluster 3, boxed yellow in Figure 3A).