DCC regulates astroglial development essential for telencephalic morphogenesis and corpus callosum formation
- The University of Queensland, Queensland Brain Institute, Australia
- Bruce Lefroy Centre for Genetic Health Research, Murdoch Children’s Research Institute, Royal Children’s Hospital, Australia
- Department of Paediatrics, University of Melbourne, Australia
- Sorbonne Université, INSERM, CNRS, Institut de la Vision, France
- The University of Queensland, Faculty of Medicine, Australia
- Members and Affiliates of the International Research Consortium for the Corpus Callosum and Cerebral Connectivity (IRC5), United States
- Departments of Neurology and Pediatrics, Institute of Human Genetics and Weill Institute of Neurosciences, University of California, San Francisco, United States
- Neuroscience Research Group, Murdoch Children’s Research Institute, Australia
- Department of Neurology, University of Melbourne, Royal Children’s Hospital, Australia
- The University of Queensland, School of Biomedical Sciences, Australia
Figures
Figure 1 with 1 supplement
Netrin 1 (NTN1) and deleted in colorectal carcinoma (DCC) are crucial for remodelling of the interhemispheric fissure (IHF), corpus callosum (CC) and hippocampal commissure (HC) formation.
(A) Staining for Gap43-positive axons (green) and pan-Laminin (LAM)-positive leptomeninges and basement membrane (magenta) in wildtype, Dcc knockout, Dcckanga, and Ntn1-lacZ mice at embryonic day (E)17 indicates midline formation or absence of the CC and HC (white brackets) and extent of the IHF (yellow brackets). (B) The ratio of IHF length over the total midline length with schema. (C) T1-weighted MR images of a control subject compared with an individual with a DCC mutation demonstrate the presence or absence of the CC (white arrowheads) and extent of the IHF (red arrowheads and brackets) within the septum (yellow arrowheads). Graph represents mean ± SEM. Statistics by Mann–Whitney test: **p<0.01, ***p<0.001. See related Figure 1—figure supplement 1 and Supplementary file 1.
-
Figure 1—source data 1
Ratio of interhemispheric fissure (IHF) length/total telencephalic midline length in Dcc and Ntn1 mouse mutants.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
The interhemispheric fissure (IHF) is not remodelled in adult Dcckanga mice.
Neurofilament (NF)-positive axons (green) and pan-Laminin (LAM)-positive leptomeninges and basement membrane (magenta) in adult wildtype and Dcckanga mice reveal presence/absence of the corpus callosum (CC) and hippocampal commissure (HC) (white brackets and arrowheads), the extent of the interhemispheric fissure (IHF) (yellow brackets) and absence of the septal substrate in Dcckanga mice (asterisks).
Figure 2 with 1 supplement
Deleted in colorectal carcinoma (DCC) and netrin 1 (NTN1) are expressed in midline zipper glia (MZG) and MZG progenitors.
(A, E, J) Schematics depicting the cellular composition of the ventral telencephalic midline at embryonic day (E)12, E15 and E17. (B, F, K) Dcc mRNA (green), Glast-positive glia (red) and pan-Laminin (LAM)-positive leptomeninges and basement membrane (magenta) in E12, E15 and E17 wildtype mice reveal Dcc-positive/Glast-positive glial fibres (yellow arrowheads) and absence of Dcc within the interhemispheric fissure (IHF) (open yellow arrowheads). (C, G) DCC protein (green) and Glast protein (red) at E12 and E15 in wildtype mice reveal DCC-positive/Glast-positive glial fibres (yellow arrowheads) and absence of DCC within the IHF (open yellow arrowheads). (D, H) Ntn1 mRNA (green), Glast (red) and pan-LAM (magenta) in E12 and E15 wildtype mice show Ntn1-positive/Glast-positive glial fibres (yellow arrowheads) and absence of Ntn1 within the IHF (open yellow arrowheads). (E, inset) Schema of DCC and NTN1 expression at the E15 IHF surface, based on the results from F–I and Figure 2—figure supplement 1. (I) NTN1 (green) and Glast (red) or β-galactosidase (β-GAL; red) immunolabelling in E15 control and Ntn1-lacZ mice identify regions of NTN1 staining present in control heterozygotes and absent in homozygous Ntn1-lacZ mice (white arrowheads) and NTN1-/β-GAL-positive puncta located in Glast-positive glia (yellow arrowheads), with insets. (L) DCC protein (green), glial-specific nuclear marker SOX9 (magenta) and mature astroglial marker (GFAP) in E17 wildtype mice identify DCC-positive/GFAP-positive/SOX9-positive glia (yellow arrowheads). 3V: third ventricle; Hi: telencephalic hinge. See related Figure 2—figure supplement 1.
Figure 2—figure supplement 1
Deleted in colorectal carcinoma (DCC) is expressed in midline zipper glia (MZG).
(A, D, F) Schemas of key cellular components within the telencephalic midline. (B, C) Dcc mRNA (green), Glast-positive glia (red) and pan-Laminin (LAM)-positive leptomeninges and basement membrane (magenta) across the cortical plate (Cp) within the neocortex (NCx) or septum (Se) in horizontal sections of wildtype mice reveal Dcc-positive/Glast-positive radial glial (RG) fibres (yellow arrowheads). LV: lateral ventricle. (E) DCC protein (green), Gap43-positive axons (blue) and Glast-positive MZG (red) in horizontal sections of embryonic day (E)15 wildtype mice (right panels) indicate DCC-positive/Glast-positive cells (yellow arrowheads) and DCC-positive/Gap43-positive axons (blue arrowheads) that are approaching the midline and are adjacent to MZG. (G) Gap43-positive axons (blue), netrin 1 (NTN1) protein (green) and pan-LAM-positive leptomeninges and basement membrane (red) in horizontal sections of E15 wildtype mice reveal NTN1-positive/Gap43-positive axons (blue arrowheads) approaching the midline and NTN1-positive/LAM-positive basement membrane (BM; red arrowheads) of the interhemispheric fissure (IHF). (H–J) Mid-horizontal tissue sections encompassing the entire telencephalon (yellow outlines) with in situ hybridization for Dcc mRNA or Ntn1 mRNA or immunohistochemistry for DCC protein (all white or green), counterstained with DAPI (blue). Insets of the telencephalic midline are shown on the right. (K) DCC immunohistochemistry in horizontal sections of E17 wildtype and Dcc knockout mice with schema of key cellular components within the telencephalic midline.
Figure 3 with 1 supplement
Netrin 1 (NTN1) and deleted in colorectal carcinoma (DCC) regulate midline zipper glia (MZG) morphology and spatial distribution.
Nestin-positive radial glia (white; A, C, E) and Glast-positive glia (white; B, D, F, K) in embryonic day (E)14–E16 Dcckanga mice (A–F) and E15 Ntn1-LacZ mice (K) demonstrate the distribution of glial processes along the interhemispheric fissure (IHF) surface (yellow brackets) and lateral to the IHF (white arrowheads) with insets (C’, B’, D’, F’). Radial fibres of the glial wedge (GW) are indicated with magenta arrowheads. The mean fluorescence intensity of Glast staining between wildtype and Dcckanga mice at E14 (G), E15 (H) and E16 (I) based on the results from (B), (D) and (F), respectively. (J) The ratio of glial distribution over total midline length, with schema, based on the results from (A) to (F). All graphs represent mean ± SEM. Statistics by Mann–Whitney test . n.s: not significant; *p<0.05, **p<0.01. See related Figure 3—figure supplement 1 and Supplementary file 1.
-
Figure 3—source data 1
Fluorescence intensity of GLAST and ratio of glial distribution/total midline length in Dcc mouse mutants.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Deleted in colorectal carcinoma (DCC) is not required for endfeet attachment or molecular polarity of midline zipper glia (MZG).
(A) Nestin-positive radial glia (white) and Glast-positive MZG (white) in horizontal sections of embryonic day (E)13 wildtype and Dcckanga mice. (B, C) Pan-Laminin (LAM)-positive leptomeninges and basement membrane (green), Nestin-positive radial glia (magenta) and α-dystroglycan (α-DYST; red; B) or β-dystroglycan (β-DYST; red, C) in horizontal sections of E15 wildtype and Dcckanga mice. (D) Quantification of fluorescence intensity of β-DYST along 200 µm of the interhemispheric fissure (IHF) surface as outlined with red dotted box in (C). (E) Nestin-positive radial glia (green) with either adenomatous polyposis coli (APC, red), N-cadherin (N-CAD; red) or β-catenin (β-CAT; red) in horizontal sections of E15 wildtype and Dcckanga mice with insets. (F) Quantification of the fluorescence intensity of APC, N-CAD and β-CAT within 5 µm of the IHF as outlined in red dotted-edged boxes from (E). (G) Quantification of the fluorescence intensity of Nestin-positive radial glial endfeet within 5 µm of the IHF surface from inset in (E). All graphs represent mean ± SEM. Statistics by Mann–Whitney test. n.s: not significant, *p<0.05. See related Supplementary file 1.
-
Figure 3—figure supplement 1—source data 1
Fluorescence intensity of β-dystroglycan (β-DYST), β-catenin (β-CAT), adenomatous polyposis coli (APC) and N-cadherin (N-CAD) along the interhemispheric fissure (IHF) surface in Dcckanga mice.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig3-figsupp1-data1-v2.xlsx
Figure 4 with 1 supplement
Deleted in colorectal carcinoma (DCC) regulates midline zipper glia (MZG) migration to the interhemispheric fissure (IHF) surface.
(A, C, E) Nuclear glial marker SOX9 (green) and MZG marker Glast (red) in embryonic day (E)14–E16 Dcckanga mice reveal SOX9-positive/Glast-positive MZG at the pial IHF surface (boxed region and insets) above the base of the IHF (magenta arrowhead). (B, D, F, G) Quantification of SOX9-positive/Glast-positive MZG at the IHF pial surface based on the results from (A), (C) and (E). All graphs represent mean ± SEM. Statistics by Mann–Whitney test or Two-way unpaired Student's T test (G) or two-way ANOVA with post Sidak’s multiple comparison test (B, D, F): *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. n.s: not significant. See related Figure 4—figure supplement 1 and Supplementary file 1.
-
Figure 4—source data 1
Number and distribution of SOX9-positive midline zipper glia (MZG) in Dcc mouse mutants.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Deleted in colorectal carcinoma (DCC) does not regulate the proliferation or cell death of midline zipper glia (MZG) but regulates the formation of the indusium griseum glia and glial wedge.
(A) Mouse MZG cells were birth-dated with the thymidine analog 5-ethynyl-2′-deoxyuridine (EdU) every 24 hr, from embryonic day (E)12 to E15 in wildtype and Dcckanga mice. Representative images of EdU (green), cell cycle marker, Ki67 (red), and MZG marker Glast (magenta) are shown for wildtype and Dcckanga mice, with the distribution of MZG progenitors within the telencephalic hinge niche outlined with white dotted lines. Yellow arrowheads in insets point out EdU cells that are either Ki57-positive (filled arrowheads) or Ki67-negative (open arrowheads) in selected insets. The number of cells expressing each marker is quantified in (C) and (D). (B) Schema of the EdU injection (In) and collection (Co) regime and interpretation of co-labelled and non-co-labelled cells. (E) Laminin (LAM)-positive leptomeninges and basement membrane (green) and cleaved-caspase 3 (Cl-CASP3)-positive apoptotic cells (red, white arrowheads) in E13–E15 wildtype and Dcckanga mice. The number of Cl-CASP3-positive cells within the telencephalic hinge niche (white dotted lines) is quantified in (F). (G) Mature astroglial marker GFAP in coronal sections of P0 Dcckanga mice and E17 Dcc knockout mice and their wildtype littermates reveals midline glial populations, the glial wedge (GW), the indusium griseum glia (IGG) and the MZG (filled arrowheads) or their absence/malformation (open arrowheads). (H) Glial-specific cell body marker SOX9 (white or green), glial cell membrane marker Glast (white or red) and interhemispheric fissure (IHF) marker LAM (magenta) in E16 coronal sections from Dcckanga mice indicate the presence or absence of SOX9-positive/Glast-positive cell bodies at the pial surface of the IHF (yellow arrowheads) and within the intermediate zone (green arrowheads). (I) Quantification of SOX9-positive IGG cell bodies at the pial surface of the IHF in E16 wildtype and Dcckanga mice from immunohistochemistry in (G). All graphs represent mean ± SEM. Statistics by Mann–Whitney test. n.s: not significant, **p<0.01. See related Supplementary file 1.
-
Figure 4—figure supplement 1—source data 1
Number of cells expressing 5-ethynyl-2′-deoxyuridine (EdU) and Ki67, cleaved-caspase3 and SOX9 along the interhemispheric fissure (IHF) surface in Dcckanga mice.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig4-figsupp1-data1-v2.xlsx
Figure 5 with 1 supplement
Netrin 1 (NTN1) and deleted in colorectal carcinoma (DCC) regulate midline zipper glia (MZG) organization during interhemispheric fissure (IHF) remodelling.
(A) Gfap-positive mature astroglia (green or white in inset), Glast-positive glia (red) and pan-Laminin (LAM)-positive IHF and basement membrane (magenta) in embryonic day (E)17 wildtype Dcckanga, Dcc knockout and Ntn1-LacZ mice. Yellow arrowheads indicate presence (filled) or absence (open) of midline glial populations, the MZG, indusium griseum glia (IGG) and glial wedge (GW). Fluorescence intensity of Gfap staining from insets or bins in insets (red dotted line) was quantified in (B) and (C). (D) Schema of MZG development, IHF remodelling and corpus callosum (CC) formation in wildtype mice and mice deficient for NTN1 or DCC. Red dotted lines indicate rostral and caudal bins that were used to calculate the ratio of GFAP fluorescence in (C). All graphs represent mean ± SEM. Statistics by Kruskal–Wallis test with post-hoc Dunn’s multiple comparison test. ***p<0.001; ns: not significant. See related Figure 4—figure supplement 1, Figure 5—figure supplement 1 and Supplementary file 1.
-
Figure 5—source data 1
Normalized fluorescence intensity of GFAP adjacent to the telencephalic midline in E17 Dcc and Ntn1 mutant mice.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Deleted in colorectal carcinoma (DCC) is not required for astroglial differentiation of midline zipper glia (MZG).
(A) Mature astroglial marker Gfap (white) in horizontal sections of embryonic day (E)15 wildtype and Dcckanga mice with quantification of Gfap average fluorescence intensity. The surface of the third ventricle (3V) is outlined with dotted white lines. Red arrowheads indicate reactive blood vessels that are not Gfap-positive glia. Yellow brackets indicate the position of the interhemispheric fissure (IHF). Fgf8 mRNA (B) or Mmp-2 mRNA (C) in horizontal sections of E15 wildtype and Dcckanga mice. Red arrowheads indicate reactivity in the telencephalic hinge (Th) in insets, right. A region of the ganglionic eminence (GE) where Fgf8 is not expressed is shown and was used to normalize specific Fgf8 expression within the Th with background immunoreactivity as quantified in (D). (E) Phosphorylated p44/42 Mapk or Erk1/2 (p-ERK, green) and Glast-positive MZG (red) in horizontal sections of E15.5 wildtype, Dcckanga mice and Dcc knockout mice reveal the extent of IHF (yellow brackets) and remodelled regions of the septum (white brackets) with p-ERK-positive MZG in insets. (F) Nuclear factor I (NFI) A or B (green) and pan-Laminin (LAM)-positive leptomeninges and basement membrane (magenta) in horizontal sections of E14 and E15 wildtype and Dcckanga mice. NFI-positive/Glast-positive MZG cell bodies at the IHF surface are outlined with white boxes and quantified in (G). Data is represented as mean ± SEM. Significant differences were determined with nonparametric Mann–Whitney tests. ns: not significant.
-
Figure 5—figure supplement 1—source data 1
Fluorescence intensity measurements for GFAP, Fgf8 and Mmp-2 mRNA, and quantification of nuclear factor I (NFI)-positive/GLAST-positive cell bodies in Dcckanga mice.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig5-figsupp1-data1-v2.xlsx
Figure 6 with 1 supplement
Conditional knockdown of deleted in colorectal carcinoma (DCC) within EMX1 cells causes a spectrum of callosal phenotypes.
(A) Axonal marker TUBB3 (green), (B) TDT (white) or (C) DCC (white) in P0 Dcc cKO demonstrate a spectrum of callosal and interhemispheric fissure (IHF) remodelling phenotypes and a reduction in DCC expression within mice expressing Emx1iCre. The corpus callosum (CC) or CC remnant (CCR) and hippocampal commissure (HC) are indicated with white brackets or white arrowheads, and the IHF is indicated with yellow brackets. Red arrowheads indicate axon bundles that have not crossed the midline. (D) Schema of measurements taken for quantification shown in (C–E). (E) Quantification of the ratio of IHF length normalized to total telencephalic midline length measured for P0 Dcc cKO mice. (F, G) Quantification of CC length (F) and depth (G) normalized to the total telencephalic midline length in P0 Dcc cKO mice. (H) Quantification of HC length normalized to the total telencephalic midline length in P0 Dcc cKO mice. (I) Quantification of DCC expression measured from the cingulate cortex (CCx) and intermediate zone (IZ) of Dcc cKO mice. (J, K) Scatterplots of the relationship between CC length (J) or HC length (K) normalized to total telencephalic midline length and IHF length normalized to total telencephalic midline length for middle horizontal sections of P0 Dcc cKO mice. Pearson r correlations are shown. (L) DCC (white), (M, N) axonal marker GAP43 (green or white, insets) and TDT (magenta) in embryonic day (E)15 Dcc cKO mice, with quantification of mean DCC fluorescence in (O) and quantification of mean GAP43 fluorescence within 50 µm from the IHF (dotted red lines) in (P). (Q) TDT (white or magenta) and glial marker GLAST (green) in E15 Dcc cKO with insets and yellow arrowheads indicating GLAST-positive/TDT-positive MZG, and quantified in (R). All graphs represent mean ± SEM. Statistics by Mann–Whitney test or unpaired t-test: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001; n.s: not significant. See related Figure 5—figure supplement 1 and Supplementary file 1.
-
Figure 6—source data 1
Measurements of interhemispheric fissure (IHF), corpus callosum (CC) and hippocampal commissure (HC) length and depth, deleted in colorectal carcinoma (DCC) fluorescence and GLAST-positive/TDTOMATO-positive midline zipper glia (MZG) cell bodies in Dcc cKO mice.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Dcc knockdown via targeted in utero electroporation does not cause corpus callosum (CC) abnormalities.
(A) TUBB3 (green) and TDT (white or magenta) in E18 Dcckanga mice electroporated with pCAG-TDTOMATO and either Dcc-CRISPR or Dcc-shRNA constructs into the cingulate cortex (CCx) at embryonic day (E)13. The CC is outlined with white brackets, and white boxes indicate the location of panels represented in (B). (B) GFP (green), TDT (magenta) or deleted in colorectal carcinoma (DCC) (white) in E18 Dcckanga mice electroporated with pCAG-TDTOMATO and either Dcc-CRISPR or Dcc-shRNA constructs into the CCx at E13. GFP indicates expression of the Dcc-CRISPR, and yellow arrowheads indicate the location of select electroporated cells. (C) Quantification of the ratio of DCC expression between ipsilateral (electroporated; EP) and contralateral (non-electroporated) hemispheres shown in (B). (D–G) Scatterplots of the relationship between CC length or hippocampal commissure (HC) length normalized to total telencephalic midline length and interhemispheric fissure (IHF) length normalized to total telencephalic midline length for ventral and dorsal horizontal sections of P0 Dcc cKO mice. Nonparametric Spearman r correlations are shown. (H) Glial marker GLAST (white) in E15 Dcc cKO mice demonstrates the distribution of GLAST-positive MZG. Yellow boxes indicate region shown in insets, right and quantified in (E). (I) Quantification of mean GLAST fluorescence within the telencephalic hinge from insets in (H).
-
Figure 6—figure supplement 1—source data 1
Quantification of the ratio of deleted in colorectal carcinoma (DCC) expression between hemispheres, measurements of interhemispheric fissure (IHF) length, corpus callosum (CC) length and hippocampal commissure (HC) length, and GLAST fluorescence intensity along the IHF surface in Dcc cKO mice.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig6-figsupp1-data1-v2.xlsx
Figure 7 with 1 supplement
Netrin 1-deleted in colorectal carcinoma (NTN1-DCC) signalling promotes cytoskeletal remodelling of astroglia.
(A, G) Representative images of U251 glioblastoma cells (A) and N2A cells (G) immunolabelled for TDTOMATO (red) and F-actin (green) following transfection with plasmids encoding Myr-TDTOMATO, DCC:TDTOMATO or DCCkanga:TDTOMATO demonstrating the presence of actin-rich regions resembling filopodia (yellow arrows), lamellipodia (yellow arrowheads) and membrane ruffles (yellow asterisks) with/without stimulation with recombinant mouse NTN1 protein. (B) Schema of predicted structure of proteins on the cell membrane encoded by the plasmids expressed in cells from (A) and (G). (C, H) Outline of cell perimeter generated from images in (A) and (G), respectively. (D–F, I) Quantification of the area, perimeter and circularity of cells represented in (A) and (G). Graphs represent mean ± SEM. Statistics by Kruskal–Wallis test for multiple comparisons. n.s: not significant; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. See related Figure 6—figure supplement 1 and Supplementary file 1.
-
Figure 7—source data 1
U251 or N2A cell area, perimeter and circularity following overexpression of DCC:TDTOMATO or myr-TDTOMATO.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Mutant DCC receptors are expressed and trafficked normally but are unable to modulate cell shape.
(A) Representative images of U251 glioblastoma cells immunolabelled for TDTOMATO (red) and F-actin (green) following transfection with plasmids encoding TDTOMATO, DCC:TDTOMATO or DCCkanga:TDTOMATO demonstrating predominant presence or absence of colocalized TDTOMATO with F-actin (arrowheads). (B) Quantification of average cell area from U251 cells represented in (A). (C) Specific missense mutations were introduced into mouse pCAG-DCC:TDTOMATO, and exon 29 was removed (del = deleted) to create the DCCkanga:TDTOMATO construct. (D) COS-7 cells were transfected with pCAG-DCC:TDTOMATO constructs, including those carrying specific point mutations and the DCCkanga:TDTOMATO construct. After 48 hr, cells were lysed, and a western blot was performed for mouse deleted in colorectal carcinoma (DCC) and GADPH. Specific bands at 214 kD and 37 kD are shown. (E) HEK293T, N2A and U251 cells were transfected with pCAG-DCC:TDTOMATO constructs, including those carrying specific point mutations. After 24 hr, cells were fixed and immunohistochemistry was performed for the N-terminal of DCC without permeabilization to detect membrane-inserted DCC (HEK293T) or for the C-terminal of DCC with permeabilization (N2A and U251 cells). (F) Representative images of N2A cells immunolabelled for TDTOMATO (red) and F-actin (green) following transfection with plasmids encoding DCC:TDTOMATO carrying missense mutations and stimulated with recombinant mouse NTN1 protein with cell perimeter outlined below. The cell perimeter and cell circularity of these cells and those represented in Figure 7B are quantified in (G) and (H), respectively. (I) Representative images of U251 and N2A cells immunolabelled for TDTOMATO (magenta) and cleaved-caspase 3 (CC3; green) following transfection with plasmids encoding DCC:TDTOMATO and myr-TDTOMATO. Arrowheads indicate TDTOMATO-positive/CC3-positive cells, which are quantified below. (J) U251 and N2A cells were transfected with plasmids encoding myr-TDTOMATO and DCC:TDTOMATO or not transfected. After 20 hr, cells were lysed, and a western blot was performed for mouse DCC, netrin 1 (NTN1) and GADPH. Specific bands at 214 kD, 75 kD and 37 kD are shown from n = 3 biological replicates. All graphs represent mean ± SEM. Statistics by Kruskal–Wallis test for multiple comparisons. n.s: not significant with p>0.05, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. See related Figure 6, Figure 7 and Supplementary file 1. All graphs represent mean ± SEM. Statistics by Mann–Whitney test or unpaired t-test: *p<0.05; n.s: not significant with p>0.05. See related Figure 7, Figure 8 and Supplementary file 1.
-
Figure 7—figure supplement 1—source data 1
U251 cell area, N2A cell perimeter and circularity and cleaved-caspase 3 expression following overexpression of DCC:TDTOMATO, DCC:TDTOMATO carrying a mutation, Myr-TDTOMATO or TDTOMATO alone.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig7-figsupp1-data1-v2.xlsx
Figure 8
DCC mutations associated with human callosal agenesis are unable to modulate cell shape and show varied netrin 1 (NTN1) binding.
(A) Schema of transmembrane receptor deleted in colorectal carcinoma (DCC) and its structural domains. Lines indicate the position of altered residues from missense DCC pathogenic variants identified in human individuals with corpus callosum (CC) abnormalities. FN3: fibronectin type III-like domain; IgC: immunoglobulin like type C domain; TM: transmembrane domain; p: P motif. (B) Colorimetric detection of alkaline phosphatase activity in COS-7 cells transfected with plasmids encoding TDTOMATO, DCC:TDTOMATO and mutant DCC:TDTOMATO constructs and incubated with a NTN1 alkaline phosphatase fusion protein. (C) Representative images of N2A cells immunolabelled for TDTOMATO (red) and F-actin (green) following transfection with plasmids encoding Myr-TDTOMATO, DCC:TDTOMATO or DCC:TDTOMATO carrying missense mutations and stimulated with recombinant mouse NTN1 protein. (D) Outline of cell perimeter generated from images in (B). (E) Quantification of the area of cells represented in (B). Graph represents mean ± SEM. Statistics by Kruskal–Wallis test for multiple comparisons. n.s: not significant, ***p<0.001. (F) Schema of model for DCC-mediated changes in cell shape: activation of DCC by NTN1 induces dimerization of the receptor and recruits intracellular signalling effectors to regulate actin polymerization for filopodia and lamellipodia formation, and to regulate microtubule dynamics to promote membrane protrusions. Mutations that affect DCC signalling prevent DCC-mediated changes in cell shape. See related Figure 6—figure supplement 1 and Supplementary file 1.
-
Figure 8—source data 1
N2A cell area following overexpression of DCC:TDTOMATO, DCC:TDTOMATO carrying a mutation or myr-TDTOMATO.
- https://cdn.elifesciences.org/articles/61769/elife-61769-fig8-data1-v2.xlsx
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | DCC | NCBI | 1630 | |
| Gene (Mus musculus) | Dcc | NCBI | 13176 | |
| Gene (Mus musculus) | Ntn1 | NCBI | 18208 | |
| Strain, strain background (Mus musculus) | Dccflox/flox, C57BL/6J | Krimpenfort et al., 2012 | N/A | |
| Strain, strain background (Mus musculus) | Dcckanga, C57BL/6J | Finger et al., 2002 | N/A | |
| Strain, strain background (Mus musculus) | Dcc-/-, C57BL/6J | Fazeli et al., 1997 | N/A | |
| Strain, strain background (Mus musculus) | Emx1iCre, C57BL/6J | Kessaris et al., 2006 | N/A | |
| Strain, strain background (Mus musculus) | Ntn1-lacZ, C57BL/6J | Serafini et al., 1996 | N/A | |
| Strain, strain background (Mus musculus) | tdTomatoflox_stop, C57BL/6J | Madisen et al., 2010 | N/A | |
| Cell line (Homo sapiens) | HEK293T | ATCC | RRID:CVCL_0045 | ATCC Cat# CRL-1573 |
| Cell line (Homo sapiens) | U251MG | ATCC | RRID:CVCL_0021 | Obtained as U-373MG (RRID:CVCL_2219) but subsequently identified as U-251 via PCR-based short tandem repeat profiling |
| Cell line (Mus musculus) | Neuro-2A (N2A) | ATCC | RRID:CVCL_0470 | Obtained via the University of Queensland |
| Cell line (Chlorocebus aethiops) | COS-7 | ATCC | RRID:CVCL_0224 | ATCC Cat# CRL-1651 |
| Antibody | Goat polyclonal anti-DCC | Santa Cruz Biotechnology | sc-6535, RRID:AB_2245770 | (1:200) western blot; (1:500)immunofluorescence |
| Antibody | Goat polyclonal anti-NTN1 | R&D Systems | AF1109, RRID:AB_2298775 | (1:500) western blot; (1:500) immunofluorescence |
| Antibody | Rabbit monoclonal anti-GADPH | Cell Signaling Technology | 2118, RRID:AB_561053 | (1:2000) western blot |
| Antibody | Rabbit polyclonal anti-GADPH | IMGENEX | IMG-5143A, RRID:AB_613387 | (1:1000) western blot |
| Antibody | Rabbit polyclonal anti-APC | Abcam | ab15270, RRID:AB_301806 | (1:250) |
| Antibody | Mouse monoclonal anti-α-DAG1 | Merck | 05-593, RRID:AB_309828 | (1:250) |
| Antibody | Rabbit polyclonal anti-β-catenin | Cell Signaling Technology | 9562, RRID:AB_331149 | (1:500) |
| Antibody | Mouse monoclonal anti-β-dystroglycan (MANDAG2) | Developmental Studies Hybridoma Bank | 7D11, RRID:AB_2211772 | (1:50) |
| Antibody | Chicken polyclonal anti-β-galactosidase | Abcam | ab9361, RRID:AB_307210 | (1:500) |
| Antibody | Rabbit polyclonal anti-cleaved-caspase 3 | Cell Signaling Technology | 9661, RRID:AB_2341188 | (1:500) |
| Antibody | Goat polyclonal anti-DCC | Santa Cruz Biotechnology | sc-6535, RRID:AB_2245770 | (1:500) |
| Antibody | Mouse monoclonal anti-GAP43 | Millipore | MAB347, RRID:AB_94881 | (1:500) |
| Antibody | Mouse monoclonal anti-GFAP | Millipore | MAB3402, RRID:AB_94844 | (1:500) |
| Antibody | Rabbit polyclonal anti-GFAP | Dako | Z0334, RRID:AB_10013382 | (1:500) |
| Antibody | Mouse monoclonal anti-Glast (EAAT1) | Abcam | Ab49643, RRID:AB_869830 | (1:500) |
| Antibody | Rabbit polyclonal anti-Glast (EAAT1) | Abcam | Ab416, RRID:AB_304334 | (1:250) |
| Antibody | Mouse monoclonal anti-KI67 | BD Pharmingen | 550609, RRID:AB_393778 | (1:500) |
| Antibody | Chicken polyclonal anti-Laminin | LS-Bio | C96142, RRID:AB_2033342 | (1:500) |
| Antibody | Rabbit polyclonal anti-Laminin (pan-Laminin) | Sigma | L9393, RRID:AB_477163 | (1:500) |
| Antibody | Mouse monoclonal anti-N-cadherin (CDH2) | BD Biosciences | 610921, RRID:AB_398236 | (1:250) |
| Antibody | Rat monoclonal anti-Nestin (NES) | Developmental Studies Hybridoma Bank | AB 2235915, RRID:AB_2235915 | (1:50) |
| Antibody | Chicken polyclonal anti-Nestin (NES) | Abcam | Ab134017, RRID:AB_2753197 | (1:1000) |
| Antibody | Goat polyclonal anti-NTN1 | R&D Systems | AF1109, RRID:AB_2298775 | (1:500) |
| Antibody | Mouse monoclonal anti-neurofilament | Millipore | MAB1621, RRID:AB_94294 | (1:500) |
| Antibody | Rabbit polyclonal anti-NFIA | Aviva Systems Biology | ARP32714, RRID:AB_576739 | (1:500) |
| Antibody | Rabbit polyclonal anti-NFIB | Sigma | HPA003956, RRID:AB_1854424 | (1:500) |
| Antibody | Rabbit polyclonal anti-neuronal-specific-ßIII-tubulin (TUBB3) | Abcam | Ab18207, RRID:AB_444319 | (1:500) |
| Antibody | Rabbit polyclonal anti-phospho p44/42 MAPK (ERK1/2) | Cell Signaling Technology | 9101, RRID:AB_331646 | (1:250) |
| Antibody | Rabbit polyclonal anti-SOX9 | Merck | AB5535, RRID:AB_2239761 | (1:500) |
| Antibody | Goat polyclonal anti-TDTOMATO | Sicgen | Ab8181-200, RRID:AB_2722750 | (1:500) |
| Recombinant DNA reagent | pCAG-TDTOMATO | This paper | ||
| Recombinant DNA reagent | pCAG-DCC:TDTOMATO | This paper | ||
| Recombinant DNA reagent | pCAG-DCCKANGA:TDTOMATO | This paper | ||
| Recombinant DNA reagent | pCAG-DCCM743L:TDTOMATO | This paper | ||
| Recombinant DNA reagent | pCAG-DCCV754M:TDTOMATO | This paper | ||
| Recombinant DNA reagent | pCAG-DCCA893T:TDTOMATO | This paper | ||
| Recombinant DNA reagent | pCAG-DCCV793G:TDTOMATO | This paper | ||
| Recombinant DNA reagent | pCAG-DCCMG805E:TDTOMATO | This paper | ||
| Recombinant DNA reagent | pCAG-DCCM1217V;A1250T:TDTOMATO | This paper | ||
| Recombinant DNA reagent | pCAG-H2B-GFP-2A-MyrTDTOMATO | Arnold Kriegstein (UCSF) | ||
| Recombinant DNA reagent | p-SUPER-Dcc-shRNA | Xiong Zhiqi; Zhang et al., 2018 | ||
| Recombinant DNA reagent | pCAG-Dcc-CRISPR 1 | Atum; this paper | Targeting chr18:71954969– 71955009 | |
| Recombinant DNA reagent | pCAG-Dcc-CRISPR 2 | Atum; this paper | Targeting chr18:71826146– 71826092 | |
| Recombinant DNA reagent | Fgf8 cDNA | Gail Martin, UCSF | In situ hybridization riboprobe | |
| Recombinant DNA reagent | Ntn1 cDNA | Helen Cooper | In situ hybridization riboprobe | |
| Recombinant DNA reagent | Mmp2 cDNA | This paper | In situ hybridization riboprobe | |
| Sequence-based reagent | Mmp-2 cDNA forward primer | Allen Brain Atlas | 5’-ATGGTGACCAAGAACAGAAGGT | |
| Sequence-based reagent | Mmp-2 cDNA reverse primer | Allen Brain Atlas | 5’-AATCACTGCTACAATCACCACG | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Met743Leu forward primer | This paper | 5’-GAGGAGGTGTCCAACTCAAGATGATACAGTTTGTCTG | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Met743Leu reverse primer | This paper | 5’-CAGACAAACTGTATCATCTTGAGTTGGACACCTCCTC | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Val754Met forward primer | This paper | 5’-TAATATAGCCTCTCACCATGATGTTTGGGTTGAGAGG | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Val754Met reverse primer | This paper | 5’-CCTCTCAACCCAAACATCATGGTGAGAGGCTATATTA | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Ala893Thr forward primer | This paper | 5’- ACTTGTACTTGGTACTGGCAGAAAAGCTGGTCCT | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Ala893Thr reverse primer | This paper | 5’-AGGACCAGCTTTTCTGCCAGTACCAAGTACAAGT | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Val793Gl forward primer | This paper | 5’-ACTAGAGTCGAGTTCTCATTATGGAATCTCCTTAAAAGCTTTCAAC | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Val793Gl reverse primer | This paper | 5’-GTTGAAAGCTTTTAAGGAGATTCCATAATGAGAACTCGACTCTAGT | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Gly805Glu forward primer | This paper | 5’-CACTTTCGTAGAGAGGGACCTCTTCTCCGGCATTGTTGAA | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Gly805Glu reverse primer | This paper | 5’-TTCAACAATGCCGGAGAAGAGGTCCCTCTCTACGAAAGTG | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Met1217Val;p.Ala1250Thr forward 1 primer | This paper | 5’-GTTCCAAAGTGGACACGGAGCTGCCTGCGTC | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Met1217Val;p.Ala1250Thr reverse 1 primer | This paper | 5’-GACGCAGGCAGCTCCGTGTCCACTTTGGAAC | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Met1217Val;p.Ala1250Thr forward 2 primer | This paper | 5’-GTACAGGGATGGTACTCACAACAGCAGGATTACTGG | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Met1217Val;p.Ala1250Thr reverse 2 primer | This paper | 5’-CCAGTAATCCTGCTGTTGTGAGTACCATCCCTGTAC | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Val848Arg forward primer | This paper | 5’-CAGCCTGTACACCTCTTGGTGGGAGCATGGGGG | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.Val848Arg reverse primer | This paper | 5’-CCCCCATGCTCCCACCAAGAGGTGTACAGGCTG | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.His857Ala forward primer | This paper | 5’-ACCCTCACAGCCTCAGCGGTAAGAGCCACAGC | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.His857Ala reverse primer | This paper | 5’-GCTGTGGCTCTTACCGCTGAGGCTGTGAGGG | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.p.del-P3(Kanga) forward primer | This paper | 5’-CCACAGAGGATCCAGCCAGTGGAGATCCACC | |
| Sequence-based reagent | Dcc site-directed mutagenesis p.p.del-P3(Kanga) reverse primer | This paper | 5’-GGTGGATCTCCACTGGCTGGATCCTCTGTGG | |
| Peptide, recombinant protein | Ntn1 | R&D Systems | 1109-N1 | 100 ng/mL |
| Peptide, recombinant protein | NTN1-AP | This paper | Generated as supernatant from HEK293T as previously described in Zelina et al., 2014 | |
| Commercial assay, kit | Click-iT EdU Alexa Fluor 488 Imaging Kit | Invitrogen | C10337 | |
| Commercial assay, kit | QuickChange II Site-Directed Mutagenesis Kit | Stratagene | 200524 | |
| Software, algorithm | Fiji | Fiji | RRID:SCR_002285 | |
| Software, algorithm | Prism | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | Imaris | Bitplane | RRID:SCR_007370 |
Additional files
-
Supplementary file 1
Statistics related to quantified data in Figures 1–8 and Figure 1—figure supplement 1–Figure 7—figure supplement 1. CA: cell area; CP: cell perimeter; CC3: cleaved caspase 3; DCCK: DCCKanga; E: embryonic day; EP: electroporated; exp: experimental; FI: fluorescence intensity; IGG: indusium griseum glia; MZG: midline zipper glia; p: postnatal day; ROI: region of interest; TDT: TDTOMATO; vs.: versus; wt: wildtype.
- https://cdn.elifesciences.org/articles/61769/elife-61769-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/61769/elife-61769-transrepform-v2.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
DCC regulates astroglial development essential for telencephalic morphogenesis and corpus callosum formation
eLife 10:e61769.
https://doi.org/10.7554/eLife.61769
