Spinal lumbar dI2 interneurons contribute to stability of bipedal stepping
- Department of Medical Neurobiology, IMRIC, Hebrew University – Hadassah Medical School, Israel
- Institut de recherches cliniques de Montréal (IRCM), Canada
- Ecology and Evolutionary Biology, University of California, Irvine, United States
- Institute of Animal Science Poultry and Aquaculture Sci. Dept. Agricultural Research Organization, The Volcani Center, Israel
Figures
Figure 1 with 3 supplements
Characterization and classification of dI2 neurons during embryonic development.
dI2 interneurons (INs) were labeled as cells that expressed both the Foxd3 and Ngn1 enhancers (Avraham et al., 2009; see Figure 1—figure supplement 1A). (A–D) dI2 axonal projection during …
-
Figure 1—source data 1
Localization of dI2 neurons at the sciatic level.
The X/Y coordinates of dI2, large-diameter dI2, and small-diameter dI2 neurons (Figure 1F).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig1-data1-v2.xlsx
-
Figure 1—source data 2
Localization of excitatory and inhibitory dI2 neurons.
The X/Y coordinates of dI2 neurons expressing either vGlut2 or VIATT (Figure 1I).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig1-data2-v2.xlsx
Figure 1—figure supplement 1
Targeting, reporters, and activity modifiers used in the study.
(A) The different DNA constructs used in this study. For targeted expression in dI1 cells, the EdI1 enhancer was used (Avraham et al., 2009). To target dI2 cells, the intersection of the Ngn1 and Fox…
Figure 1—figure supplement 2
Differential expression of transcription factor (TF) in dI2 neurons.
(A) Premigratory dI2 (yellow) and early ventral migrating dI2 (cyan) neurons are Lhx1+Pax2- (cyan arrows). Cross-section of an embryonic day (E) 5 chick neural tube, expressing GFP in dI2 neurons …
-
Figure 1—figure supplement 2—source data 1
Pattern of expression of transcription factors (TFs) in dI2 neurons.
Expression of TFs in dI2 neurons (Figure 1—figure supplement 2E).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig1-figsupp2-data1-v2.xlsx
Figure 1—figure supplement 3
Distribution of dI2 neurons at the embryonic and posthatching spinal cord.
(A) Density plot and laminar distribution of dI2 somata in crural plexus segments (N = 551 cells) (left). Density plot of dI2large (magenta) and dI2small (yellow) neurons in the crural plexus …
-
Figure 1—figure supplement 3—source data 1
Localization of dI2 neurons at the crural and brachial levels.
The X/Y coordinates of large diameter dI2 and small diameter dI2 neurons in the crural and brachial spinal levels (Figure 1—figure supplement 3A and B).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig1-figsupp3-data1-v2.xlsx
Figure 2 with 1 supplement
dI2 neurons project to the cerebellum.
(A) Experimental setup for labeling dI2 neurons that project to the cerebellum. dI2 neurons were genetically targeted at HH18, and precerebellar neurons were labeled using intracerebellar injection …
-
Figure 2—source data 1
Localization of precerebellar neurons and dI2 synapses at the sciatic level.
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Cerebellar and central cerebellar nucleus targets of dI2 neurons.
(A) dI2 synapses in the central cerebellar nuclei. A cross-section of an embryonic day (E) 17 chick cerebellum. dI2 synapses (magenta), synaptotagmin (cyan). The arrowhead points to the midline, the …
-
Figure 2—figure supplement 1—source data 1
Localization of precerebellar neurons and dI2 synapses at the crural level.
The X/Y coordinates of precerebellar neurons (Figure 1—figure supplement 1B) and dI2 synapses (Figure 2—figure supplement 1C) at the crural level.
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig2-figsupp1-data1-v2.xlsx
Figure 3 with 1 supplement
3D reconstruction of dI2 neurons along the rostrocaudal axis.
(A) Spinal cord scheme describing dI2 axonal projection along the rostrocaudal axis (caudal is to the left, and rostral is to the right). The full lines represent the lumbar and brachial levels …
Figure 3—figure supplement 1
dI2 projection neurons constitute 10% of neurons in the ventral spinocerebellar tract (VSCT).
(A) A longitudinal bifurcation of a rostrally projecting dI2 axon. 3D reconstructions of light-sheet microscopy images of a lumbar-level dI2 neuron projecting at the brachial level. The bifurcated …
-
Figure 3—figure supplement 1—source data 1
Analysis if the dI2 and ventral spinocerebellar tract (VSCT) axons at the superior peduncle.
The number of axons expressing GFP or/and cherry at the superior peduncle (Figure 3—figure supplement 1D).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig3-figsupp1-data1-v2.xlsx
Figure 4 with 3 supplements
Synaptic inputs to dI2 neurons.
Schematic representations of the experimental design for labeling dI2::GFP or dI2::Cherry interneurons (INs; cyan) and potential sources of synaptic inputs (magenta). The soma densities of dI2 INs …
-
Figure 4—source data 1
Localizations of pre-dI2 terminals and synapses at the sciatic level.
The X/Y coordinates of dorsal root ganglion (DRG) axons and premotor neurons (pre-MNs) axons (Figure 4A and B). The X/Y coordinates of dI1, V1, and synapses and 5HT terminals at the sciatic level (Figure 4C–E).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Validation of the synaptic reporter as an indicator of synapses.
(A) Premotor neurons (red) contacted by dI2::SV2-GFP and colabeled with synaptotagmin (syn in blue) antibody. (B) A group of SV2-GFP-labeled boutons and the syn content (blue foci). Note that only …
-
Figure 4—figure supplement 1—source data 1
Validation of the use of SV2-GFP reporter as an indicator for synapses.
The volume of GFP+/syn+ and GFP+/syn- dI2 synapses on premotor neurons (Figure 4—figure supplement 1C).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig4-figsupp1-data1-v2.xlsx
Figure 4—figure supplement 2
dI1i neurons are premotor neurons (pre-MNs).
(A, B) Schematic illustration of the strategy for studying the potential innervation of motor neurons by dI1 neurons (A). dI1 neurons were targeted by a dI1-specific enhancer (Figure 1—figure …
-
Figure 4—figure supplement 2—source data 1
Localization of dI1 synapses.
The X/Y coordinates of dI1 synapses at the sciatic level (Figure 4—figure supplement 2C).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig4-figsupp2-data1-v2.xlsx
Figure 4—figure supplement 3
Input of dorsal root ganglion (DRG), dI1, and 5-HT neurons to dI2 neurons at the level of the crural plexus.
(A, B) Sparse sensory innervation of ventrally located dI2 neurons. Cross-section of an embryonic day (E) 17 embryo at the lumbar spinal cord (crural plexus level). A ventrally located dI2 neuron is …
-
Figure 4—figure supplement 3—source data 1
Distribution of dorsal root ganglion (DRG) terminals on dI2 neurons.
The ventral/dorsal location and the large/small somata of dI2 neurons that are contacted by DRG terminals (Figure 4—figure supplement 3E,F).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig4-figsupp3-data1-v2.xlsx
-
Figure 4—figure supplement 3—source data 2
Localizations of pre-dI2 terminals and synapses at the crural level.
The X/Y coordinates of dI1 synapses and 5HT terminals at the crural level (Figure 4—figure supplement 3G,H).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig4-figsupp3-data2-v2.xlsx
Figure 5 with 1 supplement
Spinal synaptic targets of dI2 neurons.
(A) Whole-mount staining of the spinal cord (thoracic segments) expressing alkaline phosphatase (AP) in dI2 neurons. The lumbar dI2 neurons (not included in the image) were labeled with AP. dI2 axon …
-
Figure 5—source data 1
Localization of dI2 synapses on post-dI2 neurons at the sciatic and brachial levels.
The X/Y coordinates of dI2 synapses, ipsi premotor neurons (pre-MNs), commissural pre-MNs, and contralateral dI2 at the sciatic level; dI2 synapses and ipsi pre-MNs at the brachial level (Figure 5).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Spinal targets of dI2 at the crural and brachial levels.
Cell soma density of putative targets (magenta) of dI2 neurons and dI2 synaptic densities (dI2::SV2-GFP, yellow) are illustrated in (A–E). The laminar distribution of the somata and synapses is …
Figure 6 with 1 supplement
Kinematic analysis of locomotion in posthatching chicks following the silencing of dI2 neurons.
(A) Schematic illustration of chick hindlimb joints (bold) and bones (regular). The knee joint connects the femur and the tibiotarsus, and the ankle connects the tibiotarsus and the tarsometatarsus, …
-
Figure 6—source data 1
Analysis of knee height trajectories during the swing phase.
The knee height trajectories during the normalized swing in all the analyzed steps of all chicks (Figure 6D).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig6-data1-v2.xlsx
-
Figure 6—source data 2
Analysis of TMP angles during the swing phase.
The TMP angle trajectories during the normalized swing in all the analyzed steps of all chicks (Figure 6E).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig6-data2-v2.xlsx
-
Figure 6—source data 3
Statistical analysis of knee height trajectories and TMP angles.
Statistical analysis for the data presented in Figure 6.
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig6-data3-v2.docx
Figure 6—figure supplement 1
Locomotion characteristics of control and TeTX-treated chicks: The left-right phase.
The mean left-right phase of the control and TeTX-treated chicks. The mean phase values are indicated by the r-vectors (arrows). The Rayleigh critical values (p=0.05) are indicated by blue circles.
-
Figure 6—figure supplement 1—source data 1
Analysis of left-right phase.
The left-right phase of the control and TeTX-treated chicks (Figure 6—figure supplement 1).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig6-figsupp1-data1-v2.xlsx
Figure 7 with 2 supplements
Parameters of reduced stability in bipedal stepping in TeTX-treated chicks.
(A) The percentage of steps with body collapses in the controls and TeTX-manipulated hatchlings (n = 4 and n = 5, respectively). p-value<0.0001 (Z-test). See Table 3 for the proportions of falls at …
-
Figure 7—source data 1
Analysis of collapses.
The number of collapses of each chick (Figure 7A).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Locomotion characteristics of control and TeTX-treated chicks: The range of knee height and TMP angles.
(A, B) The range of knee height and TMP angle (A and B, respectively, see text for details) for each chicken (four controls and five TeTX-treated chicks). Purple lines: averages of each group …
-
Figure 7—figure supplement 1—source data 1
Statistical analysis of knee height trajectories and TMP angles of each chick.
Statistical analysis for the data presented in Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig7-figsupp1-data1-v2.docx
Figure 7—figure supplement 2
Locomotion characteristics of control and TeTX-treated chicks.
Analyses of the landing angle. (A) Scheme of bones and joints of the chicken leg, indicating the landing angle. (B) A box plot showing the landing angles. The control and manipulated chickens did …
-
Figure 7—figure supplement 2—source data 1
Analysis of the landing angles in all steps.
The landing angles of each chick (Figure 7—figure supplement 2B).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig7-figsupp2-data1-v2.xlsx
-
Figure 7—figure supplement 2—source data 2
Analysis of the landing angles prior to a collapse.
The landing angles before and not before a collapse in each chick (Figure 7—figure supplement 2C).
- https://cdn.elifesciences.org/articles/62001/elife-62001-fig7-figsupp2-data2-v2.xlsx
Videos
Video 1
dI2 interneurons (INs): transverse sections of lumbar segments.
Caudal to rostral transverse images of light-sheet microscopy images along the lumbar segments of an embryonic day (E) 13 spinal cord expressing Cherry in dI2 neurons (a reference to the location of …
Video 2
dI2 interneurons (INs): lumbar segments.
3D reconstruction of light-sheet microscopy images of the lumbar spinal cord. In the transparent mode, dI2 axons are apparent on the contralateral side. The trajectory of two representative axons …
Video 3
dI2 interneurons (INs): brachial segments.
3D reconstruction of light-sheet microscopy images of dI2 axons entering and exiting the brachial spinal cord. Two representative axons (ventral and lateral projection axons in yellow and green, …
Video 4
dI2 interneurons (INs): brainstem and cerebellum.
3D reconstruction of light-sheet microscopy images of dI2 axons projecting into the brain stem and the cerebellum (blue and red, respectively). Cerebellum midline crossing is demonstrated for two …
Tables
Table 1
Stride velocity and left-right phase in control and tetanus toxin (TeTX-manipulated chicks).
| Chick | Mean swing velocity (cm/s) | Mean left-right phase (°) | # of steps |
|---|---|---|---|
| TeTX1 | 46.78 ± 22.13 | 184.679 ± 33.003 | 113 |
| TeTX2 | 62.24 ± 20.17 | 182.293 ± 32.01 | 63 |
| TeTX3 | 48.06 ± 20.04 | 180.784 ± 31.064 | 69 |
| TeTX4 | 57.24 ± 24.35 | 180.502 ± 36.291 | 59 |
| TeTX5 | 36.66 ± 17.61 | 181.97 ± 35.787 | 93 |
| Control 1 (GFP) | 79.65 ± 37.77 | 182.369 ± 35.366 | 47 |
| Control 2 (GFP) | 41.91 ± 20.41 | 182.384 ± 26.708 | 19 |
| Control 3 (not electroporated) | 41.09 ± 16.59 | N.D. | 121 |
| Control 4 (not electroporated) | 42.3 ± 30.91 | N.D. | 51 |
Table 2
Maximum stride width in control and tetanus toxin (TeTX)-manipulated chicks.
| Chick | Maximum stride width (cm) | # of steps |
|---|---|---|
| TeTX1 | 5.11 ± 1.89 | 97 |
| TeTX2 | 5.32 ± 1.38 | 36 |
| TeTX3 | 4.5 ± 1.01 | 27 |
| TeTX4 | 4.9 ± 1.16 | 49 |
| TeTX5 | 5.82 ± 1.71 | 110 |
| Control 8 | 4.15 ± 1.07 | 137 |
| Control 9 | 4.32 ± 1.32 | 115 |
Table 3
Collapses, knee height, and TMP angle ranges in control and tetanus toxin (TeTX)-manipulated chicks.
| Chick | % of steps with collapse | TMP angle: mean range (°) | # of steps | % of steps with collapse | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| All steps, mean | Combined mean | Minus collapses, mean | Minus collapses, combined mean | All steps, mean | Combined mean | Minus collapses | Minus collapses, combined mean | |||
| TeTX1 | 4.4 | 3.05 ± 0.49 | 3.11 ± 0.74 | 2.87 ± 0.38 | 2.83 ± 0.57 | 82.27 ± 22 | 72.71 ± 20.52 | 79.4 ± 24.5 | 68.97 ± 21.47 | 113 |
| TeTX2 | 20.60 | 3.5 ± 0.3 | 3.35 ± 0.47 | 71.79 ± 25 | 71.1 ± 25.68 | 63 | ||||
| TeTX3 | 18.8 | 2.57 ± 0.31 | 2.27 ± 0.26 | 64.17 ± 21 | 62.79 ± 20.9 | 69 | ||||
| TeTX4 | 20.45 | 2.54 ± 0.55 | 2.477 ± 0.56 | 72.48 ± 17 | 66.22 ± 19.1 | 59 | ||||
| TeTX5 | 29 | 3.86 ± 0.83 | 3.2 ± 0.2 | 72.86 ± 12 | 65.85 ± 13.13 | 93 | ||||
| Control 1 (GFP) | 2.12 | 1.91 ± 0.22 | 1.98 ± 0.33 | 1.91 ± 0.22 | 1.98 ± 0.33 | 56.8 ± 16.4 | 49.34 ± 16.03 | 56.95 ± 16.6 | 49.4 ± 16.18 | 47 |
| Control 2 (GFP) | 0 | 1.83 ± 0.25 | 1.83 ± 0.25 | 41.42 ± 18.4 | 41.42 ± 18.4 | 19 | ||||
| Control 3 (not electroporated) | 0 | 2.42 ± 0.23 | 2.42 ± 0.23 | 54.86 ± 9.65 | 54.86 ± 9.65 | 121 | ||||
| Control 4 (not electroporated) | 0 | 1.75 ± 0.1 | 1.75 ± 0.1 | 44.12 ± 12.51 | 44.12 ± 12.51 | 51 | ||||
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Chicken) | Gallus gallus | Gil-Guy Farm, Israel | NCBI Taxon: 9031 | |
| Strain, strain background (Pseudorabies virus) | PRV152 | Enquist and Card, 2003 | NCBI Taxon: 10345 | |
| Strain, strain background (Pseudorabies virus) | PRV614 | Enquist and Card, 2003 | NCBI Taxon: 10345 | |
| Antibody | Rabbit anti-GFP(polyclonal) | Molecular Probes, Eugene, Oregon, USA | A-11122RRID:AB_221569 | Dilution(1:1000) |
| Antibody | Mouse anti-GFP(monoclonal) | Abcam | Ab1218AB_298911 | Dilution(1:100) |
| Antibody | Goat anti-GFP(polyclonal) | Abcam | Ab6673RRID:AB_305643 | Dilution(1:300) |
| Antibody | Rabbit anti-RFP(polyclonal) | Acris | AP09229PU-NRRID:AB_2035909 | Dilution(1:1000) |
| Antibody | Goat anti-ChAT(polyclonal) | Millipore, USA | AB144PRRID:AB_2079751 | Dilution(1:300) |
| Antibody | Mouse anti-synaptotagmin(monoclonal) | Hybridoma Bank, University of Iowa, Iowa City, USA | ASV30RRID:AB_2295002 | Dilution(1:100) |
| Antibody | Mouse anti-lhx1/5(monoclonal) | Hybridoma Bank, University of Iowa, Iowa City, USA | 4F2RRID: AB_531784 | Dilution(1:100) |
| Antibody | Mouse anti-FoxP4(monoclonal) | Hybridoma Bank, University of Iowa, Iowa City, USA | PCRP-FOXP4-1G7RRID:AB_2618641 | Dilution(1:50) |
| Antibody | Rabbit anti-Pax2(polyclonal) | Abcam | ab79389RRID:AB_1603338 | Dilution(1:50) |
| Antibody | Chicken anti- lacZ(polyclonal) | Abcam | ab79389RRID:AB_307210 | Dilution(1:300) |
| Antibody | Rabbit anti-calbindin(polyclonal) | Swant | D-28kRRID:AB_2314070 | Dilution(1:200) |
| Antibody | Goat anti-FoxP2(polyclonal) | Abcam | ab1307RRID:AB_1268914 | Dilution(1:1000) |
| Antibody | Rabbit anti-5-HT(polyclonal) | Abcam | ab140495 | Dilution(1:100) |
| Recombinant DNA reagent | EdI1::Cre | Avraham et al., 2009 | N/A | |
| Recombinant DNA reagent | Ngn1::Cre | Avraham et al., 2009 | N/A | |
| Recombinant DNA reagent | Ngn1::FLPo | Hadas et al., 2014 | N/A | |
| Recombinant DNA reagent | Foxd3::FLPo | Hadas et al., 2014 | N/A | |
| Recombinant DNA reagent | Foxd3::Cre | Avraham et al., 2009 | N/A | |
| Recombinant DNA reagent | Isl1::Cre | Avraham et al., 2010a | N/A | |
| Recombinant DNA reagent | CAG-LSL-GFP | Hadas et al., 2014 | N/A | |
| Recombinant DNA reagent | CAG-LSL-SV2-GFP | Hadas et al., 2014 | N/A | |
| Recombinant DNA reagent | CAG-FSF-LSL-GFP | Hadas et al., 2014 | N/A | |
| Recombinant DNA reagent | CAG-FSF-LSL-SV2-GFP | This paper | N/A | Figure 1—figure supplement 1;can be obtained from the Klar lab |
| Recombinant DNA reagent | CAG-FSF-LSL-cherry | This paper | N/A | Figure 1—figure supplement 1;can be obtained from the Klar lab |
| Recombinant DNA reagent | CAG-FSF-LSL-SV2-cherry | This paper | N/A | Figure 1—figure supplement 1;can be obtained from the Klar lab |
| Recombinant DNA reagent | CAG-FSF-LSL-AP | This paper | N/A | Figure 1—figure supplement 1;can be obtained from the Klar lab |
| Recombinant DNA reagent | CAG-LSL-TeXT | This paper | N/A | Figure 1—figure supplement 1;can be obtained from the Klar lab |
| Recombinant DNA reagent | CAG-LSL-F_SV2-cherry_F-GFP | This paper | N/A | Figure 1—figure supplement 1;can be obtained from the Klar lab |
| Recombinant DNA reagent | pGEMTEZ-TeTxLC | Addgene | #32640 | |
| Sequence-based reagent | Foxd3-F | This paper | PCR primers | TCATCACCATGGCCATCCTG |
| Sequence-based reagent | Foxd3-R | This paper | PCR primers | GCTGGGCTCGGATTTCACGAT |
| Sequence-based reagent | vGlut2-F | This paper | PCR primers | GGAAGATGGGAAGCCCATGG |
| Sequence-based reagent | vGlut2-R | This paper | PCR primers | GAAGTCGGCAATTTGTCCCC |
| Sequence-based reagent | VIAAT-F | This paper | PCR primers | CTGAACGTCACCAACGCCATCC |
| Sequence-based reagent | VIAAT-R | This paper | PCR primers | GGGTAGGAGAGCAAGGCTTTG |
| Commercial assay or kit | NucleoBond Xtra Midi | Macherey-Nagel | Cat # 740410.50 | |
| Chemical compound, drug | CTB conjugated to Alexa Fluor 647 | Thermo Fisher | C34778 | 0.3 M |
| Software, algorithm | JMP | JMP | https://www.jmp.com/en_gb/home.html | |
| Software, algorithm | Adobe Photoshop | Adobe | https://www.adobe.com/il_en/ | |
| Software, algorithm | ImageJ | ImageJ | https://imagej.nih.gov/ij/ | |
| Software, algorithm | IMARIS | Oxford Instruments | https://imaris.oxinst.com/ | |
| Software, algorithm | MacVector | MacVector | https://macvector.com/index.html | |
| Other(electroporator) | BTX Electroporator | BTX Harvard Apparatus | Cat#45-0662 | |
| Other(confocal microscope) | FV1000; Olympus | Olympus | https://www.olympus-global.com/ | |
| Other(microscope) | Eclipse Ni | Nikon | https://www.nikon.com/ | |
| Other(light-sheet microscope) | LaVision Ultramicroscope II light-sheet microscope | LaVision BioTec | https://www.lavisionbiotec.com/ |
Additional files
-
Supplementary file 1
Weight, force, and number of electroporated cells.
See statistical tests in Supplementary Statistical analysis tables.
- https://cdn.elifesciences.org/articles/62001/elife-62001-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/62001/elife-62001-transrepform1-v2.docx
