Failures of nerve regeneration caused by aging or chronic denervation are rescued by restoring Schwann cell c-Jun
- Department of Cell and Developmental Biology, University College London, United Kingdom
- Instituto de Neurociencias de Alicante, Universidad Miguel Hernández‐CSIC, Spain
- University College London Great Ormond Street Institute of Child Health, United Kingdom
- Centre for Regenerative Medicine, Institute for Regeneration and Repair, University of Edinburgh, United Kingdom
- Department of Comparative Biosciences, School of Veterinary Medicine, University of Wisconsin‐Madison, United States
- Division of Plastic and Reconstructive Surgery, The Hospital for Sick Children, Canada
- John Van Geest Centre for Brain repair, Department of Clinical Neurosciences, University of Cambridge, United Kingdom
- Hospital General Universitario de Alicante, ISABIAL, Spain
Figures
Figure 1 with 1 supplement
Restoring Schwann cell c-Jun protein reverses the age-related decline in nerve regeneration.
(A) Representative western blots of c-Jun in young and aging WT nerves and aging c-Jun OE/+ nerves 3 days post-injury. The graph shows densitometric quantitation of the western blots. c-Jun …
Figure 1—figure supplement 1
Schematic representation of neuron backfilling.
Figure 2 with 1 supplement
The mouse model of chronic denervation.
(A) Analysis of RNA sequencing data showing decrease in gene expression during chronic denervation. (B) Representative western blot showing p75NTR expression in uninjured (UI) nerves and distal …
Figure 2—figure supplement 1
Surgical procedures used to study regeneration after immediate repair and chronic denervation.
Figure 3
c-Jun declines in the distal nerve stump during chronic denervation and long-term culture.
(A) Representative Western blot of c-Jun in WT uninjured (UI) nerves and distal stumps following 3 days and 1, 3, 6, 8, and 10 weeks of denervation. The graph quantitates the results, showing an …
Figure 4
c-Jun expression is maintained in c-Jun OE/+ Schwann cells during chronic denervation.
(A) Representative western blots of c-Jun in WT and c-Jun OE/+ distal stumps after 1, 3, and 10 weeks of denervation. The results are quantitated in the graph. In contrast to WT nerves, c-Jun OE/+ …
Figure 5
The regenerative capacity of c-Jun OE/+ nerves is maintained during chronic denervation.
(A) Representative images showing Fluorogold-labeling of neurons in L4 DRGs of WT and c-Jun OE/+ mice after 2 weeks of regeneration into acutely transected (immediate repair) or chronically …
Figure 6
Cell number and nerve size in injured WT and c-Jun OE/+ nerves Cell nuclei were counted in whole transverse profiles of the tibial nerve, 5 mm from the injury site, using the electron microscope.
(A) Schwann cell numbers in young and aged WT and c-Jun OE/+ nerves. (B) Macrophage density and (C) number in young and aged WT and c-Jun OE/+ nerves. (D) Fibroblast density and (E) number in young …
-
Figure 6—source data 1
Cell counts and measurements relating to Figure 6.
- https://cdn.elifesciences.org/articles/62232/elife-62232-fig6-data1-v1.docx
Figure 7
Sonic hedgehog promotes c-Jun activation in Schwann cells in vivo and in vitro.
(A) Representative western blot showing c-Jun expression in WT and Shh cKO (cKO) nerves 3 and 7 days after cut. Quantitation is shown in the graph where the data are normalized to WT 3 days …
Figure 8
Sonic hedgehog plays a role in c-Jun activation in Schwann cells via autocrine signaling.
(A, B) qPCR showing mRNA expression of (A) Bdnf *p=0.0314 and (B) Gdnf *p=0.0382 in Schwann cell cultures incubated for 48 hr with SAG. Data normalized to vehicle. Unpaired Student’s t-tests. n = 4 …
Figure 9 with 1 supplement
Bioinformatics analysis of RNA seq.
data from young and aged nerves. (A) Over-representation analysis showing enrichment of c-Jun-regulated genes in various WT injury paradigms. p=3.2×10−8 for UI young vs aged; p=1×10 x −7 for 3-day …
Figure 9—figure supplement 1
Bioinformatics analysis of aged and young nerves following injury.
(A) Principal component analysis (PCA) shows that the key source of variance in our aging analysis is injury status with samples clustering together after injury (red) regardless of age or genotype. …
Figure 10 with 1 supplement
Bioinformatics analysis of RNA seq. data from acutely and chronically denervated nerves.
(A) GO terms downregulated and (B) upregulated in WT nerves during chronic denervation. (C) When chronically denervated c-Jun OE/+ and WT nerves were compared, GO terms associated with Schwann cell …
Figure 10—figure supplement 1
Bioinformatics analysis of nerves after chronic injury.
(A) PCA showing the key sources of variance in our chronic injury analysis are not only injury dependent but also time post-injury dependent, with samples clustering based on length of denervation …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Mpz < Cre/+>; Rosa26c-Junstopf < f/+>, C57BL/6J background, Mus musculus both sexes used | c-Jun OE/+ mouse | Fazal et al., 2017 | RRID:MGI: | |
| Mpz < Cre/+>; Jun < f/+>, C57BL/6J background, Mus musculus both sexes used | c-Jun cKO mouse | Arthur-Farraj et al., 2012 | Juntm4Wag | RRID:MGI:2445420 |
| Mpz < Cre/+>; Shh < f/+>, C57BL/6J background, Mus musculus both sexes used | Shh cKO mouse | Jackson Laboratory | B6;129-Shhtm2Amc/J | RRID:IMSR_JAX:004293 |
| Mpz < Cre/+>, C57BL/6J background, Mus musculus both sexes used | Mpz-Cre mouse | Jackson Laboratory | B6N.FVB-Tg(Mpz-cre)26Mes/J; | RRID:IMSR_JAX:017927 |
| Antibody | Anti- c-Jun (rabbit monoclonal) | Cell Signaling | Cat #9165; RRID:AB_2130165 | WB (1:1000) IF (1:800) |
| Antibody | Anti- P-c-Jun (rabbit polyclonal) | Cell Signaling | Cat#9261; RRID:AB_2130162 | WB (1:1000) |
| Antibody | Anti- p75NTR (Ngfr) (rabbit polyclonal) | Millipore | Cat#AB1554; RRID:AB_90760 | WB (1:1000) |
| Antibody | Anti- GAPDH (rabbit polyclonal) | Sigma-Aldrich | Cat#G9545; RRID:AB_796208 | WB (1:5000) |
| Antibody | Anti- Canelxin (rabbit polyclonal) | Enzo Life Sciences | Cat#ADI-SPA-860-D; RRID:AB_2038898 | WB (1:1000) |
| Antibody | Anti- sox10 (goat polyclonal) | R and D Systems | Cat#AF2864; RRID:AB_442208 | IF (1:100) |
| Antibody | Anti- CGRP (rabbit monoclonal) | Peninsula Laboratories | Cat#T-4032; RRID:AB_518147 | IF (1:1000) |
| Antibody | Anti- Neurofilament (chicken polyclonal) | Abcam | Cat#ab4680; RRID:AB_304560 | IF (1:1000) |
| Antibody | Anti- Rabbit IgG, HRP-linked (Goat polyclonal) | Cell Signaling | Cat#7074; RRID:AB_2099233 | WB (1:2000) |
| Antibody | Cy3 anti-Rabbit IgG (H+L) (Donkey polyclonal) | Jackson Immuno Research Labs | Cat#711-165-152; RRID:AB_2307443 | IF (1:500) |
| Antibody | Anti-Goat Alexa 488 Conjugated (Donkey polyclonal) | Molecular Probes - Thermo Fisher | Cat#A11057; RRID:AB_2534104 | IF (1:1000) |
| Antibody | Anti-Rabbit Alexa 488 Conjugated (Donkey polyclonal) | Molecular Probes - Thermo Fisher | Cat#A11008; RRID:AB_143165 | IF (1:1000) |
| Antibody | Anti-Chicken Alexa 488 Conjugated (Goat polyclonal) | Molecular Probes - Thermo Fisher | Cat#A-11039; RRID:AB_2534096 | IF (1:1000) |
| Sequence-based reagent | Bdnf_F | Benito et al., 2017 | PCR primers | TCATACTTCGGTTGCATGAAGG |
| Sequence-based reagent | Bdnf_R | Benito et al., 2017 | PCR primers | AGACCTCTCGAACCTGCCC |
| Sequence-based reagent | c-Jun_F (Cells) | Benito et al., 2017 | PCR primers | AATGGGCACATCACCACTACAC |
| Sequence-based reagent | c-Jun_R (Cells) | Benito et al., 2017 | PCR primers | TGCTCGTCGGTCACGTTCT |
| Sequence-based reagent | c-Jun_F (Tissue) | Benito et al., 2017 | PCR primers | CCTTCTACGACGATGCCCTC |
| Sequence-based reagent | c-Jun_R (Tissue) | Benito et al., 2017 | PCR primers | GATTCGGGCCACTTGGAGTT |
| Sequence-based reagent | Gdnf_F | Benito et al., 2017 | PCR primers | GATTCGGGCCACTTGGAGTT |
| Sequence-based reagent | Gdnf_R | Benito et al., 2017 | PCR primers | GACAGCCACGACATCCCATA |
| Sequence-based reagent | Calnexin_F | Benito et al., 2017 | PCR primers | CAACAGGGGAGGTTTATTTTGCT |
| Sequence-based reagent | Calnexin_R | Benito et al., 2017 | PCR primers | TCCCACTTTCCATCATATTTGGC |
| Sequence-based reagent | Gapdh_F | Benito et al., 2017 | PCR primers | AGGTCGGTGTGAACGGATTTG |
| Sequence-based reagent | Gapdh_R | Benito et al., 2017 | PCR primers | TGTAGACCATGTAGTTGAGGTCA |
| Sequence-based reagent | Mpz_F | Benito et al., 2017 | PCR primers | GCTGGCCCAAATGTTGCTGG |
| Sequence-based reagent | Mpz_R | Benito et al., 2017 | PCR primers | CCACCACCTCTCCATTGCAC |
| Commercial assay or kit | Kapa mRNA HyperPrep Kit | Roche | Cat#KK8581, 08098123702 | |
| Commercial assay or kit | RNeasy Micro Extraction Kit | Qiagen | Cat#74004 | |
| Chemical compound, drug | Purmorphamine | Sigma-Aldrich | Cat#540220 | Concentration: various, see figures |
| Chemical compound, drug | Smoothened Agonist (SAG) | Merck-Sigma-Aldrich-Calbiochem | Cat#566660 | Concentration: various, see figures |
| Chemical compound, drug | Cyclopamine | Merck-Sigma-Aldrich-Calbiochem | Cat#CAS 4449-51-8 | Concentration: various, see figures |
| Software, algorithm | Samtools version 1.2 | Li et al., 2009 | RRID:SCR_002105 | |
| Software, algorithm | Picard tools version 1.140 | http://broadinstitute.github.io/picard/ | RRID:SCR_006525 | |
| Software, algorithm | featureCounts | Liao et al., 2014 | RRID:SCR_012919 | |
| Software, algorithm | edgeR | Robinson et al., 2010 | RRID:SCR_012802 | |
| Software, algorithm | Gen ser enrichment analysis (GSEA) | Subramanian et al., 2005 | RRID:SCR_003199 | |
| Software, algorithm | Gen ontology (GO) analysis – PANTHER classification system | Mi et al., 2013 | RRID:SCR_004869 | |
| Software, algorithm | GraphPad Prism 9.0.0 | GraphPad Prism | RRID:SCR_002798 | |
| Software, algorithm | Bio Rad ChemiDoc MP Imaging System | Bio Rad | RRID:SCR_019037 | |
| Other | Fluorogold | Fluorochrome | Fluoro-gold 20 mg | Made up to 4% |
| Other | DAPI | Thermo Fisher | Cat#D1306 | IF (1:40,000) |
Additional files
-
Supplementary file 1
The 15 most regulated genes in the tibial nerve of WT mice during aging.
The data compare (A) uncut nerves, (B) 3-day cut nerves, and (C) the injury response. In (A) and (B), genes expressed at higher levels in aged mice under the conditions indicated are in blue (top), while genes with reduced expression in aged mice are in red (bottom). In (C), genes that respond more strongly to injury in aged mice are in blue (top), while genes with weaker injury response in aged mice are in red (bottom).
- https://cdn.elifesciences.org/articles/62232/elife-62232-supp1-v1.xlsx
-
Supplementary file 2
All significantly regulated genes in the tibial nerve of WT mice during aging and chronic denervation.
(A, B) Genes expressed at higher levels in aged mice under the conditions indicated are in blue (top), while genes with reduced expression in aged mice are in red (bottom). (C) Genes that respond more strongly to injury (3-day cut vs UI) in aged mice are in blue (top), while genes with weaker injury response are in red (bottom). (D) The 303 genes that are significantly expressed in young WT vs UI and aged c-Jun OE/+ vs UI 3 days after injury. (E) Genes expressed at higher levels after chronic denervation are in blue (top), while genes with reduced expression are in red (bottom). (F) The 227 genes that are significantly expressed in WT 1 week vs UI and c-Jun OE/+ 10 week vs UI.
- https://cdn.elifesciences.org/articles/62232/elife-62232-supp2-v1.xlsx
-
Supplementary file 3
138 genes regulated by c-Jun in injured nerves derived from Arthur-Farraj et al., 2012.
Blue (top) indicates genes expressed at higher levels in cut nerves of WT mice compared with nerves of mice with conditional c-Jun inactivation selectively in Schwann cells (92 genes), while red (bottom) indicates genes expressed at lower levels in cut WT nerves compared to c-Jun mutant nerves (46 genes).
- https://cdn.elifesciences.org/articles/62232/elife-62232-supp3-v1.xlsx
-
Supplementary file 4
The 15 most regulated genes in the tibial nerve during chronic denervation.
Genes expressed at higher levels after chronic denervation are in blue (top), while genes with reduced expression are in red (bottom).
- https://cdn.elifesciences.org/articles/62232/elife-62232-supp4-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/62232/elife-62232-transrepform-v1.docx
