Nanoscopic anatomy of dynamic multi-protein complexes at membranes resolved by graphene-induced energy transfer
- Department of Biology/Chemistry, University of Osnabrück, Germany
- Center of Cellular Nanoanalytics (CellNanOs), University of Osnabrück, Germany
- College of Life Sciences, Beijing University of Chemical Technology, China
- Department of Physics, University of Osnabrück, Germany
- 3rd Institute of Physics - Biophysics, Georg August University, Germany
- Cluster of Excellence “Multiscale Bioimaging: from Molecular Machines to Networks of Excitable Cells” (MBExC), Georg August University, Germany
Figures
Figure 1 with 1 supplement
Functional protein reconstitution onto graphene-supported lipid monolayers.
(A) Scheme of the graphene-supported lipid monolayer doped with trisNTA-DODA for site-specific capturing of His-tagged proteins. (B, C) Label-free detection of protein binding on graphene monitored …
Figure 1—figure supplement 1
Surface sensitive TIRFS-RIF detection of protein binding on graphene.
(A) Schemes of lipid layer formation, trisNTA-DODA conditioning and protein binding on silica (top) and graphene (bottom), respectively. SALD: solution-assisted lipid deposition. (B) Mass signal …
Figure 2 with 5 supplements
Calibration of distance-dependent GIET using DNA nanorulers.
(A) Architecture and theoretical distances of membrane-anchored DNA nanorulers. Anchor strands (black) are modified with a 3´-end cholesterol. Probe strands (blue) are conjugated with fluorescein at …
Figure 2—figure supplement 1
Surface sensitive TIRFS-RIF detection for GIET calibration.
Left row: Schemes of rulers used for calibrating distance-dependent GIET efficiency. For OG488-DHPE, gray bars mark injection of the lipids. For DNA rulers, the ‘anchor strands’ modified with a …
Figure 2—figure supplement 2
Simulation of electrodynamic coupling of an excited fluorophore to graphene.
(A) Scheme of the geometry used in the simulations. Random orientation of dyes was assumed. (B) Calculated fluorescence lifetime (τG) of FAM as function of the vertical distance d on graphene. …
Figure 2—figure supplement 3
Time-correlated single photon counting (TCSPC) for determining the fluorescence lifetime of DNA nanorulers.
(A) Schemes of DNA rulers used for calibrating distance-dependent GIET efficiency. The ‘anchor strands’ (black) were hybridized with the ‘probe strand’ (blue). Blocker strands (orange) were used for …
Figure 2—figure supplement 4
Mono-exponential fitting of the TCSPC data of DNA rulers.
DNA rulers labeled by the probe strand with 5´-end or 3´-end modification are shown in dashed and solid lines, respectively.
Figure 2—figure supplement 5
Characterization of membrane mobilities on glass and graphene by fluorescence recovery after photobleaching (FRAP).
(A) Time-lapse fluorescence images of ‘20–3´F’ on the lipid bilayer on glass (upper row) or lipid monolayer on graphene (lower row), respectively, before and after photobleaching at different times. …
Figure 3 with 5 supplements
Conformational dynamics of membrane-associated mNeon-Ypt7 upon interaction with Mon1-Ccz1 and HOPS.
(A) Schematic overview of delivery, activation, and function of Ypt7. GDI delivers prenylated GDP-bound Ypt7 to membranes of the late endosome/multivesicular body (MVB). Once Ypt7 is activated by …
Figure 3—figure supplement 1
Generation of mNeon-pYpt7-GDI complex.
(A) SDS-PAGE and Coomassie staining of the mNeon-pYpt7-GDI complex. 10 µM mNeon-Ypt7 was incubated with 9 µM Gdi1, 1 µM REP (Mrs6), 1 µM geranylgeranyltransferase (Bet2-Bet4) and geranylgeranyl …
Figure 3—figure supplement 2
HOPS-mediated concentration-dependent tethering of liposomes loaded with His-fused Ypt7-GTP or prenylated Ypt7-GTP.
(A) Pellet fraction of liposomes loaded with His-fused Ypt7-GDP (light gray bars) or Ypt7-GTP (dark gray bars). 170 µM liposomes were incubated with increasing amounts of HOPS complex or HOPS …
Figure 3—figure supplement 3
Homogenous distribution of prenylated mNeon-Ypt7 in lipid mono- and bilayers.
200 nM mNeon-pYpt7 complexed with GDI was incubated with glass-supported lipid bilayers and graphene-supported lipid monolayers in the presence of GTP at 30°C for 30 min. After extensive washing, …
Figure 3—figure supplement 4
Characterization of Mon1-Ccz1 binding to membranes and fluorescence lifetime changes of mNeon-pYpt7.
(A) Surface sensitive TIRFS-RIF detection of Mon1-Ccz1 binding to lipid mono- and bilayers. Mass signal for lipid coating (I), conditioning of the membrane (II), binding of Mon1-Ccz1 (III) and …
Figure 3—figure supplement 5
FRAP experiments of membrane-anchored mNeon-pYpt7 upon interaction with effectors.
(A) Time-lapse cLSM images of mNeon-pYpt7-GTP alone and in the presence of Mon1-Ccz1 or HOPS complex on glass-supported lipid bilayers or graphene-supported lipid monolayers (mNeon-pYpt7-GTP + …
Figure 4 with 2 supplements
Axial architecture of pYpt7-bound HOPS on membranes explored by GIET.
(A) Integrity of HOPS complexes containing different yEGFP-fused subunits analyzed by SDS-PAGE and Coomassie staining. (B) Confocal laser-scanning microscopy image of HOPS Vps16-yEGFP bound to …
Figure 4—figure supplement 1
Fluorescence intensity imaging by cLSM and lifetime imaging by FLIM of the recruited HOPS complex.
50 nM HOPS Vps16-yEGFP complex was added to glass-supported lipid bilayers (middle row) and graphene-supported lipid monolayers (right row) loaded with 150 nM pYpt7-GTP, respectively. As a control, …
Figure 4—figure supplement 2
Fluorescence lifetimes of yEGFP-fused HOPS complex bound to membrane-anchored pYpt7-GTP on glass and graphene.
(A) 50 nM HOPS complex with Vps39, Vps11, Vps16, Vps18, or Vps33 C-terminally fused to yEGFP was added to solid-supported lipid layers preloaded with 150 nM mNeon-pYpt7-GTP, respectively. (B) …
Figure 5 with 3 supplements
Dynamics of the pYpt7-bound HOPS complex on a lipid layer explored by single-molecule GIET.
(A, B) Representative time-lapse single-molecule intensity traces of Dy647NB-labeled HOPS Vps33-yEGFP (A) and HOPS Vps11-yEGFP (B) on glass (blue) and graphene (red). (C) Enlarged representation of …
Figure 5—figure supplement 1
Single-molecule detection of NB-labeled HOPS complexes bound to lipid-anchored pYpt7-GTP.
(A) Single-molecule images of NB-labeled HOPS Vps33-yEGFP. White dots are individual HOPS complexes bound to the lipid bilayer on glass via prenylated Ypt7-GTP. In the absence of Ypt7 and HOPS, …
Figure 5—figure supplement 2
Pooled single-molecule intensity histograms for (A) HOPS Vps33-yEGFP (n = 60498) and (B) HOPS Vps11-yEGFP (n = 33317) on glass, respectively.
The means ± s.d. of histograms in A and B are 576 ± 96 photons, and 495 ± 90 photons, respectively.
Figure 5—figure supplement 3
Representative root mean square deviation (RMSD) of single-molecule intensity traces on glass.
From the RMSD and mean intensity, a relative error of 7.6% for single-molecule detection was obtained. Of note, the relative error at single-molecule level was ~2 times smaller than s.d. of the …
Author response image 1
Time-correlated single photon counting (TCSPC) for quantification of GIET efficiency on lipid monolayer.
(A) TCSPC curves of OG488-DHPE recorded on glass with 30s (blue), on graphene with 30 s (green) and on graphene with 10 min (red). (B) Zoom up of TCSPC curves obtained on graphene with 30 s (green) …
Videos
Video 1
Mobility of mNeon-Ypt7-GTP anchored into a glass-supported lipid bilayer probed by FRAP.
Scale bar: 10 µm.
Video 2
FRAP of mNeon-Ypt7-GTP in interaction with HOPS on glass-supported lipid bilayer.
Scale bar: 10 µm.
Video 3
Single-molecule fluorescence images of NB labeled HOPS Vps33-yEGFP on glass and graphene, respectively, imaged under the same conditions.
Scale bar: 2 µm.
Tables
Table 1
Conformational states characterized by HMM analysis of smGIET.
| Protein | HOPS Vps33-yEGFP | HOPS Vps11-yEGFP | ||||
|---|---|---|---|---|---|---|
| State | L | M | H | L | M | H |
| IG/I0a | 0.25 ± 0.06 | 0.41 ± 0.08 | 0.69 ± 0.13 | 0.22 ± 0.05 | 0.36 ± 0.06 | 0.51 ± 0.08 |
| h (nm) b | 4.7 (3.9–5.5) | 6.8 (5.7–7.9) | 11.2 (8.9–14.9) | 4.3 (3.6–5.0) | 6.1 (5.3–6.9) | 8.1 (7.0–9.3) |
| Occup. (%)c | 30.9 ± 0.1 | 35.7 ± 0.2 | 33.5 ± 0.1 | 40.4 ± 0.2 | 38.0 ± 0.2 | 21.6 ± 0.1 |
-
*: mean ±s.d. based on IG of the Gaussian fits in single-molecule intensity distribution on graphene. I0 is the mean value of Gaussian fit on glass. b: h is the average height of NB-labeled HOPS on the membrane. Values in brackets are the range of h determined by mean ±s.d of IG/I0. c: mean ± s.e.m. of state occupancy.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Saccharomyces cerevisiae) | mNeon-Ypt7 | Thermo Fisher Scientific | ||
| Strain, strain background (S. cerevisiae) | BY4732 | Euroscarf library | MATa his3∆200 leu2∆0 met15∆0 trp1∆63 ura3∆0 | |
| Strain, strain background (S. cerevisiae) | BY4727 | Euroscarf library | MATalpha his3∆200 leu2∆0 lys2∆0 met15∆0 trp1∆63 ura3∆0 | |
| Strain, strain background (S. cerevisiae) | CUY2470 | doi: 10.1016/j.cub.2010.08.002 | BY4732; CCZ1::TRP1-GAL1pr MON1::HIS3M × 6-GAL1pr CCZ1::TAP-URA3 | |
| Strain, strain background (S. cerevisiae) | CUY2675 | doi:10.1111/j.1600-0854.2010.01097.x | BY4732xBY4727 VPS41::TRP1-GAL1pr VPS41::TAP-URA3 VPS39::KanMX-GAL1pr VPS33::HIS3-GAL1pr VPS11::HIS3-GAL1pr VPS16::natNT2-GAL1pr VPS18::kanMX-GAL1pr-3HA | |
| Strain, strain background (S. cerevisiae) | CUY4391 | doi: 10.1073/pnas.1117797109 | BY4732xBY4727 VPS41::TRP1-GAL1pr VPS41::TAP-URA3 VPS39::KanMX-GAL1pr VPS39::yEGFP-hphNT1 VPS33::HIS3-GAL1pr VPS11::HIS3-GAL1pr VPS16::natNT2-GAL1pr VPS18::kanMX-GAL1pr-3HA | |
| Strain, strain background (S. cerevisiae) | CUY4392 | doi: 10.1073/pnas.1117797109 | BY4732xBY4727 VPS41::TRP1-GAL1pr VPS41::TAP-URA3 VPS39::KanMX-GAL1pr VPS33::HIS3-GAL1pr VPS11::HIS3-GAL1pr VPS11::yEGFP-hphNT1 VPS16::natNT2-GAL1pr VPS18::kanMX-GAL1pr-3HA | |
| Strain, strain background (S. cerevisiae) | CUY4393 | doi: 10.1073/pnas.1117797109 | BY4732xBY4727 VPS41::TRP1-GAL1pr VPS41::TAP-URA3 VPS39::KanMX-GAL1pr VPS33::HIS3-GAL1pr VPS11::HIS3-GAL1pr VPS16::natNT2-GAL1pr VPS16::yEGFP-hphNT1 VPS18::kanMX-GAL1pr-3HA | |
| Strain, strain background (S. cerevisiae) | CUY4394 | doi: 10.1073/pnas.1117797109 | BY4732xBY4727 VPS41::TRP1-GAL1pr VPS41::TAP-URA3 VPS39::KanMX-GAL1pr VPS33::HIS3-GAL1pr VPS11::HIS3-GAL1pr VPS16::natNT2-GAL1pr VPS18::kanMX-GAL1pr-3HA VPS18::yEGFP-hphNT1 | |
| Strain, strain background (S. cerevisiae) | CUY4395 | doi: 10.1073/pnas.1117797109 | BY4732xBY4727 VPS41::TRP1-GAL1pr VPS41::TAP-URA3 VPS39::KanMX-GAL1pr VPS33::HIS3-GAL1pr VPS33::yEGFP-hphNT1 VPS11::HIS3-GAL1pr VPS16::natNT2-GAL1pr VPS18::kanMX-GAL1pr-3HA | |
| Recombinant DNA reagent | pET21a-EGFP | Novagen | ||
| Recombinant DNA reagent | pET21a-NB-H6 | Novagen | ||
| Recombinant DNA reagent | pET24b-Ypt7 | doi: 10.1242/jcs.140921 | ||
| Recombinant DNA reagent | pET24d-GST-TEV-Ypt7 | doi: 10.1091/mbc.e11-12-1030 | ||
| Recombinant DNA reagent | pET24d-GST-TEV-mNeon-Ypt7 | this paper | mNeon-Ypt7 gene was synthesized by Thermo Fisher Scientific, provided in a pMA-T backbone and subcloned into a pET24d vector. | |
| Recombinant DNA reagent | pGEX-6P-Gdi1 | doi: 10.1083/jcb.201608123 | ||
| Recombinant DNA reagent | pCDF-DUET-1-Bet2-Bet4 | doi: 10.1083/jcb.201608123 | ||
| Recombinant DNA reagent | pET30-Mrs6 | other | Gift from K. Alexandrov laboratory, Institute for Molecular Bioscience, The University of Queensland, Australia | |
| Sequenced-based reagent | 20mer anchor DNA oligonucleotide | IDT | 5’- GATGAATGGTGGGTGAGAGG-3´-TEG-Cholesterol | |
| Sequenced-based reagent | 25mer anchor DNA oligonucleotide | IDT | 5’- GATGAATGGTGGGTGAGAGGTGAGG-3´-TEG-Cholesterol | |
| Sequenced-based reagent | 35mer anchor DNA oligonucleotide | IDT | 5’- GATGAATGGTGGGTGAGAGGTGAGGAGTAAGAGGA-3´-TEG-Cholesterol | |
| Sequenced-based reagent | 50mer anchor DNA oligonucleotide | IDT | 5’- GATGAATGGTGGGTGAGAGGTGAGGAGTAAGA GGATGTGTTAGAGGGATG-3´-TEG-Cholesterol | |
| Sequenced-based reagent | 3´-FAM probe DNA oligonucleotide | IDT | 5’-CCTCTCACCCACCATTCATC-3´-FAM | |
| Sequenced-based reagent | 5´-FAM probe DNA oligonucleotide | IDT | 5’- FAM-CCTCTCACCCACCATTCATC-3´ | |
| Sequenced-based reagent | 15mer blocker DNA oligonucleotide | IDT | 5’-TCCTCTTACTCCTCA-3´ | |
| Sequenced-based reagent | 30mer blocker DNA oligonucleotide | IDT | 5’-CATCCCTCTAACACATCCTCTTACTCCTCA-3´ | |
| Peptide, recombinant protein | H6-mEGFP | doi: 10.1021/acs.nanolett.5b01153 | purified from E. coli BL21- DE3 cells | |
| Peptide, recombinant protein | GPF NB ‘enhancer’ | doi: 10.1002/smll.201502132 | purified from E. coli BL21- DE3 cells | |
| Software, algorithm | Origin8 | OriginLab | ||
| Software, algorithm | ImageJ | NIH | 1.53e | Time Series Analyzer plugin for extracting single-molecule intensity traces, Author: Balaji J http://rsb.info.nih.gov/ij/plugins/time-series.html |
| Software, algorithm | MATLAB | Mathworks | R2019b | Code availability for calculating the GIET efficiency was documented in Nature Photonics 2019, 13: 860–865. doi: 10.1038/s41566-019-0510-7. |
| Software, algorithm | HMM | other | Hidden Markov Model (HMM) Toolbox for Matlab written by Kevin Murphy https://www.cs.ubc.ca/~murphyk/Software/HMM/hmm.html | |
| Software, algorithm | STaSI | doi: 10.1021/jz501435p | Algorithm of step transition and state identification for single-molecule data analysis. |
Additional files
-
Supplementary file 1
GIET calibration by DNA nanorulers.
- https://cdn.elifesciences.org/articles/62501/elife-62501-supp1-v1.docx
-
Supplementary file 2
Fluorescence lifetime ratios of endocytic proteins and protein complexes.
- https://cdn.elifesciences.org/articles/62501/elife-62501-supp2-v1.docx
-
Supplementary file 3
Plasmids and yeast strains used in this study.
- https://cdn.elifesciences.org/articles/62501/elife-62501-supp3-v1.docx
-
Supplementary file 4
Conformational states and transition kinetics obtained from smGIET.
- https://cdn.elifesciences.org/articles/62501/elife-62501-supp4-v1.docx
-
Supplementary file 5
RMSD and mean intensities of single-molecule detections.
- https://cdn.elifesciences.org/articles/62501/elife-62501-supp5-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/62501/elife-62501-transrepform-v1.docx
