1. Genetics and Genomics
  2. Microbiology and Infectious Disease

An interbacterial DNA deaminase toxin directly mutagenizes surviving target populations

  1. Marcos H de Moraes
  2. FoSheng Hsu
  3. Dean Huang
  4. Dustin E Bosch
  5. Jun Zeng
  6. Matthew C Radey
  7. Noah Simon
  8. Hannah E Ledvina
  9. Jacob P Frick
  10. Paul A Wiggins
  11. S Brook Peterson
  12. Joseph D Mougous  Is a corresponding author
  1. Department of Microbiology, University of Washington School of Medicine, United States
  2. Department of Physics, University of Washington, United States
  3. Department of Laboratory Medicine and Pathology, University of Washington School of Medicine, United States
  4. Department of Biostatistics, University of Washington School of Public Health, United States
  5. Department of Biochemistry, University of Washington School of Medicine, United States
  6. Howard Hughes Medical Institute, University of Washington, United States
https://doi.org/10.7554/eLife.62967
Share this article
Cite this article
  1. Marcos H de Moraes
  2. FoSheng Hsu
  3. Dean Huang
  4. Dustin E Bosch
  5. Jun Zeng
  6. Matthew C Radey
  7. Noah Simon
  8. Hannah E Ledvina
  9. Jacob P Frick
  10. Paul A Wiggins
  11. S Brook Peterson
  12. Joseph D Mougous
(2021)
An interbacterial DNA deaminase toxin directly mutagenizes surviving target populations
eLife 10:e62967.
https://doi.org/10.7554/eLife.62967
  2. Download BibTeX
  3. Download .RIS
6 figures, 2 videos, 1 table and 3 additional files

Figures

Figure 1 with 2 supplements
Download asset Open asset
Double-stranded DNA deaminase A (DddA) expression leads to nucleoid degradation in E. coli wild-type cells and uracil accumulation in E. coli Δung.

(A) Fluorescence microscopy of the indicated E. coli strains expressing DddAtox or carrying an empty vector (Control). DAPI staining (DNA) is shown in cyan. Top: Representative micrographs for each condition, scale bar = 10 μm. Bottom: representative images of cells with intact or degraded nucleoids. (B) Quantification of nucleoid state in cells shown in A (n ≈100–200 cells per condition). (C) Agarose gel electrophoresis analysis of total genomic DNA isolated from the indicated E. coli strains expressing DddAtox, DddAtoxE1347A, or carrying an empty vector (Control) after induction for the time period shown. (D) Fluorescence microscopy indicating genomic uracil incorporation (red) of E. coli strains expressing DddAtox or carrying an empty vector (Control), scale bar = 10 μm. (E) Quantification of uracil labeling signal from cells shown in D (n ≈50 cells per condition). Values and error bars reflect mean ± s.d. of n = 2 independent biological replicates. p-Values derive from unpaired two-tailed t-test.

Figure 1—figure supplement 1
Download asset Open asset
Expression of DddAtox leads to nucleoid degradation in E. coli.

Full field view of fluorescence micrograph shown in Figure 1 (A) depicting E. coli strains expressing DddAtox or carrying an empty vector (Control). DAPI staining (DNA) is shown in cyan. Scale bar = 10 µM.

Figure 1—figure supplement 2
Download asset Open asset
DddAtox induction leads to genomic uracil accumulation in E. coli.

(A,B) Fluorescence microscopy indicating genomic uracil incorporation (red) in the noted E. coli strains. Scale bar = 10 µM. (A) Staining of a positive control strain for uracil incorporation, E. coli CJ236 [dut−, ung−]. This strain accumulates ~500 times more uracil than wild type. (B) Complete fields of view used to generate fluorescence micrographs depicted in Figure 1D.

Figure 2 with 2 supplements
Download asset Open asset
Intoxication by DddA leads to DNA replication arrest and widespread uracil incorporation across the genome.

(A) Viable cells (colony-forming units, cfu) of the indicated E. coli strains recovered following induction of DddAtox or empty vector (Control) for the time period shown. Values represent mean ± s.d. of n = 3 technical replicate and data are representative of three independent experiments. (B) Representative images from time-lapse microscopy of DnaN-YPet-expressing strains 6 hr post-induction of DddAtox, scale bar = 5 μm. (C) Cell tower representation of averaged localized fluorescence intensity of DnaN-YPet-expressing strains shown in B over the course of cell lifetimes. (n ≈ 20–300 cells per condition at start of experiment). (D) Mean focus intensity of each frame during time-lapse microscopy of DnaN-YPet-expressing strains over the course of 6 hr (n ≈ 20–300 cells per condition at start of experiment). (E) Representation of single-nucleotide variants (SNVs) by chromosomal position, frequency, and density in E. coli Δung following 60 min expression of DddAtox. (F) Frequency of the indicated substitutions among the SNVs shown in E. (G) Probability sequence logo of the region flanking mutated cytosines among the SNVs shown in (E).

Figure 2—figure supplement 1
Download asset Open asset
Expression of DddAtox in E. coli leads to replication arrest but does not mutagenize RNA.

(A) Full field of view of fluorescence micrographs shown in Figure 2B. Scale bar = 10 µM. (B) Kymograph of representative cells from time-lapse microscopy of DnaN-YPet expressing strains during a 6 hr timelapse post-induction of DddAtox or empty vector (Control), scale bar = 5 μm.

Figure 2—figure supplement 2
Download asset Open asset
Expression of DddAtox does not mutagenize RNA.

Representation by chromosomal position, frequency, and density of single-nucleotide variants (SNVs) detected with RNA-seq analysis of total cDNA collected from E. coli 60 min after induction of DddAtox (A) or the empty vector (Control) (B). The high-frequency SNVs detected near position 3 × 106 are the result of reads from highly expressed genes mapping incorrectly to homologous but not identical regions of the genome.

Figure 3 with 3 supplements
Download asset Open asset
Double-stranded DNA deaminase A (DddA) delivery via the T6SS during interbacterial competition results in varying outcomes among different recipient species.

(A–D) Competitiveness of the B. cenocepcia strains indicated at bottom against selected Enterobacteriaceae (colors relate to Figure 4) (A), Moraxellaceae (B), Pseudomonadaceae (C), or Burkholderiaceae (D). Pairs of organisms were cocultured on a solid surface for 6 hr. (E) Mass spectrometric quantification of uracil in genomic DNA obtained from 1 hr co-cultures of the indicated strains of P. aeruginosa with B. cenocepacia wild-type or dddAE1347A. Values and error bars reflect mean ± s.d. of n = 3 independent biological replicates. p-Values derive from unpaired two-tailed t-test. (F) Single-nucleotide variants (SNVs) detected in populations of P. aeruginosa Δung after 1 hr growth in competition with B. cenocepacia. SNVs are plotted according to their chromosomal position and frequency and colored according to their relative density. (G) Cell viability of the indicated P. aeruginosa strains after 1 hr growth in competition with B. cenocepacia wild-type or dddAE1347A. Values and error bars reflect mean ± s.d. of n = 2 independent biological replicates.

Figure 3—figure supplement 1
Download asset Open asset
P. aeruginosa accumulates genomic uracil during competition with B. cenocepacia.

(A–B) Fluorescence microscopy indicating uracil incorporation (red) into genomic DNA of cells recovered after one hour of growth from cocultures of P. aeruginosa wild-type or Δung cells and the indicated strains of B. cenocepacia (A) or each of the strains used in (A) grown in monoculture (B). (C) Quantification of uracil labeling signal from cells shown in A (n = ~50 cells per condition). Values and error bars reflect mean ± s.d. of n = 2 independent biological replicates. p-Values derive from unpaired two-tailed t-test. (D) Mutation frequency as measured by spontaneous rifampicin resistance frequency in P. aeruginosa Δung recovered after 1 hr growth in competition with the indicated strain of B. cenocepacia. Values and error bars reflect mean ± s.d. of n = 2 independent biological replicates with n = 3 technical replicates each. p-Values derive from unpaired two-tailed t-test.

Figure 3—figure supplement 2
Download asset Open asset
Delivery of double-stranded DNA deaminase A (DddA) to P. aeruginosa Δung during interbacteria competition with B. cenocepacia results in the accumulation of C•G-to-T•A transitions.

Quantification of total single-nucleotide variants (SNVs) detected in P. aeruginosa Δung after intoxication by B. cenocepacia, as shown in Figure 3F.

Figure 3—figure supplement 3
Download asset Open asset
Expression of DddAtox in P. aeruginosa results in nucleoid degradation.

(A) Representative micrographs of P. aeruginosa expressing DddAtox or carrying an empty vector (Control). DAPI staining (DNA) is shown in cyan, scale bar = 10 μm. (B) Quantification of nucleoid state in cells shown in A (n = ~100–200 cells per condition). Values and error bars reflect mean ± s.d. of n = 3 independent biological replicates. p-Values derive from unpaired two-tailed t-test.

Figure 4 with 1 supplement
Download asset Open asset
Delivery of double-stranded DNA deaminase A (DddA) by B. cenocepacia induces mutagenesis in a subset of resistant recipient species.

(A, D, and G) Mutation frequency as measured by spontaneous rifampicin resistance frequency in clones of different species recovered from growth in competition with B. cenocepacia wild-type or B. cenocepacia dddAE1347A (n = 2). (B, E, and H). Distribution of different mutation types detected in rpoB or the whole genome of rifampicin-resistant clones of different species recovered after growth in competition with wild-type B. cenocepacia. (B) Pattern of spontaneous mutation types observed in rpoB of E.coli derived from Garibyan et al., 2003. (C, F, and I). Genome distribution of different mutation types detected by whole-genome sequencing of rifampicin-resistant clones recovered after competition with B. cenocepacia. Species targeted include E. coli (A–C), E. coli EHEC (D–F), and K. pneumoniae (G–I). Colors relate to Figure 3. Values and error bars reflect mean ± s.d. of n = 2 independent biological replicates with n = 3 technical replicates each. p-values derive from unpaired two-tailed t-test. Spont. Spontaneous.

Figure 4—figure supplement 1
Download asset Open asset
Double-stranded DNA deaminase A (DddA)-mediated intoxication is not mutagenic during competition between B. cenocepacia and certain recipient species.

(A–F) Mutation frequency as measured by spontaneous rifampicin resistance frequency in clones of different species recovered from growth in competition with B. cenocepacia wild-type or B. cenocepacia dddAE1347A (n = 2). Values and error bars reflect mean ± s.d. of n = 2 independent biological replicates with n = 3 technical replicates each. p-values derive from unpaired two-tailed t-test.

Figure 5 with 1 supplement
Download asset Open asset
Predicted deaminase toxins from BaDTF2 and BaDTF3 clades exhibit mutagenic activity and a BaDTF2 representative targets ssDNA.

(A) Dendogram indicated evolutionary history of clades within the deaminase superfamily their predicted substrates (colored dots), modified from Iyer et al., 2011. Predicted toxins with unknown substrates, yellow boxes; deaminases toxins with defined biochemical activity, pink boxes. (B) Toxicity of representative BaDTF2 and BaDTF3 toxins as indicated by the proliferation (fold change in colony-forming unit [cfu] recovered) of E. coli after 1 hr expressing the toxins or the empty vector (Control). Values represent means ± s.d., and p-values derive from unpaired two-tailed t-test. (C and D) Representation of single-nucleotide variants (SNVs) by chromosomal position, frequency, and density in E. coli Δung after 1 hr expression of representative BaDTF2 (C) or BaDTF3 (D) toxins. (E and F). Distribution of different nucleotides substitutions among SNVs detected in E. coli Δung expressing representative BaDTF2 (E) or BaDTF3 (F) toxins. (G and H) Probability sequence logo of the region flanking mutated cytosines from E. coli Δung intoxicated with representative BaDTF2 (G) or BaDTF3 (H) toxins. (I and J). In vitro cytidine deamination assays for BaDTF2 toxin single-strand DNA deaminase toxin A (SsdA) using a single-stranded (I) or double-stranded (J) FAM-labeled DNA substrate 'S' with cytidines in the contexts CC, TC, AC, and GC. Cytidine deamination leads to products 'P' with increased mobility. A3A, APOBEC3A (control for activity on ssDNA). DddAtox was used as a control for activity toward dsDNA. K. In vitro cytidine deamination assays for SsdAtox or DddAtox using a single-stranded or double-stranded FAM-labeled DNA substrate with a single cytidine in the context indicated at top. Gels shown in I-K are representative of two replicates. Data in B represent means ± s.d., p-values derive from unpaired two-tailed t-test (n = 3).

Figure 5—figure supplement 1
Download asset Open asset
SsdAtox exhibits cytidine deaminase activity toward RNA in vitro, but not in vivo.

(A) Poisoned primer extension assay to detect deamination of cytidine in single-stranded RNA substrates. Deamination activity generates a 26-mer product. Image is representative of n = 2 independent replicates. (B–C) Representation of single-nucleotide variants (SNVs) by chromosomal position, frequency, and density detected with RNA-seq analysis of total cDNA collected from E. coli 60 min after induction of SsdAtox (B) or an empty vector (Control) (C). The high-frequency SNVs detected near position 3 × 106 are the result of reads from highly expressed genes mapping incorrectly to homologous but not identical regions of the genome.

Figure 6
Download asset Open asset
The structure of BaDF2 member single-strand DNA deaminase toxin A (SsdA) bears little resemblance to double-stranded DNA deaminase A (DddA) and reveals motifs differentiating toxins from RNA-targeting DYW proteins.

(A) Ribbon diagram depiction of the SsdAtox-SsdAI structure. (B,C) Secondary structure diagrams for SsdAtox and the core fold of deaminase superfamily proteins (Iyer et al., 2011). The SWG motif conserved in BaDTF2 toxins and the accompanying α-helical insertion (blue) are indicated in B. (D) Active site view of SsdAtox. Catalytic and zinc-coordinating residues, SGW motif and α-helical insertion (blue) are indicated. (E) Active site view of DddAtox indicating catalytic and zinc-coordinating residues. (F) Zoom-in view of the contact site between SsdAI and the active site of SsdAtox. (G) Conserved motifs identified in DYW and BaDTF2 proteins.

Videos

Video 1
Download asset
Double-stranded DNA deaminase A (DddA) inhibits E. coli growth.

Time lapse phase microscopy of E. coli expressing DddA during a 300-min period.

Video 2
Download asset
Double-stranded DNA deaminase A (DddA) arrests replication in E. coli growth.

Time lapse fluorescence microscopy of E. coli with YPet-labeled DnaN-expressing DddA during a 300-min period.

Tables

Appendix 1—key resources table
Reagent type
(species) or resource		DesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Escherichia coli)DH5αThermo Fisher Scientific Cat#18258012F–φ80lacZΔM15 Δ (lacZYA-argF)U169 recA1 endA1 hsdR17(rK–, mK+) phoAsupE44 λ–thi-1 gyrA96relA1Used for cloning
Strain, strain background (Escherichia coli)BL21 (DE3)EMD Millipore Cat#69450F–ompT hsdSB(rB–, mB–)gal dcm (DE3)Used for protein expression
Strain, strain background (Escherichia coli)BL21 ung-151PMID:15096615BDSC:31777; FLYB:FBtp0001612; RRID:BDSC_31777Used for protein expression
Strain, strain background (Escherichia coli)XK1502PMID:16923902F– ompT hsdSB (rB–, mB–) gal dcm ung-151Used for protein expression
Strain, strain background (Escherichia coli)XK1502 ΔungPMID:32641830F− ΔlacU169 nalA ΔungUsed for protein expression
Strain, strain background (Escherichia coli)AB1157PMID:17248104F- thr-1 leuB6(Am) glnX44(AS) hisG4(Oc) rfbC1 rpsL31(strR) argE3(Oc)
Strain, strain background (Escherichia coli)AB1157 γpet-dnaNPMID:28114307γpet-dnaN, KanR
Strain, strain background (Escherichia coli)CJ236PMID:24723723F+ung-1 relA1 dut-1 spoT1 thiE1
Strain, strain background (Burkholderia cenocepacia)H111PMID:10713433Wild-type
Strain, strain background (Burkholderia cenocepacia)H111 ΔI35_RS01770PMID:32641830ΔI35_RS01770
Strain, strain background (Burkholderia cenocepacia)H111 dddAE1347APMID:32641830dddAE1347A
Strain, strain background (Pseudomonas aeruginosa)PAO1PMID:10984043Wild-type
Strain, strain background (Klebsiella pneumoniae)MGH 78578PMID:11677609Wild-type
Strain, strain background (Escherichia coli)O157:H7 EDL933PMID:11206551
Strain, strain background (Acinetobacter baumannii)ATCC 17978PMID:18931120Wild-type
Strain, strain background (Burkholderia thailandensis)E264PMID:16336651Wild-type
Strain, strain background (Burkholderia thailandensis)F1PMID:23618999Wild-type
Strain, strain background (Burkholderia cenocepacia)K56-2PMID:29208119Wild-type
Strain, strain background (Salmonella enterica)Sv. Typhimurium 14028 sPMID:19897643Wild-type
Recombinant DNA reagentpPSV39-CV
(plasmid)		PMID:23954347For inducible expression of proteins in E. coli
Recombinant DNA reagentpScrhaB2-V
(plasmid)		PMID:15925406For inducible expression of proteins in E. coli
Recombinant DNA reagentpEXG2
(plasmid)		PMID:15911752For generation of markless P. aeruginosa mutants
Recombinant DNA reagentpScrhaB2-V::ssdA
(plasmid)		This studyTo express ssdA
Recombinant DNA reagentpPSV39-CV::ssdAI
(plasmid)		This studyTo express ssdAI
Recombinant DNA reagentpScrhaB2-V::TequE
(plasmid)		This studyTo express BadTF3
Recombinant DNA reagentpPSV39-CV::TequE
(plasmid)		This studyTo express BadTF3-Imm
Recombinant DNA reagentpETDuet-1 mcs1::ssdA-his6 mcs1::ssdAI
(plasmid)		This studyTo express ssdA-ssdAI
Recombinant DNA reagentpexG2_Δung
(plasmid)		This studyTo delete ung in Pseudomonas aeruginosa
Sequence-based reagentungDel-1This study5’-CAAGCTTCTGCAGGTCGACTCTAGAGGTATGGAGTTGTCCTTCGG
Sequence-based reagentungDel-2This study5-AGAGGTCCGGATCGGTCATGGAACCCCC
Sequence-based reagentungDel-3This study5’-CATGACCGATCCGGACCTCTGAAGGCCGC
Sequence-based reagentungDel-4This studyGGAAATTAATTAAGGTACCGAATTCCCGCGCCGGTGGACTGGC
Sequence-based reagentPAO1-ung-FThis study5’-CCGGGGAGTACTTCTCGTTC
Sequence-based reagentPAO1-ung-RThis study5’-GGCGTTCCAGTACCTGCTC
Sequence-based reagentGA_duet_PsyrE1-FThis study5’-ACCATCATCACCACAGCCAGGATCCGAAGGTCTCAAATATTGCG
Sequence-based reagentGA_duet_PsyrE1-RThis study5’-CTTAAGCATTATGCGGCCGCTCATTCCGACCTCATAATTG
Sequence-based reagentGA_duet_PsyrI1-FThis study5’-TATAAGAAGGAGATATACATATGAATAACAAAAGTAAAGTATTGATTGAAAAGC
Sequence-based reagentGA_duet_PsyrI1-RThis study5’-GCCGGCCGATATCCAATTGAGATCTTCACACAACTTGCGGCAC
Sequence-based reagentGA_pRhB_PsyrE1-FThis study5’-TGAAATTCAGCAGGATCACATATGAAGGTCTCAAATATTGCG
Sequence-based reagentGA_pRhB_PsyrE1-RThis study5’-TCATTTCAATATCTGTATATCTAGATTCCGACCTCATAATTGTTTC
Sequence-based reagentGA_p39_PsyrI1-FThis study5’-ACAATTTCAGAATTCGAGCTCACGGGAGGAAAGATGAATAACAAAAGTAAAGTATTGATTGAAAAGC
Sequence-based reagentGA_p39_PsyrI1-RThis study5’-TCATTTCAATATCTGTATATCTAGATCACACAACTTGCGGCAC
Sequence-based reagentrpoB-FThis study5’-GGAAAACCAGTTCCGCGTTG
Sequence-based reagentrpoB-RThis study5’-TCCAAGTTGGAGTTCGCCTG
Sequence-based reagentnfo_del-FThis study5’-CATTACCGTTTTCCTCCAGCGGGTTTAACAGGAGTCCTCGCATGAAATACGTGTAGGCTGGAGCTGCTTC
Sequence-based reagentnfo_del-RThis study5’-CCGTAAAATTGCAAGGATCTCCTTTTCCCGGTTATTCATCTTCAGGCTACCATATGAATATCCTCCTTAG
Sequence-based reagentnfo_dt-FThis study5’-GCTGATGGCACTGGTACTGT
Sequence-based reagentnfo_dt-RThis study5’-CCTTTAATCCGGCCTTTGCG
Sequence-based reagentxthA_del-FThis study5’-TACCATCCACGCACTCTTTATCTGAATAAATGGCAGCGACTATGAAATTTGTGTAGGCTGGAGCTGCTTC
Sequence-based reagentxthA_del-RThis study5’-TTAATTCTCCTGACCCAGTTTGAGCCAGGAGAGCTGCTAAATTAGCGGCGCATATGAATATCCTCCTTAG
Sequence-based reagentxthA_dt-FThis study5’-TACGTTTGCGATGTGGGTGA
Sequence-based reagentxthA_dt-RThis study5’-ATAACAAAGGACGGCAGGCA
Sequence-based reagentEL142_RS06975[tox]-gBlockThis study5’-TGAAATTCAGCAGGATCACATATGCTTTTAGGTGGACTTAACAACTACCAATACGCCCCAAATCCAGTCGAATGGGTCGATCCTTTGGGTTGGAAATTCTCCAATGGCAAGCGTCGTCCGCCCCACAAGGCAACGGTTACCGTCACAGACAAGAACGGAGTGGTCAAACACAAATCCAATTTGGTGTCAGGAAATATGACAGAAGCCGAAAAAAAACTGGGTTTCCCGAACAACTCTTTGGCAACACATACCGAGAATCGTGCAACGCGCTTAATTGACCTGAATCAAGGTGATACCATGTTAATTGAAGGACAGTATCGCCCGTGCCCACGCTGTAAGGGTGCGATGCGTGTTAAGGCAGAGGAATCTGGGGCTAAGGTTATCTACACCTGGCCCGAAGACGGTGACTTGAAGAAGCGCGAGTGGGAAGGAACCCCCTGTGATAAAAAGTCTAGATATACAGATATTGAAATGA
Sequence-based reagentEL142_RS06970 -gBlockThis study5’-GCCCCAAGGGGTTATGCTAAAGCTTTCTTAATTATCGAACAGGAATTTCAGATGATTCTCGACTTCAAGAATGTCAATCTTTTCAATCAAGCGAAGACGAACGTAGTTATTAGGCTCAATTAAAAGATCGACACAATTTGGTTCGGACAGTAAATAGCCGGACAAGCCATAGGGGTTAAAATCAAGGAACAGATTAGACTCCAGATAGATGTCTCCCTCGGGGATACCACCGCTGCGTTCCGTTGTTGAACGTGTAATGATGAAATACTGCTCAGGCACTTCATAGCTATCAGATGCAAACGAAAGGATGGCGCAATAATCCTCAATCGCAAACTTCACTTCTTGAATCACGATGTTACTCAGCATCTTTCCTCCCGTGAGCTCGAATTCTGAAATTGT
Sequence-based reagentRNA-GGCCGGThis study5’-GAGGCCGGAAGUGGAUGUGGAUAAGAUGGAG
Sequence-based reagentRNA-GGCUGGThis study5’-GAGGCUGGAAGUGGAUGUGGAUAAGAUGGAG
Sequence-based reagentPPE-OligonucleotideThis study5’FAM-CTCCATCTTATCCACATCCACT
Sequence-based reagentDNA-ATGCGCCAThis study5’FAM-AAAAAAAAAAAAAA ATGCGCCAAAAAAAAAAAAAAA
Sequence-based reagentrevDNA-ATGCGCCAThis study5’-TTTTTTTTTTTTTTTGGCGCATTTTTTTTTTTTTTT
Sequence-based reagentDNA-GCGThis study5’-FAM-AAAAAAAAAAAAAAAA GCGAAAAAAAAAAAAAAAAA
Sequence-based reagentDNA-CCGThis study5’-FAM-AAAAAAAAAAAAAAAA CCGAAAAAAAAAAAAAAAAA
Sequence-based reagentDNA-TCGThis study5’-FAM-AAAAAAAAAAAAAAAA TCGAAAAAAAAAAAAAAAAA
Sequence-based reagentDNA-ACGThis study5’-FAM-AAAAAAAAAAAAAAAA ACGAAAAAAAAAAAAAAAAA
Sequence-based reagentrevDNA-GCGThis study5’-TTTTTTTTTTTTTTTTTCGCTTTTTTTTTTTTTTTT
Sequence-based reagentrevDNA-CCGThis study5’-TTTTTTTTTTTTTTTTTCGGTTTTTTTTTTTTTTTT
Sequence-based reagentrevDNA-TCGThis study5’-TTTTTTTTTTTTTTTTTCGATTTTTTTTTTTTTTTT
Sequence-based reagentrevDNA-ACGThis study5’-TTTTTTTTTTTTTTTTTCGTTTTTTTTTTTTTTTTT
Gene (Pseudomonas syringae)ssdAGeneBankPSYRH_RS14050
Gene (Pseudomonas syringae)ssdAIGeneBankPSYRH_RS1404
Gene (Taylorella equigenitalis)BadTF3GeneBankEL142_RS06975
Gene (Taylorella equigenitalis)BadTF3-ImmunityGeneBankEL142_RS06970

Additional files

Supplementary file 1

Summary of single-nucleotide variants (SNPs) identified within target cells after co-culture with B. cenocepacia.

https://cdn.elifesciences.org/articles/62967/elife-62967-supp1-v3.xlsx
Supplementary file 2

X-ray data collection and refinement statistics.

https://cdn.elifesciences.org/articles/62967/elife-62967-supp2-v3.docx
Transparent reporting form
https://cdn.elifesciences.org/articles/62967/elife-62967-transrepform-v3.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Marcos H de Moraes
  2. FoSheng Hsu
  3. Dean Huang
  4. Dustin E Bosch
  5. Jun Zeng
  6. Matthew C Radey
  7. Noah Simon
  8. Hannah E Ledvina
  9. Jacob P Frick
  10. Paul A Wiggins
  11. S Brook Peterson
  12. Joseph D Mougous
(2021)
An interbacterial DNA deaminase toxin directly mutagenizes surviving target populations
eLife 10:e62967.
https://doi.org/10.7554/eLife.62967