The mTORC1-mediated activation of ATF4 promotes protein and glutathione synthesis downstream of growth signals
- Department of Molecular Metabolism, Harvard T. H. Chan School of Public Health, United States
- Department of Health Sciences and Technology, Swiss Federal Institute of Technology (ETH) Zurich, Switzerland
- Center for Advanced Biotechnology and Medicine, Department of Pharmacology, Rutgers Robert Wood Johnson Medical School, United States
- Division of Signal Transduction, Beth Israel Deaconess Medical Center and Department of Medicine, Harvard Medical School, United States
Figures
Figure 1 with 1 supplement
Mechanistic target of rapamycin complex 1 (mTORC1) signaling activates a subset of activating transcription factor 4 (ATF4)-dependent genes also activated by the integrated stress response (ISR).
(A) Schematic of the dual regulation of ATF4 and the unknowns addressed in this study. (B) Immunoblots of parallel lysates from RNA-seq experiment. Atf4+/+ and Atf4-/- mouse embryo fibroblasts were treated, as indicated, with insulin (500 nM, 16 hr) or rapamycin (20 nM, 30 min) prior to insulin (left) or with tunicamycin (2 μg/mL) for 4, 8, or 16 hr (right). Insulin response is quantified in Figure 1—figure supplement 1. (C) Venn diagram depicting number and overlap of mTORC1- and ISR-induced transcripts, including those increased with insulin (red), decreased relative to insulin with rapamycin (green), and increased with 4 hr tunicamycin (orange), and those dependent on ATF4 within these categories (purple), all with p-values <0.05. Only 61 ATF4-dependent genes overlap between those significantly induced by insulin in a rapamycin-sensitive manner and those induced by tunicamycin. Gene lists per category are provided in Figure 1—source data 1. (D) KEGG enrichment of the shared mTORC1- and ISR-induced ATF4 target genes. p-Values provided were false discovery rate corrected. (E) Plot of -log10p-values of 774 ATF4-dependent tunicamycin-induced genes. ATF4-dependent genes induced by both mTORC1 signaling and tunicamycin treatment (shared ISR and mTORC1) are shown in red. (F) The 61 ATF4-dependent genes induced by both mTORC1 (i.e., rapamycin-sensitive insulin stimulation) and tunicamycin treatment are shown ranked from left to right in order of greatest log2-fold change with insulin (red bars), with the corresponding tunicamycin-induced changes superimposed (white bars) (n = 4). Error bars depict 95% confidence intervals.
-
Figure 1—source data 1
Gene lists from Figure 1C.
- https://cdn.elifesciences.org/articles/63326/elife-63326-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Quantification of immunoblot shown in Figure 1B.
Figure 2
C/EBP family transcription factors contribute to the regulation of activating transcription factor 4 (ATF4)-dependent genes shared between mechanistic target of rapamycin complex 1 (mTORC1) signaling and the integrated stress response (ISR).
(A) CiiiDER analysis comparing transcription factor-binding elements enriched in the promoters of the top 200 ATF4-dependent genes induced by tunicamycin but not insulin (ISR Only) versus the 61 ATF4-dependent genes induced by both mTORC1 signaling and tunicamycin (Shared ISR and mTORC1). Those sequence elements significantly enriched (p<0.01) are shown in blue or red. Data are provided in Figure 2—source data 1. (B) Cistrome analysis of genome-wide chromatin immunoprecipitation studies to identify transcription factors found to bind to the promoters of the ATF4-dependent genes shared in their regulation by mTORC1 and ISR. (C) qPCR analysis of the indicated transcripts in Tsc2-/-mouse embryo fibroblasts (MEFs) transfected with control siRNAs (siCT) or those targeting Atf4, C/EBPα, C/EBPβ, C/EBPδ, C/EBPγ. Expression relative to siCT for each gene is graphed as mean ± SEM from two independent experiments, each with three biological replicates (n = 6). (D) Immunoblots of cells treated as in (C). (E) qPCR analysis of the indicated transcripts in serum-deprived wild-type MEFs treated with insulin (500 nM, 16 hr) after 30 min pretreatment with vehicle or rapamycin (20 nM) following transfection with control siRNAs (siCT) or those targeting Atf4 or C/ebpγ. Expression relative to siCT for each gene is graphed as mean ± SEM from two independent experiments, each with three biological replicates (n = 6). *p<0.05, **p<0.01, ***p<0.001, ns = not significant. One-way analysis of variance with Holm–Sidak method for multiple comparisons was used to determine statistical significance for (C, E).
-
Figure 2—source data 1
Promoter element enrichment data for Figure 2A.
- https://cdn.elifesciences.org/articles/63326/elife-63326-fig2-data1-v2.xlsx
Figure 3 with 1 supplement
Mechanistic target of rapamycin complex 1 (mTORC1) and activating transcription factor 4 (ATF4) regulate genes involved in amino acid synthesis, transport, and tRNA charging.
(A) Row-normalized heatmaps of NanoString gene expression data are shown from (1) serum-deprived wild-type (WT) or Tsc2-/-mouse embryo fibroblasts (MEFs) treated (16 hr) with vehicle (Veh) or rapamycin (20 nM, Rap) (n = 2), (2) serum-deprived WT MEFs treated with insulin (500 nM, 16 hr, Ins) following 30 min pretreatment with vehicle or rapamycin (20 nM) (n = 2), and (3) WT and Tsc2-/- MEFs transfected with Atf4 siRNAs or non-targeting controls (siCT) and serum-deprived for 16 hr (n = 3). Genes are grouped by functional category and ranked in order of most significantly decreased with ATF4 knockdown for each group. Heatmap values are provided in Figure 3—source data 1, and effects on ATF4 protein levels and mTORC1 signaling for each condition are shown by immunoblot in Figure 3—figure supplement 1A. (B, C) qPCR analysis of the indicated transcripts in WT and Tsc2-/- MEFs (B) or WT MEFs stimulated with insulin in the presence or absence of rapamycin (C) as in (A). Expression relative to vehicle-treated, unstimulated WT cells is graphed as mean ± SEM from three independent experiments, each with three biological replicates (n = 9). Effects of ATF4 knockdown are shown in Figure 3—figure supplement 1B. (D, E) Representative immunoblots of Tsc2-/- MEFs treated with vehicle or rapamycin as in (A) or serum-deprived WT MEFs stimulated with insulin (500 nM, 24 hr) following 30 min pretreatment with vehicle or rapamycin (20 nM), with biological duplicates shown for each condition. Quantification provided in Figure 3—figure supplement 1C, D. (F) Row-normalized heatmaps of NanoString gene expression data for transcripts in the functional groups from (A) found to be significantly (p<0.05) induced in eIF2αA/A MEFs treated with insulin (500 nM, 16 hr) following 30 min pretreatment with vehicle or rapamycin (20 nM) (n = 2). Genes are ranked by category in order of most significantly increased with insulin for each group. The heatmap values are provided in Figure 3—source data 1. Immunoblots validating that these cells are defective in the integrated stress response and qPCR validation of representative genes are provided in Figure 3—figure supplement 1E, F. (G) Representative immunoblot of cells treated as in (F), with biological duplicates shown for each condition. (H) Representative immunoblot of eIF2αA/A MEFs transfected with siRNAs targeting Atf4, Tsc2, or non-targeting controls (CT) prior to serum starvation for 16 hr. (I, J) Representative immunoblot of serum-deprived LNCaP cells treated with vehicle or rapamycin (20 nM, 16 hr) (I) or Atf4 siRNAs versus non-targeting controls (siCT) (J), with biological duplicates shown for each. (K, L) qPCR analysis of the indicated transcripts in LNCaP cells serum-starved in the presence of vehicle or rapamycin (20 nM, 16 hr) (K) or transfected with ATF4 siRNAs or non-targeting controls (siCT) and serum-starved for 16 hr (L). Expression relative to vehicle-treated cells is graphed as mean ± SEM from two independent experiments, with three biological replicates each (n = 6). Immunoblots and qPCR analysis for PC3 cells treated as in (I–L) are provided in Figure 3—figure supplement 1G–J, and effects of c-Myc knockdown on representative gene targets are shown in Figure 3—figure supplement 1K, L. *p<0.05, **p<0.01, ***p<0.001, ns = not significant. One-way analysis of variance with Holm–Sidak method for multiple comparisons was used to determine statistical significance for (B, C). Unpaired two-tailed t-test was used to determine statistical significance for (F, K, L). (D, E, G, H, I, J) are representative of at least two independent experiments.
-
Figure 3—source data 1
Nanonstring data supporting Figure 3.
- https://cdn.elifesciences.org/articles/63326/elife-63326-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Supplmental data supporting Figure 3.
(A) Representative immunoblots corresponding to NanoString heatmaps depicted in Figure 3A, with biological duplicates shown. (B) qPCR analysis of the indicated transcripts in Tsc2-/-mouse embryo fibroblasts (MEFs) transfected with siRNAs as described in Figure 3A. Expression relative to non-targeting control (siCT) is graphed as mean ± SEM from three independent experiments, each with three biological replicates (n = 9). (C, D) Quantification of immunoblots shown in Figure 3D, E. (E) Representative immunoblot of eIF2αA/A MEFs treated with vehicle or tunicamycin (2 µg/mL, 4 hr). (F) qPCR analysis of the indicated transcripts in eIF2αA/A MEFs treated as described in Figure 3F. Expression relative to vehicle-treated, unstimulated cells is graphed as mean ± SEM from three independent experiments, each with three biological replicates (n = 9). (G, H) Representative immunoblots of serum-deprived PC3 cells treated with vehicle or rapamycin (20 nM, 16 hr) (G) or transfected with Atf4 siRNAs or non-targeting controls (siCT) prior to serum deprivation (16 hr) (H), with biological duplicates for each condition shown. (I, J) qPCR analysis of the indicated transcripts in cells treated as described in (G, H). (K) Representative immunoblots of Tsc2-/- MEFs transfected with control siRNAs (siCT) or those targeting Atf4 or c-Myc prior to 16 hr serum deprivation. (L) qPCR analysis of the indicated transcripts in cells transfected as described in (K). Expression relative to siCT transfected cells is graphed as mean ± SEM from two independent experiments, each with three biological replicates (n = 6). (A, E, G, H, K) are representative of at least two independent experiments. *p<0.05, **p<0.01, ***p<0.001, ns = not significant, calculated in (B, D, F, L) via one-way analysis of variance with Holm–Sidak method for multiple comparisons and (C, I, J) via unpaired two-tailed t-test.
Figure 4 with 1 supplement
Use of activating transcription factor 4 (ATF4) knockout cells and a rapamycin-resistant ATF4 to validate ATF4 targets regulated by mechanistic target of rapamycin complex 1 signaling.
(A) Schematic of ATF4 transcript, including upstream open reading frames (uORFs), coding sequence (CDS), and DNA-binding domain (DNABD), highlighting location of CRISPRn guides biallelic location of ATF4 mutations generated in Tsc2-/- mouse embryo fibroblasts (MEFs). (B, C) Representative immunoblots of serum-deprived Tsc2-/- (wild-type [WT]) MEFs or Tsc2-/- Atf4-/- MEFs with stable expression of cDNAs encoding GFP, ATF4 lacking its 5′-UTR, or a DNABD mutant (DBD) of this ATF4 left untreated (B) or treated with vehicle or rapamycin (20 nM, 16 hr) (C), with biological duplicates shown for each condition. Immunoblots of proteins encoded by ATF4 gene targets in these cells are provided in Figure 4—figure supplement 1. (D) qPCR analysis of the indicated transcripts from cells treated as in (C). Expression relative to WT vehicle-treated cells is graphed as the log2 mean ± SD from a representative experiment with three biological replicates (n = 3). *p<0.05, **p<0.01, ***p<0.001, ns = not significant, calculated via one-way analysis of variance with Holm–Sidak method for multiple comparisons. (B–D) are representative of at least two independent experiments.
Figure 4—figure supplement 1
Supplemental data supporting Figure 4.
Representative immunoblots of serum-deprived Tsc2-/- mouse embryo fibroblasts (MEFs) (Atf4 wild-type) and Tsc2-/- Atf4-/- MEFs with stable expression of cDNAs encoding GFP, activating transcription factor 4 (ATF4) lacking its 5′-UTR, or a DNABD mutant (DBD) of this ATF4 treated with vehicle or rapamycin (20 nM, 16 hr), with biological duplicates for each condition shown.
Figure 5 with 1 supplement
Activation of activating transcription factor 4 (ATF4) contributes to the induction of protein synthesis downstream of mechanistic target of rapamycin complex 1.
(A, B) Representative autoradiogram and immunoblot of wild-type (WT) and Tsc2-/- mouse embryo fibroblasts (MEFs) transfected with siRNAs targeting Atf4 or Rheb1 and Rhebl1 or non-targeting controls (siCT) and serum-deprived for 16 hr with a pulse label of [35S]-methionine for the final 20 min (A) and quantified in (B). Biological triplicates from a representative experiment are shown in (A). (B) is graphed as mean ± SEM from two independent experiments, each with three biological replicates (n = 6). Lack of effect of ATF4 knockdown on eIF2α phosphorylation is shown in Figure 5—figure supplement 1A. (C, D) Representative autoradiogram and immunoblot of serum-deprived Tsc2-/- MEFs (WT) or Tsc2-/- Atf4-/- MEFs with stable expression of cDNAs encoding GFP or ATF4 lacking its 5′-UTR treated with vehicle or rapamycin (20 nM, 16 hr) with a pulse label of [35S]-methionine for the final 20 min (C) and quantified in (D). Biological triplicates from a representative experiment are shown in (C). (D) is graphed as mean ± SEM from two independent experiments, each with three biological replicates (n = 6). Measurement of methionine uptake in these cells is provided in Figure 5—figure supplement 1B, and effects of ATF4 knockout on protein synthesis in growth factor-stimulated WT MEFs are shown in Figure 5—figure supplement 1C, D. (B,D) *p<0.05, **p<0.01, ***p<0.001, ns = not significant, calculated via one-way analysis of variance with Holm–Sidak method for multiple comparisons.
Figure 5—figure supplement 1
Supplemental data supporting Figure 5.
(A) Representative immunoblots of Tsc2-/- mouse embryo fibroblasts (MEFs) transfected with Atf4, Rheb, or non-targeting control (siCT) siRNAs prior to serum starvation for 16 hr, with biological duplicates shown. Data is representative of at least three independent experiments. (B) Cellular methionine uptake in serum-deprived Tsc2-/- MEFs (Atf4 wild-type [WT]) andTsc2-/- Atf4-/- MEFs with stable expression of cDNAs encoding GFP or activating transcription factor 4 was assayed and graphed as mean ± SEM relative to WT cells with data from two independent experiments, with three biological replicates each (n = 6). (C, D) Representative autoradiogram and immunoblots of protein extracts from Atf4+/+ and Atf4-/- MEFs grown in the presence of serum and treated with vehicle (Veh) or rapamycin (20 nM, Rap, 16 hr) and pulse labeled with [35S]-methionine for the final 20 min, with biological duplicates from a representative experiment shown (C) and autoradiograms quantified and graphed as mean ± SEM from two independent experiments, each with two biological replicates (n = 4) (D). *p<0.05, **p<0.01, ***p<0.0001, ns = not significant, calculated for (B, D) via one-way analysis of variance with Holm–Sidak method for multiple comparisons.
Figure 6 with 1 supplement
Mechanistic target of rapamycin complex 1 (mTORC1) regulates cystine uptake through activating transcription factor 4 (ATF4) and its target SLC7A11.
(A) Schematic of transporter xCT, encoded by Slc7a11, which heterodimerizes with SLC3A2 to serve as a cystine (Cys2)/glutamate anti-porter. Cystine is reduced to cysteine (Cys), which is essential for glutathione synthesis. Cysteine transport is mediated by neutral amino acid trasporters distinct from xCT. The targets of erastin and buthionine-sulfoximine, two compounds used in this study, are also depicted. (B, C) qPCR analysis of Slc7a11 (B) or Slc3a2 (C) in serum-deprived Tsc2-/- mouse embryo fibroblasts (MEFs) (wild-type [WT]) and Tsc2-/- Atf4-/- MEFs with stable expression of cDNAs encoding GFP (control), ATF4 lacking its 5′-UTR, or a DNABD mutant (DBD) of this ATF4 treated with vehicle or rapamycin (20 nM, 16 hr). Expression relative to WT vehicle-treated cells is graphed as the log2 mean ± SD from a representative experiment with three biological replicates (n = 3). (D–F) Representative immunoblots of serum-deprived Tsc2-/- MEFs (D), insulin-stimulated (500 nM, 24 hr) WT MEFs (E), or serum-deprived LNCaP cells (F) treated 24 hr (D, E) or 16 hr (F) with vehicle, rapamycin (20 nM), or Torin1 (250 nM), shown with biological duplicates. The SLC7A11 antibody is validated for use in MEFs in Figure 6—figure supplement 1A, corresponding immunoblots quantified in Figure 6—figure supplement 1B, C, F. Effects of ATF4 knockdown and rapamycin on SLC7A11 transcripts in LNCaP and PC3 cells are shown in Figure 6—figure supplement 1D, E, and corresponding immunoblots and protein quantification are provided in Figure 6—figure supplement 1G, H. (G, H) Representative growth curves of Tsc2-/- Atf4-/- MEFs with stable expression of GFP, ATF4, or ATF4DBD grown in 10% dialyzed fetal bovine serum (FBS) with Dulbecco’s Modified Eagle’s Medium (DMEM) (G) or DMEM supplemented with cysteine alone (Cys, 1 mM), nonessential amino acids (100 μM each) lacking cysteine (NEAA-Cys), or nonessential amino acids plus either cysteine (1 mM, NEAA+Cys), or cystine (0.5 mM, NEAA+Cys2) (H). Mean cell numbers ± SD relative to day 0 are graphed from three biological replicates (n = 3). (I) Cell death of Tsc2-/- Atf4-/- MEFs with stable expression of cDNAs encoding GFP, ATF4, or SLC7A11 cultured in DMEM with 10% dialyzed FBS was quantified by annexin V and propidium iodide (PI) staining after 72 hr and graphed as the mean percentage of total cells ± SD from three biological replicates (n = 3). (J) Cystine uptake in serum-deprived Tsc2-/- MEFs treated with vehicle, rapamycin (20 nM), or erastin (10 μM) for 16 hr is graphed as the mean ± SEM radiolabel incorporation from C14-cystine over the final 10 min relative to vehicle-treated cells from two independent experiments, with three biological replicates each (n = 6). The effect of mTOR inhibitors on cystine uptake in littermate-derived Rictor+/+ and Rictor-/- MEFs, and corresponding immunoblots, is shown in Figure 6—figure supplement 1I, J. (K) Cystine uptake in serum-deprived WT and Atf4-/- MEFs pretreated 30 min with vehicle or rapamycin (20 nM) prior to insulin stimulation (500 nM, 24 hr) or treated with erastin (10 μM, 30 min) was assayed and graphed as in (J) relative to vehicle-treated WT cells with data from three independent experiments, with three biological replicates each (n = 9). (L) Cystine uptake in serum-deprived Tsc2-/- MEFs (WT) andTsc2-/- Atf4-/- MEFs with stable expression of cDNAs encoding GFP or ATF4 treated with vehicle or rapamycin (20 nM) for 16 hr was assayed and graphed as in (J) relative to vehicle-treated WT cells with data from two independent experiments, with three biological replicates each (n = 6). (B–I) are representative of at least two independent experiments. *p<0.05, **p<0.01, ***p<0.001, ns = not significant, calculated in (B, C, I, J, K, L) via one-way analysis of variance with Holm–Sidak method for multiple comparisons and in (G, H) via unpaired two-tailed t-test. For (I), the sum of annexin V+/PI-, annexin V-/PI+, and annexin V+/PI+ populations were used for comparisons to the annexin V-/P- population.
Figure 6—figure supplement 1
Supplemental data supporting Figure 6.
(A) Representative immunoblot of Tsc2-/- mouse embryo fibroblasts (MEFs) transfected with Slc7a11 or non-targeting control (siCT) siRNAs prior to serum starvation for 16 hr. (B, C) Quantification of representative immunoblots from Figure 6D, E. (D, E) qPCR analysis of SLC7A11 transcripts in serum-deprived LNCaP (D) or PC3 (E) cells either transfected with siRNAs targeting ATF4 or non-targeting controls (siCT) (left) or treated with vehicle or rapamycin (20 nM, 16 hr) (right). Expression relative to siCT or vehicle-treated cells is graphed as mean ± SEM from two independent experiments, each with three biological replicates (n = 6). (F) Quantification of representative immunoblots shown in Figure 6F. (G, H) Representative immunoblot of serum-deprived PC3 cells treated (16 hr) with vehicle, rapamycin (20 nM), or Torin1 (250 nM), shown with biological duplicates (G) and quantified in (H). (I, J) Cystine uptake in Rictor+/+ and Rictor-/- MEFs grown in full serum and treated with vehicle, rapamycin (20 nM, 24 hr), Torin1 (250 nM, 24 hr), or erastin (10 μM, 30 min) was assayed and graphed as in Figure 6J relative to vehicle-treated Rictor+/+ cells with data from two independent experiments, with three biological replicates each (n = 6). Representative immunoblots shown in (J). (A, G, J) are representative of two independent experiments. *p<0.05, **p<0.01, ***p<0.001, ns = not significant, calculated for (D, E) via unpaired two-tailed t-test and (B, C, F, H, I) via one-way analysis of variance with Holm–Sidak method for multiple comparisons.
Figure 7 with 1 supplement
Mechanistic target of rapamycin complex 1 (mTORC1) regulates cellular glutathione levels through activating transcription factor 4 (ATF4) and SLC7A11-mediated cystine uptake.
(A) Total glutathione in serum-deprived Tsc2-/-mouse embryo fibroblasts (MEFs) treated with rapamycin (20 nM), Torin1 (250 nM), or buthionine-sulfoximine (BSO) (10 μM) for 16 hr is graphed as mean ± SEM relative to vehicle-treated cells from three independent experiments, each with three biological replicates (n = 9). Relative abundance of reduced (GSH) and oxidized (GSSG) glutathione from this experiment is shown in Figure 7—figure supplement 1A. (B) Relative total glutathione in serum-deprived Tsc2-/- MEFs with stable reconstitution of a cDNA encoding TSC2 or empty vector (EV) control is graphed as mean ± SD from a representative experiment with three biological replicates (n = 3). (C, D) Immunoblot (C) and relative glutathione levels measured by LC-MS/MS (D) from Tsc2-/- ELT3 xenograft tumors resected from mice treated for 5 days with vehicle or rapamycin (1 mg/kg on days 1, 3, and 5) (n = 3 mice/group). Relative glutathione levels from rapamycin-treated human TSC2-/- tumor cells are shown in Figure 7—figure supplement 1B. (E) Total glutathione in serum-deprived LNCaP (left) and PC3 (right) cells treated with vehicle, rapamycin (20 nM), Torin1 (250 nM), or BSO (50 μM) for 24 hr is graphed as mean ± SD relative to vehicle-treated cells from a representative experiment with three biological replicates (n = 3). (F) Total glutathione in serum-deprived Tsc2-/- MEFs (Atf4 wild-type [WT]) and Tsc2-/- Atf4-/- MEFs with stable expression of cDNAs encoding GFP (control), ATF4, ATF4DBD, or SLC7A11 grown in Dulbecco’s Modified Eagle’s Medium and supplemented, where indicated, with cysteine (1 mM, Cys) or cystine (0.5 mM, Cys2) is graphed as mean ± SD relative to WT cells from a representative experiment with three biological replicates (n = 3). Relative glutathione in these cells supplemented with nonessential amino acid with or without Cys, measured by LC-MS/MS, is shown in Figure 7—figure supplement 1C. (G) Total glutathione in serum-deprived Atf4+/+ and Atf4-/- MEFs pretreated 30 min with vehicle or rapamycin (20 nM) prior to insulin stimulation (500 nM, 24 hr) or treated with BSO (10 μM, 24 hr) is graphed as mean ± SEM relative to unstimulated Atf4+/+ cells from two independent experiments, with three biological replicates each (n = 6). (H) Total glutathione in serum-deprived Tsc2-/- MEFs (Atf4 WT) and Tsc2-/- Atf4-/- MEFs with stable expression of cDNAs encoding GFP, ATF4 lacking its 5′-UTR, or a DNABD mutant (DBD) of this ATF4 treated with vehicle or rapamycin (20 nM) for 16 hr is graphed as mean ± SD relative to vehicle-treated WT cells from a representative experiment with three biological replicates (n = 3). Effects of mTORC1 signaling and ATF4 on GCLC and GCLM transcript and protein levels are shown in Figure 7—figure supplement 1D–G. (B, E, F, H) are representative of at least two independent experiments. *p<0.05, **p<0.01, ***p<0.001, ns = not significant, calculated in (A, E, F, G, H) via one-way analysis of variance with Holm–Sidak method for multiple comparisons and in (B, D) via unpaired two-tailed t-test.
Figure 7—figure supplement 1
Supplemental data supporting Figure 7.
(A) Relative GSH and GSSG levels in serum-deprived Tsc2-/-mouse embryo fibroblasts (MEFs) treated with rapamycin (20 nM,16 h), Torin1 (250 nM, 16 hr), or buthionine-sulfoximine (10 μM, 16 hr). GSH and GSSG levels relative to vehicle-treated cells are graphed as mean ± SEM from three independent experiments, with three biological replicates each (n = 9). (B) Total glutathione levels in human TSC2-/- angiomyolipoma cells treated with vehicle or rapamycin (20 nM, 24 hr) measured by LC-MS/MS (mean ± SD, n = 3). (C) Normalized peak area of reduced glutathione from LC-MS/MS analysis of serum-deprived Tsc2-/- Atf4-/- MEFs with addback of GFP or activating transcription factor 4 (ATF4) in the presence of supplemented cysteine (1 mM), nonessential amino acids without cysteine (100 µM each), or nonessential amino acids (1 mM cysteine or 100 µM) (mean ± SD, n = 3). (D, E) Transcript abundance of Gclc and Gclm in serum-deprived Tsc2-/- MEFs treated with vehicle or rapamycin (20 nM, 16 hr) (D) or transfected with siRNAs targeting Atf4 or non-targeting controls (siCT) (E). Expression relative to vehicle (D) or siCT(E) is graphed as mean ± SEM from two independent experiments, each with three biological replicates (n = 6). (F, G) Representative immunoblots of cells treated as in Figure 7G, H, except where indicated in (F), cells were treated with Torin1 (250 nM), with biological duplicates provided for each condition. (C, F, G) are representative of two independent experiments. *p<0.05, **p<0.01, ***p<0.001, ns = not significant calculated for (A, C) via one-way analysis of variance with Holm–Sidak method for multiple comparisons and unpaired two-tailed t-test for (B, D, E).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological sample (Mus musculus) | ELT3 tumor samples | PMID:29056426 | Valvezan et al., 2017 | |
| Cell line (M. musculus) | WT and Tsc2-/- MEFs | PMID:14561707 | David Kwiatkowski | |
| Cell line (M. musculus) | EIF2aA/A MEFs | PMID:11430820 | Randal Kaufman | |
| Cell line (M. musculus) | Rictor+/+ and Rictor-/- MEFs | PMID:17141160 | D.A. Guertin and D.M. Sabatini | |
| Cell line (Homo sapiens) | PC3 | ATCC | CRL-1435 RRID:CVCL_0035 | |
| Cell line (H. sapiens) | LNCaP | ATCC | CRL-1740 RRID:CVCL_1379 | |
| Cell line (M. musculus) | Tsc2+/+ Atf4-/- MEFs | This paper | CRISPR-Cas9n generated – see Materials and methods | |
| Cell line (M. musculus) | Tsc2-/- Atf4-/- MEFs | This paper | CRISPR-Cas9n generated – see Materials and methods | |
| Transfected construct (Aequorea victoria) | pTRIPZ-EGFP | This paper | eGFP cDNA- expressing control plasmid – see Materials and methods | |
| Transfected construct (M. musculus) | pTRIPZ-ATF4 | This paper | Rapamycin-resistant ATF4 cDNA-expressing plasmid – see Materials and methods | |
| Transfected construct (M. musculus) | pTRIPZ-ATF4DBD | This paper | ATF4 DNA-binding domain mutant cDNA-expressing plasmid – see Materials and methods | |
| Transfected construct (H. sapiens) | pTRIPZ-SLC7A11 | This paper | SLC7A11 cDNA-expressing plasmid – see Materials and methods | |
| Transfected construct (human, mouse) | Non-targeting pool for siRNA experiments | GE Life Sciences/Dharmacon | D-001810-10-50 | |
| Transfected construct (mouse) | siMyc | GE Life Sciences/Dharmacon | L-040813-00-0010 | |
| Transfected construct (mouse) | siAtf4 | GE Life Sciences/Dharmacon | L-042737-01-0020 | |
| Transfected construct (mouse) | siRheb | GE Life Sciences/Dharmacon | L-057044-00-0020 | |
| Transfected construct (mouse) | siRhebL1 | GE Life Sciences/Dharmacon | L-056074-01-0020 | |
| Transfected construct (mouse) | siTsc2 | GE Life Sciences/Dharmacon | L-047050-00-0020 | |
| Transfected construct (mouse) | siC/ebpα | GE Life Sciences/Dharmacon | L-040561-00-0005 | |
| Transfected construct (mouse) | siC/ebpβ | GE Life Sciences/Dharmacon | L-043110-00-0005 | |
| Transfected construct (mouse) | siC/ebpδ | GE Life Sciences/Dharmacon | L-060294-01-0005 | |
| Transfected construct (mouse) | siC/ebpγ | GE Life Sciences/Dharmacon | L-065627-00-0005 | |
| Transfected construct (human) | siATF4 | GE Life Sciences/Dharmacon | L-005125-00-0020 | |
| Sequenced-based reagent | qPCR primers | IDT | See table in Materials and methods | |
| Recombinant DNA reagent | ATF4 (cDNA amplified from plasmid) | Addgene | RRID:Addgene_21845 | |
| Recombinant DNA reagent | Pspax2 (plasmid) | Addgene | RRID:Addgene_12260 | |
| Recombinant DNA reagent | Pmd2.G (plasmid) | Addgene | RRID:Addgene_12259 | |
| Recombinant DNA reagent | pSpCas9n(BB)−2A-GFP (PX461) (plasmid) | Addgene | RRID:Addgene_48140 | |
| Recombinant DNA reagent | pTRIPZ (plasmid) | PMID:27088857 | Alex Toker (Beth Israel Deaconess Medical Center) | |
| Recombinant DNA reagent | GFP (cDNA amplified from plasmid) | Addgene | RRID:Addgene_19319 | |
| Recombinant DNA reagent | SLC7A11 (cDNA amplified from plasmid) | PMID:29259101 | Alex Toker (Beth Israel Deaconess Medical Center) | |
| Recombinant DNA reagent | pBabe hygro IRES-TSC2 | PMID:15150095 | David Kwiatkowski (Brigham and Women’s Hospital) | |
| Sequenced-based reagent | CRISPR-Cas9n guides for KO of ATF4 | IDT | CACCGGAGGTGGAGGGGCTATGCT; AAACAGCATAGCCCCTCCACCTCC; CACCGACAATCTGCCTTCTCCAGG; AAACCCTGGAGAAGGCAGATTGTC | |
| Sequenced-based reagent | Sequencing primers for Atf4-/- cell lines | IDT | TCGATGCTCTGTTTCGAATG; CTTCTTCCCCCTTGCCTTAC | |
| Sequenced-based reagent | Primers for site-directed mutagenesis | IDT | GCCTCCTGCTCAGCCGCCGCCGCCTCGAGGTACCCAGTGGCTGCTGTCTTGTTTTGCTCCATCT; AGATGGAGCAAAACAAGACAGCAGCCACTGGGTACCTCGAGGCGGCGGCGGCTGAGCAGGAGGC | |
| Commercial assay or kit | KOD Xtreme Hot Start DNA Polymerase | Sigma-Aldrich | 71975 | |
| Antibody | (P)-S6K1 T389 rabbit monoclonal | Cell Signaling Technologies (CST) | Cat #: 9234 RRID:AB_2269803 | 1:1000, 10 μL |
| Antibody | ATF4 rabbit monoclonal | Cell Signaling Technologies (CST) | Cat #: 11815 RRID:AB_2616025 | 1:1000, 10 μL |
| Antibody | eIF2α rabbit polyclonal | Cell Signaling Technologies | Cat #: 9722 RRID:AB_2230924 | 1:1000, 10 μL |
| Antibody | P-eIF2α S51 rabbit polyclonal | Cell Signaling Technologies | Cat #: 9721 RRID:AB_330951 | 1:1000, 10 μL |
| Antibody | S6K1 rabbit monoclonal | Cell Signaling Technologies | Cat #: 2708 RRID:AB_390722 | 1:1000, 10 μL |
| Antibody | CD98 rabbit monoclonal | Cell Signaling Technologies | Cat #: 13180 RRID:AB_2687475 | 1:1000, 10 μL |
| Antibody | PSAT1 rabbit polyclonal | Protein Tech | Cat #: 20180-1-AP RRID:AB_10665948 | 1:1000, 10 μL |
| Antibody | MTHFD2 rabbit polyclonal | Protein Tech | Cat #: 12270–1-AP RRID:AB_2147525 | 1:1000, 10 μL |
| Antibody | AARS rabbit polyclonal | Bethyl Antibodies | A303-475A-M | 1:1000, 10 μL |
| Antibody | GARS rabbit polyclonal | Bethyl Antibodies | A304-746A-M | 1:1000, 10 μL |
| Antibody | LARS rabbit polyclonal | Bethyl Antibodies | A304-316A-M | 1:1000, 10 μL |
| Antibody | XPOT rabbit polyclonal | Aviva Biotechnologies | Cat #: ARP40711_P050 RRID:AB_2048757 | 1:1000, 10 μL |
| Antibody | TSC2 rabbit monoclonal | Cell Signaling Technologies | Cat #: 4308 RRID:AB_10547134 | 1:1000, 10 μL |
| Antibody | SLC7A11 rabbit monoclonal | Abcam | Cat #: ab175186 RRID:AB_2722749 | 1:1000, 10 μL For immunoblots of WT and Tsc2-/- MEFs |
| Antibody | SLC7A11 rabbit monoclonal | Cell Signaling Technologies | Cat #: 12691 RRID:AB_2687474 | 1:1000, 10 μL For immunoblots of PC3 and LNCaP cell lines |
| Antibody | GCLC rabbit monoclonal | Abcam | ab190685 | 1:1000, 10 μL |
| Antibody | GCLM rabbit monoclonal | Abcam | Cat#: ab126704 RRID:AB_11127439 | 1:1000, 10 μL |
| Antibody | RICTOR rabbit monoclonal | Cell Signaling Technologies | Cat #: 9476 RRID:AB_10612959 | 1:1000, 10 μL |
| Antibody | RHEB rabbit monoclonal | Cell Signaling Technologies | Cat #: 13879 RRID:AB_2721022 | 1:1000, 10 μL |
| Antibody | 4EBP1 rabbit monoclonal | Cell Signaling Technologies | Cat #: 9644 RRID:AB_2097841 | 1:1000, 10 μL |
| Antibody | c-MYC rabbit polyclonal | Cell Signaling Technologies | Cat #: 9402 RRID:AB_2151827 | 1:1000, 10 μL |
| Antibody | β-Actin mouse monoclonal | Sigma | Cat #: A5316 RRID:AB_476743 | 1:5000, 2 μL |
| Antibody | HRP-conjugated anti-rabbit rabbit polyclonal | CST | Cat #: 7074 RRID:AB_2099233 | 1:5000, 2 μL |
| Antibody | HRP-conjugated anti-mouse mouse polyclonal | CST | Cat #: 7076 RRID:AB_330924 | 1:5000, 2 μL |
| Antibody | IRDye 800CW Donkey anti-Rabbit IgG rabbit polyclonal | LI-COR | Cat #: 925–32213 RRID:AB_2715510 | 1:5000, 2 μL |
| Antibody | IRDye 800CW Donkey anti-Mouse IgG mouse polyclonal | LI-COR | Cat #: 926-32212 RRID:AB_621847 | 1:5000, 2 μL |
| Chemical compound, drug | Doxycycline hydrochloride | Sigma | D3447 | |
| Chemical compound, drug | Rapamycin | LC Laboratories | R5000 | |
| Chemical compound, drug | Insulin | Alpha Diagnostic, | INSL 16 N-5 | |
| Chemical compound, drug | Tunicamycin | Sigma-Aldrich | T7765 | |
| Chemical compound, drug | Torin1 | Tocris | 4247 | |
| Chemical compound, drug | Erastin | Selleckchem | S7242 | |
| Chemical compound, drug | Buthionine-sulfoximine (BSO) | Sigma | B2515 | |
| Chemical compound, drug | Hygromycin B | Thermo Fisher Scientific | 10687010 | |
| Chemical compound, drug | Puromycin | Sigma | P8833 | |
| Chemical compound, drug | Staurosporine | Tocris | 1285 | |
| Chemical compound, drug | Cysteine | Sigma | C7477 | |
| Chemical compound, drug | Cystine | Sigma | 57579 | |
| Chemical compound, drug | 2-Mercaptoethanol | EMD Millipore | 444203 | |
| Chemical compound, drug | MEM Nonessential amino acids solution | Thermo Fisher Scientific | 11140050 | |
| Chemical compound, drug | 35S-methionine | PerkinElmer | NEG009L005MC | |
| Chemical compound, drug | L-[1, 2, 1', 2'-14C]-Cystine | PerkinElmer | NEC854010UC | |
| Commercial assay or kit | FITC Annexin V Apoptosis Detection Kit I | BD | 556547 | |
| Commercial assay or kit | GSH/GSSG-Glo Assay | Promega | V6611 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
The mTORC1-mediated activation of ATF4 promotes protein and glutathione synthesis downstream of growth signals
eLife 10:e63326.
https://doi.org/10.7554/eLife.63326
