1. Biochemistry and Chemical Biology
  2. Chromosomes and Gene Expression
Download icon

Mutations in SKI in Shprintzen–Goldberg syndrome lead to attenuated TGF-β responses through SKI stabilization

  1. Ilaria Gori
  2. Roger George
  3. Andrew G Purkiss
  4. Stephanie Strohbuecker
  5. Rebecca A Randall
  6. Roksana Ogrodowicz
  7. Virginie Carmignac
  8. Laurence Faivre
  9. Dhira Joshi
  10. Svend Kjær
  11. Caroline S Hill  Is a corresponding author
  1. Developmental Signalling Laboratory, The Francis Crick Institute, United Kingdom
  2. Structural Biology Facility, The Francis Crick Institute, United Kingdom
  3. Bioinformatics and Biostatistics Facility, The Francis Crick Institute, United Kingdom
  4. INSERM - Université de Bourgogne UMR1231 GAD, FHU-TRANSLAD, France
  5. Peptide Chemistry Facility, The Francis Crick Institute, United Kingdom
Research Article
Cite this article as: eLife 2021;10:e63545 doi: 10.7554/eLife.63545
7 figures, 1 video, 1 table and 1 additional file

Figures

Figure 1 with 1 supplement
Requirement of SMAD2 or SMAD3 and SMAD4 for SKI and SKIL degradation.

(A and C) The parental HEK293T cell line and two individual SMAD4 knockout clones (A) or two individual SMAD2, SMAD3 knockout clones, or two SMAD2 and SMAD3 double knockout clones (C) were incubated overnight with 10 μM SB-431542, washed out, then incubated with full media containing either SB-431542 or 20 ng/ml Activin A for 1 hr, as indicated. Whole-cell extracts were immunoblotted with the antibodies indicated. (B) Parental HaCaT and four individual SMAD4 knockout clones were treated as above, except that they were treated with 2 ng/ml TGF-β for 1 hr instead of Activin A. Nuclear lysates were immunoblotted using the antibodies indicated. SB, SB-431542; A, Activin A; T, TGF-β; S2, SMAD2; S3, SMAD3; S2/3, SMAD2 and SMAD3; S4, SMAD4; KO, knockout; dKO, double knockout.

Figure 1—source data 1

Sequences of knockout alleles made in HEK293T cells.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig1-data1-v2.docx
Figure 1—figure supplement 1
SMAD4 is essential for TGF-β/Activin-induced transcriptional responses.

(A and B) HEK293T (A) or HaCaT (B) parental cells and individual clones of SMAD4 knockout cells were transiently transfected with CAGA12-Luciferase together with TK-Renilla as an internal control and a plasmid expressing human SMAD4 as indicated (A and B). Cells were incubated with 0.5% fetal bovine serum-containing media overnight and then treated with 20 ng/ml Activin (A) or 2 ng/ml TGF-β (B) for 8 hr. Cell lysates were prepared and Luciferase/Renilla activity was measured. Plotted are the means ± SEM of three independent experiments. The p-values are from one-way ANOVA with Tukey’s post hoc correction. *p<0.05; ***p<0.001; ****p<0.0001. (C) HaCaT parental and four independent clones of SMAD4 knockout cells were either untreated or incubated with either 2 ng/ml TGF-β or 20 ng/ml BMP4 for 1 hr (SMAD7, JUNB, ID1, and ID3) or 6 hr (SERPINE1 and SKIL). Total RNA was extracted and qPCR was used to assess the levels of mRNA for the genes shown. The data are the average of three or four experiments ± SEM. The p-values are from one-way ANOVA with Tukey’s post hoc correction. **p<0.01; ***p<0.001; ****p<0.0001. Par, parental; S4 KO, SMAD4 knockout.

Figure 1—figure supplement 1—source data 1

Luciferase assay data for HEK293T S4 KO clones, as presented in Figure 1—figure supplement 1A.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig1-figsupp1-data1-v2.xlsx
Figure 1—figure supplement 1—source data 2

Luciferase assay data for HaCaT S4 KO clones, as presented in Figure 1—figure supplement 1B.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig1-figsupp1-data2-v2.xlsx
Figure 1—figure supplement 1—source data 3

qPCR data for HaCaT S4 KO clones, as presented in Figure 1—figure supplement 1C.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig1-figsupp1-data3-v2.xlsx
Figure 2 with 1 supplement
Characterization of the role of SMAD4 in TGF-β-induced SKIL degradation.

(A–C) HaCaT SMAD4 knockout (S4 KO) cells were stably transfected with EGFP alone, or EGFP SMAD4 (WT) or with four different EGFP-SMAD4 mutants (D351H, D537Y, which abolish interaction with the R-SMADs, and A433E and I435Y, which do not interact with SKIL). (A) Cells were incubated overnight with 10 µM SB-431542, washed out and pre-incubated with 25 μM MG-132 for 3 hr, and then treated either with 10 μM SB-431542 or 2 ng/ml TGF-β for 1 hr. Whole-cell extracts were immunoprecipitated (IP) with GFP-trap agarose beads. The IPs were immunoblotted using the antibodies shown. Inputs are shown below. (B) Nuclear lysates were prepared from the HaCaT S4 KO cells stably transfected with EGFP alone or with EGFP-SMAD4 constructs as indicated, treated as in (A), but without the MG-132 step and immunoblotted using the antibodies shown. On the right the quantifications are the normalized average ± SEM of five independent experiments. The quantifications are expressed as fold changes relative to SB-431542-treated S4 KO cells. (C) Levels of SKIL in the EGFP-positive S4 KO rescue cell lines treated as in (B), assayed by flow cytometry. Each panel shows an overlay of the indicated treatment conditions. The red line indicates the SB-431542-treated sample, whereas the cyan line indicates the TGF-β-treated sample. Quantifications are shown bottom right. For each group, the percentage of the median fluorescence intensity normalized to the SB-431542-treated sample is quantified. Data are the mean ± SEM of five independent experiments. The p-values are from one-way ANOVA with Sidak’s post hoc correction *p<0.05; ****p<0.0001. SB, SB-431542; T, TGF-β.

Figure 2—source data 1

Quantification of Western blot for HaCaT S4 KO rescue cell lines, as presented in Figure 2B.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig2-data1-v2.xlsx
Figure 2—source data 2

Flow cytometry data for HaCaT S4 KO rescue cell lines, as presented in Figure 2C.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig2-data2-v2.xlsx
Figure 2—figure supplement 1
Transcriptional activity of the SMAD4 mutants compared to WT SMAD4.

(A) Parental HaCaT, SMAD4 knockout clone 2 stably transfected with EGFP alone (S4 KO), or with EGFP fusions of WT SMAD4 or the four indicated SMAD4 mutants were transiently transfected with CAGA12-Luciferase together with TK-Renilla as an internal control. Cells were untreated or treated with 2 ng/ml TGF-β for 8 hr. Luciferase/Renilla activity was measured on whole-cell lysates. Plotted are the means ± SEM of four independent experiments. The p-values are from one-way ANOVA with Tukey’s post hoc correction. ****p<0.0001. (B) Parental HaCaT and SMAD4 knockout clone 2 cells stably transfected as in (A) were incubated overnight with 10 μM SB-431542, washed out, and then retreated with SB-431542 (SB) or with 2 ng/ml TGF-β (T) for 6 hr. Total RNA was extracted and qPCR was performed for the genes shown. Plotted are the means ± SEM of four independent experiments. The p-values are from two-way ANOVA with Sidak’s post hoc test. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. (C) Levels of SKIL in parental HaCaT cells were measured by flow cytometry 1 hr after incubation with 10 μM SB-431542 or after treatment for 1 hr with 2 ng/ml TGF-β. The panel shows an overlay of the indicated treatment conditions. The red line indicates the SB-431542-treated sample, while the cyan line represents the TGF-β-treated sample.

Figure 2—figure supplement 1—source data 1

Luciferase assay data for HaCaT S4 KO rescue cell lines, as presented in Figure 2—figure supplement 1A.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig2-figsupp1-data1-v2.xlsx
Figure 2—figure supplement 1—source data 2

qPCR data for HaCaT S4 KO rescue cell lines, as presented in Figure 2—figure supplement 1B.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig2-figsupp1-data2-v2.xlsx
Visualization of TGF-β-induced SKIL degradation.

HaCaT SMAD4 knockout (S4 KO) cells or those stably expressing EGFP SMAD4 WT or EGFP SMAD4 mutants were incubated overnight with 10 μM SB-431542, washed out, and incubated for 1 hr with 10 µM SB-431542 or with 2 ng/ml TGF-β. Cells were fixed and stained for EGFP (for SMAD4), SKIL, and with DAPI (blue) to mark nuclei and imaged by confocal microscopy. The merge combines SKIL, SMAD4, and DAPI staining. Arrows indicate examples of EGFP-expressing cells and corresponding levels of nuclear SKIL. Scale bar corresponds to 50 µm.

Figure 4 with 1 supplement
SGS mutations inhibit binding of SKI to SMAD2/3.

(A and B) HaCaT cells were treated or not with 2 ng/ml TGF-β. A peptide pulldown assay was performed on whole cells extracts and pulldowns were immunoblotted with the antibodies indicated. Inputs are shown on the right. (A) Wild-type (WT) SKI peptides corresponding to amino acids 11–45 or containing SGS point mutations as shown in red were used. (B) WT SKIL peptides corresponding amino acids 80–120 or containing mutations (in red) corresponding to SGS mutations in SKI were used. (C) WT SKI peptides or those containing SGS point mutations were used in pulldown assays with whole-cell extracts of SMAD2-null mouse embryonic fibroblasts that express just the MH2 domain of SMAD2 (MEF SMAD2Δex2) (Das et al., 2009), treated with 2 ng/ml TGF-β. The untreated sample is only shown for the WT SKI peptide. A PSMAD2 immunoblot is shown. (D) A recombinant trimer of phosphorylated SMAD2 MH2 domain was used in a peptide pulldown assay with WT and G34D SKI peptides. A PSMAD2 immunoblot is shown, with inputs on the right. (E) Mutational peptide array of SKI peptides (amino acids 11–45), mutated at all residues between amino acids 19 and 35, was probed with a recombinant PSMAD3–SMAD4 complex, which was visualized using a SMAD2/3 antibody conjugated to Alexa 488. On each row, the indicated amino acid is substituted for every other amino acid. A representative example is shown. See Figure 4—figure supplement 1C and Figure 4—source data 2 for quantification of the peptide arrays.

Figure 4—figure supplement 1
SGS mutations in SKI.

(A) Alignment of the first 317 amino acids of human SKI with the corresponding regions of mouse SKI and human SKIL is shown. Key domains are shown: pink corresponds to the R-SMAD-binding domain; blue, DHD domain; purple, SAND domain. SGS mutations are indicated by arrows. (B) SKI peptides corresponding to amino acids 11–51 and truncated versions as shown were analyzed in peptide pulldown assays with whole cell extracts from HaCaT cells treated with or without 2 ng/ml TGF-β. The pulldowns were immunoblotted using the antibodies shown. Inputs are shown on the right. (C) Quantification of the mutational peptide array of SKI peptides (amino acids 11–45), a representative of which is shown in Figure 4E. Each intensity measure is normalized to the average intensity of 60 positive controls of the WT peptide after subtracting the background, measured from the average intensity of 60 negative controls (truncated SKI peptide C as indicated in B). The values shown are the mean normalized intensities for each mutated peptide. See also Figure 4—source data 2.

Figure 5 with 1 supplement
Crystal structure of PSMAD2 MH2 domain and N-terminal SKI peptide.

(A) Crystal structure of the phosphorylated SMAD2 MH2 domain trimer (the three monomers are shown in bright green, cyan, and olive) with the N-terminal SKI peptide amino acids 11–45 (magenta). A ribbon representation is shown. The C-terminal phosphates are indicated with a ball and stick representation (red and magenta). (B–F) Close ups on key residues for SKI binding. SKI residues are shown in magenta, and SMAD2 residues are in green. In (B–D), a ribbon representation is shown. In (E and F), SMAD2 is shown as a surface representation and SKI as a ribbon. (G) A detail from the structure of monomeric SMAD2 MH2 domain with a peptide from ZFYVE9 (formerly called SARA) (Wu et al., 2000). Note that the β1’ strand that contains Tyr268 is locked in a hydrophobic pocket, forcing Trp448 into flattened orientation, incompatible with SKI binding. (H) A detail from the structure in (A) indicating how SMAD2 complex formation shifts the position of the β1’ strand and more particularly, Tyr268, allowing Trp448 to flip 90°, enabling it to stack with SKI residues Phe24 and Pro35.

Figure 5—source data 1

Structure validation report for crystal structure (ID: 6ZVQ).

https://cdn.elifesciences.org/articles/63545/elife-63545-fig5-data1-v2.pdf
Figure 5—figure supplement 1
Analysis of the phosphorylated SMAD2 MH2 domain complex used for structural studies.

(A) The trimeric arrangement of the phosphorylated SMAD2 MH2 domain was confirmed by SEC-MALLS. The SEC-MALLS chromatogram is shown. The calculated molecular weight was 81 kDa, which was very close to the expected molecular weight of 78.5 kDa. (B) The interaction between the phosphorylated SMAD2 MH2 domain and the SKI peptide (amino acids 11–45) was measured by biolayer interferometry. The biosensors were loaded with biotinylated SKI peptide and incubated with different concentrations of phosphorylated SMAD2 MH2 domain as shown. The calculated Kd was 1.33 × 10−9 ± 2.12 x10−11 M. (C) Data collection and refinement statistics for the crystal structure of the phosphorylated SMAD2 MH2 domain complex with the N-terminal region of SKI shown in Figure 5A.

Figure 6 with 1 supplement
Knockin of an SGS mutation into SKI in HEK293T cells inhibits SKI degradation and inhibits Activin-induced transcription.

(A) Parental HEK293T and three independent P35S SKI knockin clones were incubated overnight with 10 μM SB-431542, washed out, and treated for 3 hr with 25 μM MG-132 and then with either SB-431542 or 20 ng/ml Activin A for an additional 1 hr. Whole-cell lysates were immunoprecipitated (IP) with SKI antibody or beads alone (Be). The IPs were immunoblotted using the antibodies shown. Inputs are shown below. (B) Parental HEK293T and four independent P35S SKI knockin clones were incubated with 10 μM SB-431542 overnight, washed out, and incubated with either SB-431542 or 20 ng/ml Activin for the times indicated. Whole-cell lysates were immunoblotted using the antibodies indicated. (C) Cells were treated as in (B), and nuclear lysates were prepared and analyzed by DNA pulldown assay using the wild-type c-Jun SBE oligonucleotide or a version mutated at the SMAD3–SMAD4 binding sites (top panel). Inputs are shown in the bottom panel. HEK293T parental and two independent P35S SKI knockin clones were stably transfected with the CAGA12-Luciferase reporters (D) or the BRE-Luciferase reporter (E) with TK-Renilla as an internal control. Cells were serum starved with media containing 0.5% fetal bovine serum and 10 μM SB-431542 overnight. Subsequently, cells were washed and treated with Activin A (D) or BMP4 (E) at the concentrations indicated for 8 hr. Cell lysates were prepared and assayed for Luciferase and Renilla activity. Plotted are the means and SEM of seven (D) or four (E) independent experiments, with the ratio of Luciferase:Renilla shown. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. The p-values are from two-way ANOVA with Tukey’s post hoc test. A, Activin; SB, SB-431542; Par, parental.

Figure 6—source data 1

Luciferase assays for Activin A-induced HEK293T P35S SKI clones, as presented in Figure 6D.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig6-data1-v2.xlsx
Figure 6—source data 2

Luciferase assays for BMP4-induced HEK293T P35S SKI clones, as presented in Figure 6E.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig6-data2-v2.xlsx
Figure 6—figure supplement 1
Mutation of the R-SMAD binding domain or SAND domain in SKI/SKIL prevents ligand-induced SKI/SKIL degradation.

(A) Characterization of P35S SKI mutation in HEK293T cells compared to parental cells by PCR followed by Sanger sequencing analysis. The black box indicates the change in nucleotides that give rise to the desired mutation. The details of the knocked in changes are given below. (B) HEK293T parental and SMAD4 knockout (S4 KO) cells were transiently transfected with FLAG-SKIL WT or FLAG-SKIL G103V (ΔS2/3) or FLAG-SKIL R314A, T315A, H317A, and W318E (ΔS4) as indicated, or left untransfected (U). Cells were incubated overnight with 10 μM SB-431542, then washed out, and pre-treated with 25 μM MG-132 for 3 hr, followed by incubation with SB-431542 or with 20 ng/ml Activin A for 1 hr. Whole cell extracts were immunoprecipitated (IP) with FLAG beads. The IPs were immunoblotted using the antibodies shown. Inputs are shown below. (C) HEK293T cells were untransfected (U) or transfected with the plasmids indicated as in (B). Cells were incubated overnight with 10 μM SB-431542, then washed out, and subsequently treated with SB-431542 or with 20 ng/ml Activin A for the times shown. Whole-cell extracts were immunoblotted using the antibodies shown. SB, SB-431542; A, Activin A.

Figure 7 with 2 supplements
SGS mutations in SKI inhibit TGF-β-induced transcriptional responses in fibroblasts derived from SGS patients.

(A) Fibroblasts derived from a healthy subject carrying WT SKI and from two SGS patients carrying the L32V or the ΔS94-97 heterozygous mutations in SKI were incubated overnight with 10 μM SB-431542, washed out, and either re-incubated with SB-431542 or 2 ng/ml TGF-β for the times indicated. Whole-cell lysates were immunoblotted using the antibodies indicated. (B) Hierarchically clustered heatmaps of log2FC values (relative to the SB-431542-treated samples) showing the expression of TGF-β-responsive genes in the healthy fibroblasts and the L32V SKI fibroblasts after 1 hr and 8 hr of TGF-β treatment, analyzed by RNA-seq. Four biological replicates per condition were analyzed. The genes shown are those for which the TGF-β inductions were statistically significant in the healthy fibroblasts, but non-significant in the L32V fibroblasts. (C) The same data as in (B) are presented as box plots. (D) Model for the mechanism of action of WT SKI and mutated SKI. The left panel shows the unstimulated condition. In the nuclei, SKI (blue) is complexed with RNF111 (pink) and is also bound to DNA at SBEs with SMAD4 (green) forming a transcriptionally repressive complex with other transcriptional repressors (maroon). In the middle panel, TGF-β/Activin stimulation induces the formation of phosphorylated R-SMAD–SMAD4 complexes (yellow and green), which induce WT SKI degradation by RNF111. This allows an active PSMAD3–SMAD4 complex to bind SBEs and activate transcription. In the right panel, SGS-mutated SKI (light blue) is not degraded upon TGF-β/Activin stimulation, due to its inability to interact with PSMAD2 or PSMAD3. It therefore remains bound to SMAD4 on DNA, leading to attenuated transcriptional responses.

Figure 7—figure supplement 1
Dermal fibroblasts from SGS patients exhibit an attenuated TGF-β transcriptional response.

(A) Principal component analysis (PCA) plot is shown for RNA-seq on normal fibroblasts containing WT SKI, and fibroblasts from SGS patients containing either the L32V SKI mutation or the ΔS94-97 SKI mutation, treated as indicated. PCA measures sample to sample variation using rlog transformed read count of all genes expressed above one read in at least one sample. Four replicates are shown for each condition. (B) Enriched Reactome pathways common between the pairwise comparisons of time points (SB-431542-treated versus 1 hr TGF-β or 8 hr TGF-β) of fibroblasts derived from a healthy subject containing WT SKI. (C) Hierarchically clustered heatmaps of log2FC values (relative to SB-431542 condition) showing the expression of TGF-β-responsive genes in the healthy (WT SKI) and the ΔS94-97 SKI-containing fibroblasts after 1 hr and 8 hr treatment with TGF-β, analyzed by RNA-seq. Four biological replicates per condition were analyzed. The genes shown are those for which the TGF-β inductions were statistically significant in the healthy fibroblasts, but non-significant in the ΔS94-97 fibroblasts. (D) The same data as in (C) are presented as box plots.

Figure 7—figure supplement 2
Validation of RNA-seq data by qPCR.

(A–L) Healthy dermal fibroblasts (WT SKI) and dermal fibroblasts from SGS patients containing either the L32V SKI mutation or the ΔS94-97 SKI mutation were treated overnight with 10 µM SB-431542, washed out, and incubated with either SB-431542 or 2 ng/ml TGF-β for 1 hr and 8 hr. Total RNA was extracted, and either RNA-seq or qPCR analysis was performed. Transcript levels for a subset of target genes are displayed as plots of the mean transcripts per million (TPM) from the RNA-seq data (A, C, E, G, I, K) or were measured by qPCR and plotted normalized to SB-431542-treated healthy fibroblasts (B, D, F, H, J, L). Plotted are the means and SEM of at least of four independent experiments. The p-values are from two-way ANOVA with Tukey’s post hoc test. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

Figure 7—figure supplement 2—source data 1

qPCR validations of RNA-seq data for SGS and control dermal fibroblasts.

https://cdn.elifesciences.org/articles/63545/elife-63545-fig7-figsupp2-data1-v2.xlsx

Videos

Video 1
Mechanism of SKI binding to phosphorylated SMAD2 MH2 domain.

Animation of SMAD2 MH2 domain monomer (orange) forming a complex with two other SMAD2 MH2 domain monomers (cyan and olive). Note the movement of Trp448 on helix five and Tyr268 on the β1’ strand in the orange monomer upon trimerization. The flipped Trp448 is then in the correct orientation for binding to the SKI peptide (magenta).

Tables

Appendix 1—key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)HaCaTFrancis Crick Institute
Cell Services
RRID:CVCL_0038Keratinocytes (immortalized adult)
Cell line (Homo sapiens)HEK293TFrancis Crick Institute
Cell Services
RRID:CVCL_0063Embryonic kidney cells (normal)
Cell line (Homo sapiens)Dermal fibroblasts
(normal, adult)
David Abraham, UCL, UKPrimary cells, male
Cell line (Homo sapiens)Dermal fibroblasts
(carrying heterozygous
mutation L32V SKI)
Carmignac et al., 2012
PMID:23103230
Primary cells, female
Cell line (Homo sapiens)Dermal fibroblasts
(carrying heterozygous
mutation ΔS94-97 SKI)
Carmignac et al., 2012
PMID:23103230
Primary cells, male
Cell line (Homo sapiens)HaCaT S4 KO #1;
HaCaT S4 KO #2;
HaCaT S4 KO #3;
HaCaT S4 KO #4
This paperKeratinocytes in which SMAD4
is deleted by CRISPR/Cas9
technology
Cell line (Homo sapiens)HEK293T S2 KO #1;
HEK293T S2 KO #2
This paperEmbryonic kidney cells in which
SMAD2 is deleted by
CRISPR/Cas9 technology
Cell line (Homo sapiens)HEK293T S3 KO #1;
HEK293T S3 KO #2
This paperEmbryonic kidney cells in which
SMAD3 is deleted by
CRISPR/Cas9 technology
Cell line (Homo sapiens)HEK293T S2/S3 dKO #1;
HEK293T S2/S3 dKO #2
This paperEmbryonic kidney cells in which
SMAD2 and SMAD3 are deleted
simultaneously by
CRISPR/Cas9 technology
Cell line (Homo sapiens)HEK293T S4 KO #1;
HEK293T S4 KO #2
This paperEmbryonic kidney cells in which
SMAD4 is deleted by
CRISPR/Cas9 technology
Cell line (Homo sapiens)HEK293T P35S SKI #1;
HEK293T P35S SKI #2;
HEK293T P35S SKI #3;
HEK293T P35S SKI #4
This paperEmbryonic kidney cells in which
the P35S SKI mutation is
introduced by
CRISPR/Cas9 technology
Cell line (Homo sapiens)HEK293T
CAGA12-Luciferase/Renilla
This paperEmbryonic kidney cells in which
the CAGA12-Luciferase and
TK-Renilla reporters
are stably expressed
Cell line (Homo sapiens)HEK293T
BRE-Luciferase/Renilla
This paperEmbryonic kidney cells in which
the BRE-Luciferase and TK-Renilla
reporters are stably expressed
Cell line (Homo sapiens)HEK293T P35S SKI
CAGA12 Luciferase/Renilla #2;
HEK293T P35S SKI
CAGA12 Luciferase/Renilla #3
This paperHEK293T P35S SKI clones 2 and 3 in
which the CAGA12-Luciferase and
TK-Renilla reporters are
stably expressed
Cell line (Homo sapiens)HEK293T P35S SKI
BRE-Luciferase/Renilla #2;
HEK293T P35S SKI
BRE-Luciferase/Renilla #3
This paperHEK293T P35S SKI clones 2 and 3 in
which the BRE-Luciferase and
TK-Renilla reporters are
stably expressed
Cell line (Homo sapiens)HaCaT S4 KO EGFPThis paperHaCaT SMAD4 KO clone 2 cells
stably expressing EGFP
Cell line (Homo sapiens)HaCaT SMAD4 KO rescue
EGFP-SMAD4 WT
This paperHaCaT SMAD4 KO clone 2 cells stably
expressing EGFP-SMAD4 WT
Cell line (Homo sapiens)HaCaT SMAD4 KO rescue
EGFP-SMAD4 D351H
This paperHaCaT SMAD4 KO clone 2 cells stably
expressing EGFP-SMAD4 D351H
Cell line (Homo sapiens)HaCaT SMAD4 KO rescue
EGFP-SMAD4 D537Y
This paperHaCaT SMAD4 KO clone 2 cells stably
expressing EGFP-SMAD4 D537Y
Cell line (Homo sapiens)HaCaT SMAD4 KO
rescue
EGFP-SMAD4 A433E
This paperHaCaT SMAD4 KO clone 2 cells stably
expressing EGFP-SMAD4 A433E
Cell line (Homo sapiens)HaCaT SMAD4 KO
rescue
EGFP-SMAD4 I435Y
This paperHaCaT SMAD4 KO clone 2 cells stably
expressing EGFP-SMAD4 I435Y
Cell line (M. musculus)MEF SMAD2Δex2Piek et al., 2001
PMID:11262418
Mouse embryo-derived fibroblasts
carrying the homozygous
null allele Smad2ex2
Cell line
(Spodoptera frugiperda)
Sf21Fitzgerald et al., 2006
PMID:17117155
Insect cells used to express
recombinant proteins
Transfected constructpGFP-C1VectorBuilderClontech,
Cat# 6084–1
Construct used to make HaCaT
SMAD4 KO stably expressing EGFP
Transfected
construct (human)
pEGFP-SMAD4 WTNicolás et al., 2004
PMID:15280432
Construct used to make HaCaT
SMAD4 KO stably expressing
EGFP SMAD4 WT
Transfected
construct (human)
pEGFP-SMAD4 D351HThis paperConstruct used to make HaCaT
SMAD4 KO stably expressing
EGFP-SMAD4 D351H
Transfected
construct (human)
pEGFP-SMAD4 D537YThis paperConstruct used to make HaCaT
SMAD4 KO stably expressing
EGFP-SMAD4 D537Y
Transfected
construct (human)
pEGFP-SMAD4 A433EThis paperConstruct used to make HaCaT
SMAD4 KO stably expressing
EGFP-SMAD4 A433E
Transfected
construct (human)
pEGFP-SMAD4 I435YThis paperConstruct used to make HaCaT
SMAD4 KO stably expressing
EGFP-SMAD4 I435Y
Transfected constructpRL-TK VectorPromegaCat# E2241Construct used to make HEK
293T cells stably expressing
TK Renilla
Transfected constructpGL3-BRE-LucKorchynskyi and ten Dijke, 2002
PMID:11729207
Addgene
Cat# 45126
Construct used to make HEK
293T cells stably expressing
Luciferase under control
of the BRE
Transfected constructpGL3 CAGA12-LucDennler et al., 1998
PMID:9606191
Construct used to make HEK
293T cells stably expressing
Luciferase under control of
the CAGA12 sequence
Transfected constructpSUPER.retro.puroOligoEngineCat# VEC-pRT-0002Construct used to express
resistance to puromycin in order
to make stable cell lines
Transfected constructpSpCas9(BB)−2A-GFP
(PX458)
Ran et al., 2013
PMID:24157548
Addgene Cat# 48138Different oligonucleotides
corresponding to gRNAs have
been cloned into this plasmid
in order to make several different
CRISPR/Cas9 knockout cell lines.
AntibodyAnti-phosphorylated
SMAD2
(Rabbit monoclonal)
Cell Signaling TechnologyCat# 3108;
RRID:AB_490941
WB (1:1000)
AntibodyAnti-SMAD2/3
(mouse monoclonal)
BD BiosciencesCat# 610843;
RRID:AB_398162
IF (1:500)
WB (1:1000)
AntibodyAnti-phospho-SMAD3
(rabbit monoclonal)
Cell Signaling TechnologyCat# 9520;
RRID:AB_2193207
WB (1:500)
AntibodyAnti-SMAD4 (B-8)
(mouse monoclonal)
Santa CruzCat# sc-7966;
RRID:AB_627905
WB (1:1000)
AntibodyAnti-SMAD3
(Rabbit monoclonal)
AbcamCat# 40854;
RRID:AB_777979
WB (1:1000)
AntibodyAnti-FLAG DYKDDDDK
Tag (L5)
(Rat monoclonal)
Thermo FisherCat# MA1-142,
RRID:AB_2536846
IP (5 µg)
WB (1:1000)
AntibodyAnti-MCM6 (C-20)
(Goat polyclonal)
Santa CruzCat# sc-9843;
RRID:AB_2142543
WB (1:2000)
AntibodyAnti MCM6 (H-8)
(Mouse monoclonal)
Santa CruzCat# sc-393618
RRID:AB_2885187
WB (1:2000)
AntibodyAnti-Tubulin
(Rat monoclonal)
AbcamCat# ab6160;
RRID:AB_305328
WB (1:5000)
AntibodyAnti-SKI
(Rabbit Polyclonal)
GeneTexCat# GTX133764
RRID:AB_2885186
IP (5 µg)
WB (1:2000)
AntibodyAnti-GFP
(Goat polyclonal)
AbcamCat# ab6673,
RRID:AB_305643
IF (1:200)
AntibodyAnti SKIL (SnoN)
(H-317)
(Rabbit polyclonal)
Santa CruzCat# sc-9141,
RRID:AB_671124
WB (1:1000)
IF (1:1000)
Flow cytometry (1:200)
AntibodyDonkey anti-Goat IgG
(H+L) Cross-adsorbed
secondary antibody,
Alexa Fluor 546
Thermo Fisher ScientificCat# A-11056,
RRID:AB_2534103
IF (1:1000)
antibodyAnti-Rabbit Alexa Fluor 594Thermo Fisher ScientificCat# A-21244;
RRID:AB_10562581
IF (1:1000)
AntibodyAnti-Rabbit Alexa Fluor 647Thermo Fisher ScientificCat# A-21244,
RRID:AB_2535812
Flow cytometry (1:1000)
AntibodyGoat anti-rabbit HRPDakoCat# P0448;
RRID:AB_2617138
WB (1:5000)
AntibodyGoat anti-mouse HRPDakoCat#P0447;
RRID:AB_2617137
WB (1:5000)
AntibodyDonkey anti-rat HRPJackson LabCat#712-035-153;
RRID:AB_2340639
WB (1:5000)
AntibodyRabbit anti-goat HRPDakoCat# P0449,
RRID:AB_2617143
WB (1:5000)
Recombinant DNA reagentpEF-FLAG-SKIL
(plasmid)
This paperTransient transfection in
HEK293T cells to
express FLAG SKIL WT
Recombinant DNA reagentFLAG SKIL
G103V (SKIL ΔS2/S3)
(plasmid)
This paperTransient transfection in
HEK293T cells to
express FLAG SKIL G103V
Recombinant DNA reagentFLAG SKIL R314A,
T315A, H317A,
W318E (SKIL ΔS4)
(plasmid)
This paperTransient transfection in
HEK293T cells to express
FLAG SKIL R314A,
T315A, H317A, W318E
Recombinant DNA reagentpFast Dual
ALK5* GST-MH2-hSMAD2
(plasmid)
This paperUsed to express recombinant
proteins in insect cells
Recombinant DNA reagentpFastDual
ALK5*/GST-hSMAD3
(plasmid)
This paperUsed to express recombinant
proteins in insect cells
Recombinant DNA reagentpBacPAK-SMAD4
(plasmid)
This paperUsed to express recombinant
proteins in insect cells
Sequence-based reagentSMAD4_F1This paperCACCGACAACTCGTTCGTAGTGATA
CRISPR/Cas9-mediated knockout
guide, forward oligo 1
Sequence-based reagentSMAD4_R1This paperAAACTATCACTACGAACGAGTTGTC
CRISPR/Cas9 mediated knockout
guide, reverse oligo 1
Sequence-based reagentSMAD4_F2This paperCACCGTGAGTATGCATAAGCGACGA
CRISPR/Cas9 mediated knockout
guide, forward oligo 2
Sequence-based reagentSMAD4_R2This paperAAACTCGTCGCTTATGCATACTCAC
CRISPR/Cas9 mediated knockout
guide, reverse oligo 2
Sequence-based reagentSMAD2 _F1This paperCACCGCTATCGAACACCAAAATGC
CRISPR/Cas9 mediated knockout
guide, forward oligo
Sequence-based reagentSMAD2 _R1This paperAAACGCATTTTGGTGTTCGATAGC
CRISPR/Cas9 mediated knockout
guide, reverse oligo
Sequence-based reagentSMAD3_F1This paperCACCGGAATGTCTCCCCGACGCGC
CRISPR/Cas9 mediated knockout
guide, forward oligo
Sequence-based reagentSMAD3_R1This paperAAACGCGCGTCGGGGAGACATTCC
CRISPR/Cas9 mediated knockout
guide, reverse oligo
Sequence-based reagentSKI_F1This paperCACCGCAGCGCGCCGAGAAAGCGGC
CRISPR/Cas9 mediated knockin
guide, forward oligo
Sequence-based reagentSKI_R1This paperAAACGCCGCTTTCTCGGCGCGCTGC
CRISPR/Cas9 mediated knockin
guide, reverse oligo
Sequence-based reagentSKI_ssODNThis paperG*C*AGTTCCACCTGAGCTCCATGAGC
TCGCTGGGAGGATCCGCCGCTTTCTC
GGCGCGCTGGGCGCAGGAGGCCTA
CAAGAAGGAGAGCGCCAAGGAGGCG
GGCGCGGCCGCGGTGCCG*G*C
Repair template
Sequence-based reagentSKI_R2This paperGCCCATGACTTTGAGGATCTCC
Universal reverse primer for
clone screening
Sequence-based reagentSKI_F2This paperATGAGCTCGCTGGGCGGCCCG
WT SKI forward primer
for clone screening
Sequence-based reagentSKI_F3This paperATGAGCTCGCTGGGAGGATCC
P35S SKI forward primer
for clone screening
Sequence-based reagentBiotinylated WT cJUN
SBE oligonucleotide (top)
Levy et al., 2007
PMID:17591695
5′-Biotin-
GGAGGTGCGCGGAGTCAGG
CAGACAGACAGACACAGCCA
GCCAGCCAGGTCGGCA
DNAP oligo - Top
Sequence-based reagentWT cJUN SBE
oligonucleotide (bottom)
Levy et al., 2007
PMID:17591695
TGCCGACCTGGCTGGCTGGC
TGTGTCTGTCTGTCTGCCTG
ACTCCGCGCACCTCC
DNAP oligo - Bottom
Sequence-based reagentBiotinylated MUT cJUN
SBE oligonucleotide (top)
This paper5′-biotin-
GGATTTGCTAATGATATAGT
AATATATATATATACATATAT
ATATATTGATCTTCA
Mutated DNAP oligo -Top
Sequence-based reagentMUT cJUN
SBE oligonucleotide (bottom)
This paperTGAAGATCAATATATATATAT
GTATATATATATATTACTAT
ATCATTAGCAAATCC
Mutated DNAP oligo -Bottom
Sequence-based reagentMUT cJUN SBE
oligo-nucleotide (top)
This paperGGATTTGCTAATGATATAGTA
ATATATATATATACATATAT
ATATATTGATCTTCA
Competitor mutant oligo - Top
Sequence-based reagentMUT cJUN SBE
oligo-nucleotide (bottom)
This paperTGAAGATCAATATATATATATG
TATATATATATATTACTATA
TCATTAGCAAATCC
Competitor mutant
oligo – bottom
Sequence-based reagentGAPDH_F1Grönroos et al., 2012
PMID:22615489
CTTCAACAGCGACACCCACT
PCR primer
Sequence-based reagentGAPDH_R1Grönroos et al., 2012
PMID:22615489
GTGGTCCAGGGGTCTTACTC
PCR primer
Sequence-based reagentSMAD7_F1Grönroos et al., 2012
PMID:22615489
CTTAGCCGACTCTGCGAACT
PCR primer
Sequence-based reagentSMAD7_R1Grönroos et al., 2012
PMID:22615489
CCAGGCTCCAGAAGAAGTTG
PCR primer
Sequence-based reagentSKIL_F1This paperCTGGGGCTTTGAATCAGCTA
PCR primer
Sequence-based reagentSKIL_R1This paperCATGGTCACCTTCCTGCTTT
PCR primer
Sequence-based reagentSERPINE1_F1Grönroos et al., 2012
PMID:22615489
TGATGGCTCAGACCAACAAG
PCR primer
Sequence-based reagentSERPINE1_R1Grönroos et al., 2012
PMID:22615489
GTTGGTGAGGGCAGAGAGAG
PCR primer
Sequence-based reagentJUNB_F1Ramachandran et al., 2018
PMID:29376829
ATACACAGCTACGGGATACGG
PCR primer
Sequence-based reagentJUNB_R1Ramachandran et al., 2018
PMID:29376829
GCTCGGTTTCAGGAGTTTGT
PCR primer
Sequence-based reagentID1_F1Ramachandran et al., 2018
PMID:29376829
GCCGAGGCGGCATGCGTTC
PCR primer
Sequence-based reagentID1_R1Ramachandran et al., 2018
PMID:29376829
CTTGCCCCCTGGATGGCTGG
PCR primer
Sequence-based reagentID3_F1Grönroos et al., 2012
PMID:22615489
GGCCCCCACCTTCCCATCC
PCR primer
Sequence-based reagentID3_R1Grönroos et al., 2012
PMID:22615489
GCCAGCACCTGCGTTCTGGAG
PCR primer
Sequence-based reagentCDKN1A_F1Miller et al., 2018
PMID:30428352
ACTCTCAGGGTCGAAAACGG
PCR primer
Sequence-based reagentCDKN1A_R1Miller et al., 2018
PMID:30428352
ATGTAGAGCGGGCCTTTGAG
PCR primer
Sequence-based reagentISLR2_F1This paperAGTCGGCGAATATTGGGAGC
PCR primer
Sequence-based reagentISLR2_R1This paperATGATCCGGCCACTCCTAGA
PCR primer
Sequence-based reagentCALB2_F1This paperATGGCAAATTGGGCCTCTCA
PCR primer
Sequence-based reagentCALB2_R1This paperGGTCAGCTTCATGCCCTGAAAT
PCR primer
Sequence-based reagentSOX11_F1This paperAGCGGAGGAGGTTTTCAGTG
PCR primer
Sequence-based reagentSOX11_R1This paperTTCCATTCGGTCTCGCCAAA
PCR primer
Sequence-based reagentITGB6_F1This paperTGCGACCATCAGTGAAGAAG
PCR primer
Sequence-based reagentITGB6_R1This paperGACAACCCCGATGAGAAGAA
PCR primer
Sequence-based reagentHEY1_F1This paperGCTTTTGAGAAGCAGGGATCT
PCR primer
Sequence-based reagentHEY1_R1This paperGATAACGCGCAACTTCTGCC
PCR primer
Sequence-based reagentCOL7A1_F1This paperCAAGGGGGACATGGGTGAAC
PCR primer
Sequence-based reagentCOL7A1_R1This paperCGGATACCAGGCACTCCATC
PCR primer
Sequence-based reagentSMAD4_F3This paperGTTCATAAGATCTACCCAAGTG
AATATATAAAGGTCTTTGATTTG
PCR primer for cloning,
forward primer carrying
the mutation A433E
Sequence-based reagentSMAD4_R3This paperACGCAAATCAAAGACCTTTATA
TATTCACTTGGGTAGATCTTATG
PCR primer for cloning,
reverse primer carrying
the mutation A433E
Sequence-based reagentSMAD4_F4This paperAAGATCTACCCAAGTGCATATT
ACAAGGTCTTTGATTTGCGTCAG
PCR primer for cloning,
forward primer carrying
the mutation I435Y
Sequence-based reagentSMAD4_R4This paperCTGACGCAAATCAAAGACCTTGT
AATATGCACTTGGGTAGATCTT
PCR primer for cloning,
reverse primer carrying
the mutation I435Y
Sequence-based reagentSKIL_F2This paperCAGAGCTCGCTGGGTGTA
CCAGCAGCATTTTC
PCR primer for cloning,
forward primer carrying
the mutation G103V
Sequence-based reagentSKIL_R2This paperGAAAATGCTGCTGGTAC
ACCCAGCGAGCTCTG
PCR primer for cloning,
reverse primer carrying
the mutation G103V
Peptide,
recombinant protein
SKI peptide AThis paperBiotin-aminohexanoic
acid-
FQPHPGLQKTLEQFHLSSMSS
LGGPAAFSARWAQEAYKKES
Peptide,
recombinant protein
SKI peptide BThis paperBiotin-aminohexanoic
acid-
FQPHPGLQKTLEQFHLS
SMSSLGGPAAFSARWAQE
Peptide,
recombinant protein
SKI peptide CThis paperBiotin-aminohexanoic
acid-
GLQKTLEQFHLSSMSSLG
GPAAFSARWAQE
Peptide,
recombinant protein
SKI peptide DThis paperBiotin-aminohexanoic
acid-
TLEQFHLSSMSSLGG
PAAFSARWAQE
Peptide,
recombinant protein
SKI peptide EThis paperBiotin-aminohexanoic
acid-
TLEQFHLSSMSSLGGPA
AFSARWAQEAYK
Peptide,
recombinant protein
SKI L21RThis paperBiotin-aminohexanoic
acid-
FQPHPGLQKTREQFHLSS
MSSLGGPAAFSARWAQE
Peptide,
recombinant protein
SKI S28TThis paperBiotin-aminohexanoic
acid-
FQPHPGLQKTLEQFHLS
TMSSLGGPAAFSARWAQE
Peptide,
recombinant protein
SKI S31LThis paperBiotin-aminohexanoic
acid-
FQPHPGLQKTLEQFHLS
SMSLLGGPAAFSARWAQE
Peptide,
recombinant protein
SKI L32PThis paperBiotin-aminohexanoic
acid-
FQPHPGLQKTLEQFHLS
SMSSPGGPAAFSARWAQE
Peptide,
recombinant protein
SKI G34DThis paperBiotin-aminohexanoic
acid –
FQPHPGLQKTLEQFHLSS
MSSLGDPAAFSARWAQE
Peptide,
recombinant protein
SKI P35SThis paperBiotin-aminohexanoic
acid –
FQPHPGLQKTLEQFHLSS
MSSLGGSAAFSARWAQE
Peptide,
recombinant protein
SKIL WTThis paperBiotin-aminohexanoic
acid –
LHLNPSLKHTLAQFHLSSQSS
LGGPAAFSARHSQESMSPTV
Peptide,
recombinant protein
SKIL L90RThis paperBiotin-aminohexanoic
acid –
LHLNPSLKHTRAQFHLSSQS
SLGGPAAFSARHSQESMSPTV
Peptide,
recombinant protein
SKIL S100LThis paperBiotin-aminohexanoic
acid -
LHLNPSLKHTLAQFHLSSQS
LLGGPAAFSARHSQESMSPTV
Peptide,
recombinant protein
SKIL G103DThis paperBiotin-aminohexanoic
acid -
LHLNPSLKHTLAQFHLSSQSS
LGDPAAFSARHSQESMSPTV
Peptide,
recombinant protein
SKIL P104SThis paperBiotin-aminohexanoic
acid -
LHLNPSLKHTLAQFHLSSQSS
LGGSAAFSARHSQESMSPTV
Peptide,
recombinant protein
SKI WTThis paperFQPHPGLQKTLEQFHLSSMSS
LGGPAAFSARWAQE
Peptide,
recombinant
protein
Human recombinant TGF-β1PeprotechCat# 100–21
Peptide,
recombinant
protein
Human recombinant BMP4PeprotechCat# 120-05ET
Peptide,
recombinant
protein
Human recombinant Activin APeprotechCat# 120–14
Commercial assay or kitPowerUp SYBR
Green Master Mix
Thermo Fisher ScientificCat# A25742
Commercial assay or kitQuickextract DNA
extraction solution
LucigenCat# QE09050
Commercial assay or kitDual-Glo Luciferase
Assay System
PromegaCat# E2920
Commercial assay or kitFugene 6 transfection
reagent
PromegaCat# E2691
Commercial assay or kitSuperdex 200 10/300
size exclusion column
CytivaCat# 28990944
Commercial assay or kitStreptavidin (SA) BiosensorsForteBioCat# 18–5019
Commercial assay or kitGlutathione 4B SepharoseCytivaCat# 17075601
Commercial assay or kitPierce NeutrAvidin AgaroseThermo Fisher ScientificCat# 29200
Commercial assay or kitGFP-Trap Agarose (IP)CromotekCat# gta-20
Commercial assay or kitProtein G
Sepharose, Fast Flow
Sigma–AldrichCat# P3296
Chemical compound, drugcOmplete, EDTA-free
Protease Inhibitor Cocktail
Sigma–AldrichCat#
000000011873580001
Chemical compound, drugTRIzolThermo Fisher ScientificCat# 15596026
Chemical compound, drugDAPISigma-AldrichCat# 10236276001
Chemical compound, drugSB-431542Tocris; Inman et al., 2002:
PMID:12065756
Cat# 1614
Chemical compound, drugMG-132TocrisCat# 1748
Software, algorithmFIJI (ImageJ)https://imagej.net/Fiji/DownloadsRRID:SCR_002285
Software, algorithmFlowJo 10FlowJoRRID:SCR_008520
Software, algorithmGraphPad Prism 8GraphPadRRID:SCR_002798
Software, algorithmASTRA6.1WyattRRID:SCR_001625
Software, algorithmOctet CFR softwareForteBio
Software, algorithmDLS Xia2/XDS pipelineWinter, 2010;
Kabsch, 2010
PMID:20124692
Software, algorithmCCP4 suiteWinn et al., 2011
PMID:21460441
RRID:SCR_007255
Software, algorithmPhaserMcCoy et al., 2007
PMID:19461840
RRID:SCR_014219
Software, algorithmRefmacMurshudov et al., 2011
PMID:21460454
RRID:SCR_014225
Software, algorithmCootEmsley et al., 2010
PMID:20383002
RRID:SCR_014222
Software, algorithmPHENIX SuiteLiebschner et al., 2019
PMID:31588918
RRID:SCR_014224
Software, algorithmPhenix.RefineAfonine et al., 2012
PMID:22505256
RRID:SCR_016736
Software, algorithmRSEM-1.3.0/STAR-2.5.2Li and Dewey, 2011;
PMID:21816040
Dobin et al., 2013
PMID:23104886
RRID:SCR_013027
Software, algorithmDESeq2 package
(version 1.24.0)
Love et al., 2014
PMID:25516281
RRID:SCR_015687

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)