1. Cancer Biology
  2. Stem Cells and Regenerative Medicine
Download icon

RAL GTPases mediate EGFR-driven intestinal stem cell proliferation and tumourigenesis

  1. Máté Nászai
  2. Karen Bellec
  3. Yachuan Yu
  4. Alvaro Román-Fernández
  5. Emma Sandilands
  6. Joel Johansson
  7. Andrew D Campbell
  8. Jim C Norman
  9. Owen J Sansom
  10. David M Bryant
  11. Julia B Cordero  Is a corresponding author
  1. Wolfson Wohl Cancer Research Centre, United Kingdom
  2. Institute of Cancer Sciences, University of Glasgow, United Kingdom
  3. Cancer Research UK Beatson Institute, United Kingdom
Research Article
Cite this article as: eLife 2021;10:e63807 doi: 10.7554/eLife.63807
8 figures, 1 table and 2 additional files

Figures

Figure 1 with 1 supplement
Ral GTPases are necessary and sufficient to induce EGFR/MAPK signalling in intestinal stem cells (ISCs).

(A) Adult Drosophila wings from control animals and with posterior compartment knockdown of wg (wg-RNAi), Egfr (Egfr-RNAi), or RalA using one of two previously validated RNAi lines (RalA-RNAi(1)) or combined wg and Egfr knockdown (wg-RNAi+Egfr RNAi). Scale bar = 500 µm. (B) Blind scoring of wing dysmorphia on a scale of 1–5. Numbers inside bars represent the total number of wings scored. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (C) Heat map from transcriptomic analysis of adult whole midguts from mock-treated and Ecc15-infected control animals (+) or following adult-restricted knockdown of RalA (RalA-RNAi(1)) using the escargot-gal4, UAS-gfp driver (ISC/EB>). RNA was extracted from >25 whole midguts per replicate, and four biological replicates per genotype/per condition were processed for sequencing. (D) RT-qPCR confirmation of genes associated with EGFR/MAPK signalling in whole midguts from genotypes and conditions as in (C) expressed relative to rpl32 levels. n (number of biological replicates) = 4, each dot represents an independent RNA sample from >25 midguts per sample. Two-way ANOVA followed by Sidak’s multiple comparisons test. (E) Representative confocal images of Sox21a immunofluorescence staining (red/grey) of adult posterior midguts from Mock-treated or Ecc15-infected wild-type control animals or following knockdown of RalA (RalA-RNAi(1)) in stem/progenitor cells using escargot-gal4, UAS-gfp (ISC/EB>; green). (F) Quantification of average Sox21a staining intensity within the nuclear compartment (DAPI positive) in midguts as in (E). Two-way ANOVA followed by Sidak’s multiple comparisons test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. (G) Representative confocal images of pERK immunofluorescence staining (red/grey) of adult posterior midguts from Mock-treated or Ecc15-infected control animals or following knockdown of RalA (RalA-RNAi(1)) within stem/progenitor cells (ISC/EB>; green). (H) Quantification of average pERK staining intensity within the ISC/EB compartment (GFP positive) of midguts as in (G). Two-way ANOVA followed by Sidak’s multiple comparisons test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. (I) Immunohistochemistry images of total (bottom panels) and pERK (top panels) in small intestinal regenerating crypts 3 days after whole-body irradiation of control mice (left panels) or mice following conditional intestinal epithelial knockout of Rala or Ralb. Scale bar = 50 µm. (J) Quantification of the percentage of cells with pERK staining in regenerating small intestinal crypts as in (I). n = number of mice, with >12 crypts quantified per animal, each dot represents the average percentage from a given mouse. One-way ANOVA followed by Tukey’s multiple comparisons test. (K) Representative confocal images of Sox21a immunofluorescence staining (red/grey) of adult posterior midguts from control animals or animals overexpressing wild-type Rala within stem/progenitor cells (ISC/EB>; green). Scale bar = 50 µm. (L) Quantification of average Sox21a staining intensity within the nuclear compartment (DAPI positive; blue) of midguts as in (K). Student’s t-test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. (M) Representative confocal images of pERK immunofluorescence staining (red/grey) in control animals or animals overexpressing wild-type Rala within stem/progenitor cells (ISC/EB>; green). (N) Quantification of average pERK staining intensity within the ISC/EB compartment (GFP positive) of midguts as in (M). Student’s t-test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. Where indicated: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns: not significant. All error bars represent SD. Scale bars = 20 µm, unless otherwise stated.

Figure 1—source data 1

Ral GTPases are necessary and sufficient to induce EGFR/MAPK signalling in intestinal stem cells.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Ral GTPases are necessary and sufficient to induce EGFR/MAPK signalling in intestinal stem cells (ISCs).

(A) Representative confocal images of Sox21a immunofluorescence staining (red/grey) of adult posterior midguts from Mock-treated or Ecc15-infected control animals or following knockdown of RalA using an independent RNAi line from that in Figure 1 (RalA-RNAi(2)) in stem/progenitor cells using escargot-gal4, UAS-gfp (ISC/EB>; green). Scale bar = 50 µm. (B) Quantification of average Sox21a staining intensity within the nuclear compartment (DAPI positive; blue) in midguts as in (A). Two-way ANOVA followed by Sidak’s multiple comparisons test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. (C) Representative confocal images of pERK immunofluorescence staining (red/grey) of adult posterior midguts from Mock-treated or Ecc15-infected control animals or following knockdown of RalA using an independent RNAi line from that in Figure 1 (RalA-RNAi(2)) within stem/progenitor cells (ISC/EB>; green). (D) Quantification of average pERK staining intensity within the ISC/EB compartment (GFP positive) of midguts as in (C). Two-way ANOVA followed by Sidak’s multiple comparisons test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. (E) Quantification of the percentage of cells with total ERK staining (tERK) in regenerating small intestinal crypts as in Figure 1I. n = number of mice, with >12 crypts quantified per animal, each dot represents the average percentage from a given mouse. One-way ANOVA followed by Tukey’s multiple comparisons test. (F) Representative confocal images of tERK immunofluorescence staining (red/grey) in control animals or animals overexpressing wild-type Rala within stem/progenitor cells (ISC/EB>; green). (G) Quantification of average tERK staining intensity within the ISC/EB compartment (GFP positive) of midguts as in (F). Student’s t-test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. (H) Western blot of pERK and tERK from Control (Mock treated), wild-type Rala overexpressing (Mock treated) and Ecc15-infected midguts and whole fly lysates. (I) Representative confocal images of tERK immunofluorescence staining (red/grey) in mock-treated wild-type control animals or animals infected with Ecc15. (J) Quantification of average tERK staining intensity within the ISC/EB compartment (GFP positive) of midguts as in (I). Student’s t-test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. Where indicated: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns: not significant. All error bars represent SD. Scale bars = 20 µm, unless otherwise stated.

Figure 1—figure supplement 1—source data 1

Ral GTPases are necessary and sufficient to induce EGFR/MAPK signalling in intestinal stem cells.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig1-figsupp1-data1-v2.xlsx
Ral GTPase activation is necessary for EGFR/MAPK signalling in regenerating intestinal stem cells/enteroblasts (ISCs/EBs).

(A) Representative confocal images of pH3 staining (red) within the ISC/EB compartment (green) in mock-treated or regenerating posterior midguts. Scale bar = 50 µm. (B) Quantification of pH3-positive nuclei in control or GEFmeso-RNAi posterior midguts as in (A). Two-way ANOVA followed by Sidak’s multiple comparisons test. n = number of midguts. (C) Quantification of pH3-positive nuclei in control or RalGPS-RNAi posterior midguts as in (A). Two-way ANOVA followed by Sidak’s multiple comparisons test. n = number of midguts. (D) Quantification of pH3-positive nuclei in control or Rgl-RNAi posterior midguts as in (A). Two-way ANOVA followed by Sidak’s multiple comparisons test. n = number of midguts. (E) Representative confocal images of pERK staining (red/grey) in mock-treated or regenerating control animals or animals with knockdown of GEFmeso, RalGPS, or Rgl within the ISC/EB compartment (green). Scale bar = 20 µm. (F) Quantification of average pERK staining intensity within the ISC/EB compartment (GFP positive) as in (E). Two-way ANOVA followed by Sidak’s multiple comparisons test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. Where indicated: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns: not significant. All error bars represent SD. Scale bars = 20 µm, unless otherwise stated.

Figure 2—source data 1

Ral GTPase activation is necessary for EGFR/MAPK signalling in regenerating ISCs/EBs.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig2-data1-v2.xlsx
Figure 3 with 1 supplement
Ral GTPases are required for EGFR/MAPK signalling upstream of Ras.

(A) Representative confocal images of pH3 staining (red) within the intestinal stem cell/enteroblast (ISC/EB) compartment (green) of control animals or animals overexpressing wild-type Egfr (EGFRWT) or one of two constitutive Ras constructs used in this paper (RasV12(2)) with or without RalA knockdown within stem/progenitor cells (ISC/EB>; green). Scale bar = 50 µm. (B) Quantification of pH3-positive nuclei in posterior midguts as in (A). Two-way ANOVA followed by Sidak’s multiple comparisons test. n = number of midguts. (C) Representative confocal images of pERK staining (red/grey) of control animals or animals overexpressing wild-type Egfr (EGFRWT) or one of two constitutive Ras constructs used in this paper (RasV12(2)) with or without RalA knockdown within stem/progenitor cells (ISC/EB>; green). (D) Quantification of average pERK staining intensity as seen in (C) within the ISC/EB compartment (GFP positive). Two-way ANOVA followed by Sidak’s multiple comparisons test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. (E) Representative confocal images of pH3 staining (red) within the ISC/EB compartment (green) of control animals or animals overexpressing two types of constitutively active Egfr constructs (EGFRλtop or EGFRA887T) with or without RalA knockdown within stem/progenitor cells (ISC/EB>; green). Scale bar = 50 µm. (F) Quantification of pH3-positive nuclei in posterior midguts as in (E). Two-way ANOVA followed by Sidak’s multiple comparisons test. Error bars represent SEM. n = number of midguts. (G) Representative confocal images of pERK staining (red/grey) within the ISC/EB compartment (green) of control animals or animals overexpressing two types of constitutively active Egfr constructs (EGFRλtop or EGFRA887T) with or without RalA knockdown within stem/progenitor cells (ISC/EB>; green). (H) Quantification of average pERK staining intensity as in (G) within the ISC/EB compartment (GFP positive). Two-way ANOVA followed by Sidak’s multiple comparisons test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. Where indicated: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns: not significant. All error bars represent SD. Scale bars = 20 µm, unless otherwise stated.

Figure 3—source data 1

Ral GTPases are required for EGFR/MAPK signalling upstream of Ras.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Ral GTPases are required for EGFR/MAPK signalling upstream of Ras.

(A) Percentage survival of adult flies enclosing with the desired experimental genotype. Fisher’s exact test. (B) Adult Drosophila wings from control animals and with posterior compartment overexpression of wild-type Egfr (EGFRWT) with or without knockdown of RalA (RalA-RNAi(1)). Scale bar = 500 µm. (C) Representative confocal images of pH3 staining (red/grey; white arrows) within the intestinal stem cell/enteroblast (ISC/EB) compartment (green) in animals overexpressing a constitutively active Ras transgene independent from that in Figure 3 (RasV12(1)) with or without RalA knockdown (RalA-RNAi(2)) within stem/progenitor cells (ISC/EB>; green). Scale bar = 50 µm. (D) Quantification of pH3-positive nuclei in posterior midguts as in (C). Data were analysed by Student’s t-test. n = number of midguts. (E) Representative confocal images of tERK staining (red/grey) in animals overexpressing wild-type Egfr (EGFRWT) with or without RalA knockdown within stem/progenitor cells (ISC/EB>; green). Scale bar = 20 µm. (F) Quantification of average tERK staining intensity within the ISC/EB compartment (GFP positive) of midguts as in (E). Student’s t-test. n = number of z-stack confocal images quantified, each from an independent posterior midgut. Where indicated: ****p<0.0001, ns: not significant. All error bars represent SD.

Figure 3—figure supplement 1—source data 1

Ral GTPases are required for EGFR/MAPK signalling upstream of Ras.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig3-figsupp1-data1-v2.xlsx
Figure 4 with 3 supplements
Ral GTPases are required for EGFR internalisation.

(A) Representative images of wild-type EGFR staining (red/turbo colour map) in adult Drosophila midgut stem/progenitor cells (intestinal stem cell/enteroblast [ISC/EB>]; green) without (Control) or with RalA knockdown (RalA-RNAi). (B) Quantification of EGFR plasma membrane staining localisation in midguts as in (A) relative to the cytoplasm. Data is presented as Tukey's box and whiskers plot. Data were analysed by Student’s t-test. n = number of z-stack confocal images quantified, each from an independent posterior midgut. (C) Representative images of EGFRA887T staining (red/turbo colour map) in adult Drosophila midgut stem/progenitor cells (ISC/EB>; green) without (Control) or with RalA knockdown (RalA-RNAi). (D) Quantification of EGFRA887Tplasma membrane staining localisation as in (C) relative to the cytoplasm presented as Tukey's box and whiskers plot. Student’s t-test. n = number of z-stack confocal images quantified, each from an independent posterior midgut. (E) Representative images of EGFR staining in (red/turbo colour map) in adult Drosophila midgut stem/progenitor cells (ISC/EB>; green) without (Control) or with wild-type RalA overexpression (RalAwt). (F) Quantification of EGFR plasma membrane staining localisation in midguts as in (E) relative to the cytoplasm. Data is presented as Tukey's box and whiskers plot. Student’s t-test. n = number of z-stack confocal images quantified, each from an independent posterior midgut. (G) Internalisation of EGFR over time determined by a surface biotinylation ELISA-based assay in H1299 human non-small cell lung cancer cells transfected with a non-targeting (Control) or combined Rala and Ralb knockdown constructs (siRala +b) and incubated in the presence or absence of EGF ligand. Data from one experiment with three technical replicates and representative of three independently performed experiments is presented. Two-way ANOVA followed by Bonferroni's multiple comparisons test. Error bars represent SEM. Where indicated: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. All error bars represent SD. Scale bars = 20 µm.

Figure 4—source data 1

Ral GTPases are required for EGFR internalisation.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Demonstration of method used to quantify EGFR cellular localisation.

(A) Example of a single confocal plane from a z-stack confocal image used for the quantification of EGFR localisation. Stem/progenitor cells are identified using escargot-gal4, UAS-gfp (ISC/EB>; green), nuclei are highlighted by DAPI staining (blue). These layers are converted to binary masks based on the triangle method to determine the threshold value and subjected to morphological operations to yield masks for the quantification of EGFR intensity in the various subcellular locations. The membrane compartment (red) is defined as the dilated outline of the intestinal stem cell/enteroblast (ISC/EB) compartment. The cytoplasmic compartment (green) is defined as the ISC/EB compartment minus the membrane and nuclear (blue) compartments. (B) Coloured bar representing the colour of pixels with a given 16-bit intensity in the turbo colour map.

Figure 4—figure supplement 2
Ras is required for EGFR internalisation.

(A) Representative images of wild-type EGFR staining (red/turbo colour map) in adult Drosophila midgut stem/progenitor cells (intestinal stem cell/enteroblast [ISC/EB>]; green) without (Control) or with Ras knockdown (Ras-RNAi). (B) Quantification of EGFR plasma membrane staining localisation in midguts as in (A) relative to the cytoplasm. Data is presented as Tukey's box and whiskers plot. Student’s t-test. n = number of z-stack confocal images quantified, each from an independent posterior midgut. Where indicated: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. All scale bars = 20 µm.

Figure 4—figure supplement 2—source data 1

Rasis required for EGFR internalisation.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig4-figsupp2-data1-v2.xlsx
Figure 4—figure supplement 3
RAL GTPases are required for EGFR internalisation.

(A) Confirmation of knockdown of Rala in H1299 human non-small cell lung cancer cells transfected with a non-targeting (Control) or combined Rala and Ralb knockdown constructs (siRala+b). Data expressed as Delta CT using GAPDH as a reference. n = 3 repeat knockdown cultures. Student's t-test. Error bars represent SEM. (B) Confirmation of knockdown of Ralb in H1299 human non-small cell lung cancer cells transfected with a non-targeting (Control) or combined Rala and Ralb knockdown constructs (siRala+b). Data expressed as Delta CT using GAPDH as a reference. n = 3 repeat knockdown cultures. Student's t-test. Error bars represent SEM. (C) Internalisation of cMet over time as determined by a surface biotinylation ELISA-based assay in H1299 human non-small cell lung cancer cells transfected with a non-targeting (Control) or combined Rala and Ralb knockdown constructs (siRala+b) and incubated in the presence or absence of HGF ligand. Data from one representative experiment is shown with three technical replicates. Experiment was repeated three times. Two-way ANOVA followed by Bonferroni's multiple comparisons test. Error bars represent SEM. (D) Internalisation of cMet over time as determined by a surface biotinylation ELISA-based assay in H1299 human non-small cell lung cancer cells transfected with a non-targeting (Control) or combined Rala and Ralb knockdown constructs (siRala+b) and incubated in the presence or absence of EGF ligand. Data from one representative experiment is shown with three technical replicates. Experiment was repeated three times. Two-way ANOVA followed by Bonferroni's multiple comparisons test. Error bars represent SEM. (E) Internalisation of human Transferrin receptor (hTfnR) over time as determined by a surface biotinylation ELISA-based assay in H1299 human non-small cell lung cancer cells transfected with a non-targeting (Control) or combined Rala and Ralb knockdown constructs (siRala+b) and incubated in the presence or absence of EGF ligand. Data from one representative experiment is shown with three technical replicates. Experiment was repeated three times. Two-way ANOVA followed by Bonferroni's multiple comparisons test. Error bars represent SEM. (F) Internalisation of α5β1 integrin over time as determined by a surface biotinylation ELISA-based assay in H1299 human non-small cell lung cancer cells transfected with a non-targeting (Control) or combined Rala and Ralb knockdown constructs (siRala+b) and incubated in the presence or absence of EGF ligand. Data from one representative experiment is shown with three technical replicates. Experiment was repeated three times. Two-way ANOVA followed by Bonferroni's multiple comparisons test. Error bars represent SEM. Where indicated: ***p<0.001.

Figure 4—figure supplement 3—source data 1

RAL GTPases are required for EGFR internalisation.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig4-figsupp3-data1-v2.xlsx
Figure 5 with 1 supplement
Ral GTPases mediate malignant transformation of the intestinal and mammary epithelium.

(A) Representative confocal images of pH3 staining (red/grey) in midguts overexpressing Src-kinase (Src64wt) with or without Rala knockdown (RalA-RNAi(2)) in stem/progenitor cells (intestinal stem cell/enteroblast [ISC/EB>]; green). White arrows indicate pH3-positive nuclei. (B) Quantification of pH3-positive nuclei in posterior midguts as in (A). Data were analysed by Student’s t-test. n = number of midguts. (C) Representative confocal images of Sox21a staining (red/grey) in midguts overexpressing Src-kinase (Src64wt) with or without Rala knockdown (RalA-RNAi(2)) in stem/progenitor cells (ISC/EB>; green). Scale bar = 50 µm. (D) Quantification of average Sox21a staining intensity within the nuclear compartment (DAPI positive) as in (C). Two-way ANOVA followed by Sidak’s multiple comparisons test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. (E) Representative confocal images of pERK staining (red/grey) in midguts overexpressing Src-kinase (Src64wt) with or without Rala knockdown (RalA-RNAi(2)) in stem/progenitor cells (ISC/EB>; green). (F) Quantification of average pERK staining intensity within the ISC/EB compartment (GFP positive) as in (E). Two-way ANOVA followed by Sidak’s multiple comparisons test; n = number of z-stack confocal images quantified, each from an independent posterior midgut. Error bars represent SD. (G) Representative images of EGFR staining (red/grey) in midguts overexpressing Src-kinase (Src64wt) and EGFRwt with or without Rala knockdown (RalA-RNAi(2)) in stem/progenitor cells (ISC/EB>; green). (H) Quantification of EGFR plasma membrane staining localisation relative to the cytoplasm as in (G) presented as Tukey's box and whiskers plot. Data were analysed by Student’s t-test. n = number of z-stack confocal images quantified, each from an independent posterior midgut. (I) Confocal fluorescence microscopy images of HMT3522 T4-2 3D cultures, treated with EGFR inhibitors (tyrphostin AG1478 and erlotinib) or corresponding vehicle controls (ethanol and DMSO, respectively) followed by fixation after 5 days and staining for F-actin (yellow) and nuclei (blue, Hoechst). Scale bar = 40 µm. (J) Quantification of area of 5 days T4-2 cysts treated as in (I). n ≥ 1214 cysts assessed from four wells/condition/experiment, two independent experiments. One-way ANOVA, Tukey’s multiple comparisons test. (K) Confocal fluorescence microscopy images of HMT3522 T4-2 cysts of 5 days expressing either scramble, RalA or RalB shRNA. Cysts were fixed and stained for F-actin (yellow) and nuclei (blue, Hoechst). Scale bar = 40 µm. (L) Quantification of 5 days T4-2 cysts as in (K). n ≥ 468 cysts assessed from four wells/condition/experiment, three independent experiments. One-way ANOVA, Tukey’s multiple comparisons test. Where indicated: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns: not significant. All error bars represent SD. Scale bars = 20 µm, unless otherwise stated.

Figure 5—source data 1

Ral GTPases mediate malignant transformation of the intestinal and mammary epithelium.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Ral knockdown in human mammary cell lines.

(A) Confirmation of knockdown of Rala in HMT3522 T4-2 3D cultures in parental lines or following shScr, shRala, and shRalb transfection. Data expressed as Delta CT using ACTB as a reference. n = 3 independent samples, Error bars represent SEM. Data were analysed using one-way ANOVA followed by Tukey's multiple comparisons test. (B) Confirmation of knockdown of Ralb in HMT3522 T4-2 3D cultures in parental lines or following shScr, shRala, and shRalb transfection. Data expressed as Delta CT using ACTB as a reference. n = 3 independent samples, error bars represent SEM. Data were analysed using one-way ANOVA followed by Tukey's multiple comparisons test. Where indicated: ***p<0.001, ****p<0.0001.

Figure 5—figure supplement 1—source data 1

Ralknockdown in human mammary cell lines.

https://cdn.elifesciences.org/articles/63807/elife-63807-fig5-figsupp1-data1-v2.xlsx
Working model depicting the role of RAL GTPases in EGFR/MAPK signalling.

(A) Experimental contexts used. Most results were acquired from Drosophila intestinal epithelial stem progenitor cells. Key findings were confirmed using mammalian intestine and human lung and breast cancer cell lines. (B) RalA is necessary for EGFR internalisation and MAPK activation, leading to mitogenic signalling.

Author response image 1
Transcriptional readouts of EGFR/MAPK pathway activation.

RT-qPCR confirmation of transcriptional targets of EGFR/MAPK signalling in whole midguts from wild-type control and EGFR knockdown in stem/progenitor cells using escargot-gal4, UAS-gfp. Results are presented relative to rpl32 levels. n (number of biological replicates) = 4 or 3, each dot represents an independent RNA sample from >10 midguts per sample. Where indicated: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001; Two-way ANOVA followed by Sidak’s multiple comparisons test. All error bars represent SD.

Author response image 2
Inhibition of cell membrane internalisation induces hyperproliferation.

Representative confocal images of adult posterior midguts from wild-type control animals, or following the overexpression of temperature sensitive dominant negative dynamin (shiDN), or dominant negative Rab5 (Rab5DN) in stem/progenitor cells using escargot-gal4, UAS-gfp (ISC/EB>; green). Scale bar = 50 µ. Quantification of pH3 counts, as in A, in guts expressing dominant negative dynamin. Quantification of pH3 counts, as in A, in guts expressing dominant negative Rab5. Where indicated: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001; Student’s t-test. All error bars represent SD.

Tables

Appendix 1—key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Mus musculus)VillinCreERel Marjou et al., 200410.1002/gene.20042NA
Strain, strain background (Mus musculus)Ralafl/flPeschard et al., 2012 10.1016/j.cub.2012.09.013RRID:MGI:5505291
Strain, strain background (Mus musculus)Ralbfl/flPeschard et al., 201210.1016/j.cub.2012.09.013RRID:MGI:5505291
Strain, strain background (Erwinia carotovora carotovora 15)Ecc15B. Lemaitre; (Basset et al., 2000)10.1073/pnas.97.7.3376NA
Genetic reagent (Drosophila melanogaster)en>BDSCRRID:BDSC_30564y1 w*; P{w+mW.hs=en2.4 GAL4}e16E
Genetic reagent (Drosophila melanogaster)ISC/EB>S. Hayashi; Goto and Hayashi, 1999
PMID:10393119
NAyw;esg-Gal4NP5130,UAS-GFP,UAS-GFPnLacZ/Cyo;tub-Gal80ts/Tm6B
Genetic reagent (Drosophila melanogaster)ControlR. CaganNAw[1118]
Genetic reagent (Drosophila melanogaster)RalA-RNAi(1)VDRCRRID:FlyBase_FBst0477124P{KK108989}VIE-260B
Genetic reagent (Drosophila melanogaster)RalA-RNAi(2)BDSCRRID:BDSC_29580y1 v1; P{y+t7.7v+t1.8=TRiP.JF03259}attP2
Genetic reagent (Drosophila melanogaster)wg-RNAiVDRCRRID:FlyBase_FBst0476437P{KK108857}VIE-260B
Genetic reagent (Drosophila melanogaster)wg-RNAiVDRCRRID:FlyBase_FBst0450965P{GD5007}v13351
Genetic reagent (Drosophila melanogaster)EGFR-RNAiVDRCRRID:FlyBase_FBst0478953P{KK100051}VIE-260B
Genetic reagent (Drosophila melanogaster)RalAwtG. Hasan; (Richhariya et al., 2017); 10.1038/srep42586NAP{UAS-RalA}3
Genetic reagent (Drosophila melanogaster)GEFmeso-RNAiBDSCRRID:BDSC_42545y1 v1; P{y[+t7.7] v[+t1.8]=TRiP.HMJ02116}attP40
Genetic reagent (Drosophila melanogaster)RalGPS-RNAiVDRCRRID:FlyBase_FBst0463650w[1118]; P{GD11683}v40596/TM3
Genetic reagent (Drosophila melanogaster)Rgl-RNAiBDSCRRID:BDSC_28938y1 v1; P{y[+t7.7] v[+t1.8]=TRiP.HM05149}attP2
Genetic reagent (Drosophila melanogaster)EGFRwtBDSCRRID:BDSC_5368y1 w[*]; P{w[+mc]=UAS Egfr.B}32-26-1
Genetic reagent (Drosophila melanogaster)EGFRA887TBDSCRRID:BDSC_9533w[*]; P{w[+mC]=Egfr0.2.A887T.UAS}8-2
Genetic reagent (Drosophila melanogaster)EGFRλtopBDSCRRID:BDSC_59843w[*]; P{w[+mC]=UAS Egfr.lambdatop}3/TM6C, Sb1
Genetic reagent (Drosophila melanogaster)RasV12(1)BDSCRRID:BDSC_64196 w[*]; P{w[+mC]=UAS-Ras85D.V12}2
Genetic reagent (Drosophila melanogaster)RasV12(2)BDSCRRID:BDSC_64195w[*]; P{w[+mC]=UAS-Ras85D.V12}TL1
Genetic reagent (Drosophila melanogaster)Ras-RNAiVDRCRRID:FlyBase_FBst0478466P{KK108029}VIE-260B
Genetic reagent (Drosophila melanogaster)Src64wtBDSCRRID:BDSC_8477w[*]; P{w[+mC]=UAS-Src64B.C}2
Cell line (Homo sapiens)H1299ATCC CRL-5803RRID:CVCL_0060Authenticated through STR profiling
Mycoplasma negative
Cell line (Homo sapiens)HMT3522 T4-2V. Weaver, UCSFRRID:CVCL_2501Authenticated through STR profiling
Mycoplasma negative
Cell line (Homo sapiens)HEK293-FTThermo Fisher ScientificRRID:CVCL_6911Authenticated through STR profiling
Mycoplasma negative
AntibodyAnti-GFP (Chicken polyclonal)AbcamRRID:AB_300798Drosophila IF (1:2000)
AntibodyAnti-Sox21a (Rabbit polyclonal)B. Biteau; (Meng and Biteau, 2015) 10.1016/j.celrep.2015.09.061NADrosophila IF (1:2000)
AntibodyAnti-pERK (Rabbit polyclonal)Cell Signalling TechnologyRRID:AB_331646Drosophila IF (1:100); mouse IHC (1:400); western blot (1:1000)
AntibodyAnti-ERK (Rabbit polyclonal)Cell Signalling TechnologyRRID:AB_390779Drosophila IF (1:100); western blot (1:1000)
AntibodyAnti-ERK (Rabbit polyclonal)Cell Signalling TechnologyRRID:AB_330744Mouse IHC (1:40)
AntibodyAnti-rabbit IgG HRP-linked antibody (Goat polyclonal)Cell Signalling TechnologyRRID:AB_2099233Western blot (1:10,000)
AntibodyAnti-Phospho-Histone 3 Ser 10 (Rabbit polyclonal)Cell Signalling TechnologyRRID:AB_331535Drosophila IF (1:100)
AntibodyAnti-EGFR extracellular domain (Mouse monoclonal)Sigma-AldrichRRID:AB_609900Drosophila IF (1:50)
AntibodyAnti-EGFR1 (Mouse monoclonal)BDPharmingenRRID:AB_2096589Capture-ELISA (5 µg/mL)
AntibodyAnti-c-MET (Goat polyclonal)R&D SystemsRRID:AB_355289Capture-ELISA anti-HGFR (5 µg/mL)
AntibodyAnti-Alpha5 beta1 integrin (Mouse monoclonal, Clone V5)BDPharmingenRRID:AB_396007Capture-ELISA
Anti-CD49e (5 µg/mL)
AntibodyAnti-Transferrin receptor (Human monoclonal)BDPharmingenRRID:AB_395918Capture-ELISA
CD71 antibody (5 µg/mL)
AntibodyAlexa Fluor 488 anti-chicken-IgY (H + L) (Goat polyclonal secondary antibody)InvitrogenCat#A-11039
RRID:AB_142924
Drosophila IF (1:100)
AntibodyAlexa Fluor 594 anti-rabbit-IgG (H + L) (Goat polyclonal secondary antibody)InvitrogenCat#A-11037
RRID:AB_2534095
Drosophila IF (1:100)
AntibodyAlexa Fluor 594 anti-mouse-IgG (H + L) (Goat polyclonal secondary antibody)Molecular ProbesRRID:AB_141672Drosophila IF (1:100)
AntibodyAlexa Fluor 594 anti-mouse-IgG (H + L) (Goat polyclonal secondary antibody)InvitrogenRRID:AB_2534091Drosophila IF (1:100)
Recombinant DNA reagentpLKO.1-puromycinMoffat et al. Cell. 2006 Mar 24. 124(6):1283–98RRID:Addgene_10878
Recombinant DNA reagentVSVGTrono lab, unpublished, donated to AddgeneRRID:Addgene_12259
Recombinant DNA reagentSPAX2Trono lab, unpublished, donated to AddgeneRRID:Addgene_12260
Sequence-based reagentRho_FwdThis paperNATTGTCATCTTTGTCTCCTGCGA
Sequence-based reagentRho_RevThis paperNAGTCAGGTGGGCAATGTACGA
Sequence-based reagentStg_FwdThis paperNACAGTAATAACACCAGCAGTTCGAG
Sequence-based reagentStg_RevThis paperNAGTAGAACGACAGCTCCTCCT
Sequence-based reagentSox21a_FwdThis paperNAAGACAATTAATACAGAGCTCGAGG
Sequence-based reagentSox21a_RevThis paperNAGAGATGCTCGTCATGATGCC
Sequence-based reagentRpl32_FwdThis paperNAAGGCCCAAGATCGTGAAGAA
Sequence-based reagentRpl32_RevThis paperNATGTGCACCAGGAACTTCTTGAA
Sequence-based reagentRala_FwdPrimerBankID#324072795 c2GCAGACAGCTATCGGAAGAAG
Sequence-based reagentRala_RevPrimerBankID#324072795 c2TCTCTAATTGCAGCGTAGTCCT
Sequence-based reagentRalb_FwdPrimerBankID#48762927 c1AGCCCTGACGCTTCAGTTC
Sequence-based reagentRalb_RevPrimerBankID#48762927 c1AGCGGTGTCCAGAATATCTATCT
Sequence-based reagentActB_FwdLiu et al., 201510.1371/journal.pone.0117058NATGACGTGGACATCCGCAAAG
Sequence-based reagentActB_Rev Liu et al., 2015 10.1371/journal.pone.0117058NACTGGAAGGTGGACAGCGAGG
Sequence-based reagentshScrThis paperNACCGCAGGTATGCACGCGT
Sequence-based reagentshRalaThis paperNAGGAGGAAGTCCAGATCGATAT
Sequence-based reagentshRalbThis paperNACAAGGTGTTCTTTGACCTAAT
Sequence-based reagentsiRNA Rala (human)DharmaconONTARGETplus – Cat# L-009235-00-0005
Sequence-based reagentsiRNA Ralb (human)DharmaconONTARGETplus – Cat# L-008403-00-0005
Peptide, recombinant proteinEGFSigmaCat# 11376454001
Peptide, recombinant proteinHGFSigmaCat# H9661
Commercial assay or kitHigh Capacity cDNA Reverse Transcription KitApplied BiosystemsCat# 4368813
Commercial assay or kitPerfeCTa SYBR Green FastMix (Low ROX)Quanta BioCat# 95074–012
Commercial assay or kitVECTASHIELD Mounting Medium with DAPIVector Laboratories, IncRRID:AB_2336790
Commercial assay or kitSuperSignal West Pico Chemiluminescent SubstrateThermo Fisher ScientificCat# 34077
Commercial assay or kitRNAeasy Mini Kit (50)QIAGENCat# 74104
Commercial assay or kitGrowth Factor Reduced MatrigelBD Biosciences354230
Commercial assay or kitLipofectamine 2000Thermo Fisher ScientificCat# 11668027
Commercial assay or kitLenti-X ConcentratorClontech
Chemical compound, drugGlutamineThermo Fisher Scientific25030081
Chemical compound, drugDMEMThermo Fisher Scientific12491015
Chemical compound, drugFBSThermo Fisher Scientific26140079
Chemical compound, drugL-GlutamineThermo Fisher Scientific25030081
Chemical compound, drugNon-essential amino acidsThermo Fisher Scientific11140050
Chemical compound, drugInsulinSigma-AldrichI0516Insulin solution from bovine pancreas, 10 mg/mL insulin in25 mm HEPES, pH 8.2, BioReagent, sterile-filtered, suitable for cell culture
Chemical compound, drugTransferrinSigma-AldrichT2252
Chemical compound, drugSodium seleniteSigma-AldrichS5261
Chemical compound, drugβ-EstradiolSigma-AldrichE2758
Chemical compound, drugHydrocortisoneSigma-AldrichH0888
Chemical compound, drugProlactinMiltenyi Biotech130-093-985
Chemical compound, drugTyrphostin-AG1478Sigma-AldrichT4182
Chemical compound, drugErlotinib, HCLSigma-AldrichSML2156
Chemical compound, drugPuromycinThermo Fisher ScientificA1113803
Chemical compound, drugPhalloidinInvitrogenA12380, A22287
Chemical compound, drugHoechstH21486
Chemical compound, drugRIPA bufferSigmaR0278
Chemical compound, drugBradford reagentAbcamAB119216
Chemical compound, drugNuPAGE 10% Bis-Tris gelThermo Fisher ScientificNP0301BOX
Chemical compound, drugNuPAGE MOPS SDS running buffer
Chemical compound, drugTrans-Blot Turbo PVDF membraneBio-Rad1704157
Chemical compound, drugBSASigmaA3294
Chemical compound, drugSuper Signal West Pico Chemiluminescent SubstrateThermo Fisher Scientific34077
Software, algorithmFijiNIH1.51n; https://fiji.sc/
Software, algorithmGraphPad Prism 6GraphPadRRID:SCR_002798
Software, algorithmZEN 2 liteZEISSRRID:SCR_013672
Software, algorithm7500 Real-Time PCR SoftwareApplied BiosystemsRRID:SCR_014596
Software, algorithmHarmonyPerkinElmer
Software, algorithmBatchQuantify(Johansson et al., 2019)
10.1016/j.stem.2019.02.002
NAhttps://github.com/emltwc/2018-Cell-Stem-Cell
Software, algorithmEGFR_quantThis paperNAhttps://github.com/emltwc/EGFRProject
Software, algorithmBlind scoring(Perochon et al., 2021)https://doi.org/10.1038/s41556-021-00676-zNAhttps://github.com/emltwc/TracheaProject/blob/master/Blind_scoring.ijm
OtherAxio ObserverZEISS
OtherLSM780 microscopeZEISS
OtherBX51 microscopeOlympus
OtherOpera Phenix Z9501PerkinElmer
Other7500 Fast Real-Time PCR SystemApplied Biosystems
OtherTrans-Blot Turbo systemBio-Rad1704150
OtherHiSeq 2000Illumina
OtherImageLock plateEssen Biosciences

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)