Human cytomegalovirus antagonizes activation of Fcγ receptors by distinct and synergizing modes of IgG manipulation
- Faculty of Medicine, Albert-Ludwigs-University Freiburg, Germany
- Institute of Virology, University Medical Center, Albert-Ludwigs-University Freiburg, Germany
- Institute of Virology, University Hospital Düsseldorf, Heinrich-Heine-University Düsseldorf, Germany
- Institute for Virology, University Hospital Essen, University of Duisburg-Essen, Germany
Figures
Figure 1 with 2 supplements
gp34 and gp68 simultaneously bind to IgG using distinct epitopes.
(A) CV-1 cells were infected with rVACVs expressing gp34, gp68, or the host Fc-receptors FcγRIIA and FcγRI at a multiplicity of infection of 4 for 14 hr before metabolic labeling. Proteins were …
-
Figure 1—source data 1
Relates to Figure 1D bar graph.
- https://cdn.elifesciences.org/articles/63877/elife-63877-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Immunoblot detection of human cytomegalovirus (HCMV) glycoproteins in the supernatant of Hek293T producer cells.
Soluble constructs of gp34 or gp34mtrp (sgp34 and sgp34mtrp, both streptavidin-tagged) or gp68 (gp68s, 6xHis-tagged) lacking a transmembrane domain and cytosolic tail were recombinant expressed in …
Figure 1—figure supplement 2
Fcγ-binding deficient mutant of gp34.
(A) Schematic depiction of soluble gp34 of AD169 (sgp34) with indicated signal peptide (small gray box) and Ig-like domain (large gray box), O-glycosylation sites (gray dots), N-glycosylation sites …
Figure 2 with 1 supplement
gp34 and gp68 synergistically antagonize FcγR activation.
(A) MRC-5 or human foreskin fibroblasts (HFF) cells were infected with human cytomegalovirus (HCMV) AD169 mutant viruses lacking different combinations of vFcγRs (Multiplicity of Infection [MOI] = 3,…
Figure 2—figure supplement 1
Schematic depiction of the experimental setup of a cell-based FcγR activation assay.
Infected or antigen-transfected cells are opsonized using virus-specific or antigen-specific antibody preparations. BW5147 reporter cells stably expressing chimeric human FcγR receptor ectodomains …
Figure 3 with 2 supplements
Native gp34 efficiently internalizes immune complexes.
(A) Sequence alignment of human cytomegalovirus (HCMV) AD169 BAC-2 encoded glycoproteins gp34 (RL11, P16809) and gp68 (UL119-118, P16739). Cellular localization motifs are highlighted in green. (B) …
-
Figure 3—source data 1
Relates to Figure 3D bar graph.
- https://cdn.elifesciences.org/articles/63877/elife-63877-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Alignment of selected herpesvirus glycoproteins present on the surface of an infected cell.
Green = localization signal. Human cytomegalovirus (HCMV) gp34 (RL11, P16809), gp68 (UL119-118, P16739), gB (UL55, P06473), gp95 (RL12, P16810), and gpRL13 (RL13, Q6SWC9). HSV-1 gE (US8, P04488). …
Figure 3—figure supplement 2
Internalization of CD20/Rtx immune complexes and non-immune IgG in dependence of vFcγR expression.
Internalization kinetics was measured by loss of surface signal over time in a pulse-chase approach detecting residual surface complexes via a PE-conjugated mouse-anti-human-IgG antibody. 293 T …
Figure 4 with 1 supplement
gp68 blocks binding of human FcγRIII to immune complexes.
(A) 293 T-CD20 cells were transfected with indicated constructs encoded on a pIRES_eGFP vector. CD99 served as a non-Fcγ-binding control. Gating strategy and CD20 expression in dependence of vFcγR …
-
Figure 4—source data 1
Relates to Figure 4C bar graph.
- https://cdn.elifesciences.org/articles/63877/elife-63877-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
gp68 is not able to block FcγRI binding to IC.
Hek293T cells stably expressing CD20 and opsonized with Rtx were assayed for FcγRI ectodomain binding in the presence or absence of gp68-CD4 as described in Figure 4. Error bars = SD. Three …
-
Figure 4—figure supplement 1—source data 1
Relates to Figure 4—figure supplement 1 bar graph.
- https://cdn.elifesciences.org/articles/63877/elife-63877-fig4-figsupp1-data1-v2.xlsx
Figure 5 with 2 supplements
Human cytomegalovirus (HCMV) gp68, but not gp34 blocks binding of human FcγRIII to opsonized HCMV-infected cells.
MRC-5 cells were infected with mutant HCMV Ad169 viruses lacking different vFcγR encoding genes at MOI = 2 and measured 72dpi via flow cytometry. ΔΔΔ = ΔRL11/ΔRL12/ΔUL119-118. ΔUL119 = ΔUL119-118. (A…
-
Figure 5—source data 1
Relates to Figure 5D bar graph.
- https://cdn.elifesciences.org/articles/63877/elife-63877-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Gp68, but not gp34, binds IgG simultaneously to FcγRIII.
(A) Schematic of the experimental setup. As in Figure 4, using HER-2-specific Herceptin (Hc) replacing Rtx. Human cytomegalovirus (HCMV) vFcγRs gp34 or gp68 were transiently expressed by 293 T cells …
Figure 5—figure supplement 2
Human cytomegalovirus (HCMV) gp68 reduces binding of human FcγRII ectodomains to opsonized-infected cells.
MRC-5 cells were infected with mutant HCMV AD169 pBAC2-derived viruses lacking different vFcγR encoding genes at MOI = 2 and measured 72dpi via flow cytometry. ΔΔΔ = ΔRL11/ΔRL12/ΔUL119-118. ΔUL119 = …
Figure 6 with 1 supplement
gp34 and gp68 synergistically antagonize.
FcγRIIIA in the absence and presence of non-immune IgG and show cooperativity. (A) Increased membrane-residence enhances antagonistic potential of gp68 and reduces antagonistic potential of gp34. …
-
Figure 6—source data 1
Relates to Figure 6B bar graph.
- https://cdn.elifesciences.org/articles/63877/elife-63877-fig6-data1-v2.xlsx
-
Figure 6—source data 2
Relates to Figure 6C bar graph.
- https://cdn.elifesciences.org/articles/63877/elife-63877-fig6-data2-v2.xlsx
-
Figure 6—source data 3
Relates to Figure 6D bar graph.
- https://cdn.elifesciences.org/articles/63877/elife-63877-fig6-data3-v2.xlsx
Figure 6—figure supplement 1
Human cytomegalovirus (HCMV) gH surface expression on HCMV-infected cells.
MRC-5 cells were infected using a vFcγR-deleted (ddd) AD169 BAC-2 derived mutant virus (MOI = 2) and gH surface expression was detected at 72hpi using MSL-109 (humanized anti-HCMV gH, 10 µg/ml) and …
Figure 7
Graphical summary.
NK cells elicit a powerful antibody-mediated antiviral response through antibody-dependent cellular cytotoxicity (ADCC). gp68 (ochroid) binds IgG in a 2:1 ratio reducing, but not abolishing …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (HCMV) | UL119-118 | This paper | MN900952.1 | |
| Gene (HCMV) | RL11 | This paper | MN900952.1 | |
| Gene (Homo sapiens) | CD4 | This paper | BT019791.1 | |
| Gene (HSV-1) | US8 | This paper | MN136524.1 | |
| Gene (HSV-1) | US7 | This paper | MN136524.1 | |
| Strain, strain background E. coli | NEB5-alpha | NEB | C2987 | Made chemically competent for cloning via CaCl2 |
| Strain, strain background (HCMV) | AD169-BAC2 | doi:10.1016/j.celrep.2020 | MN900952.1 | |
| Genetic reagent Mus musculus | BW5147 FcγR-reporter cells | doi:10.1016/j.jim.2012.09.006 | ||
| Genetic reagent (H. sapiens) | Hek-CD20 | Kindly provided by Irvin Chen, UCLA | Lentiviral transduction | |
| Genetic reagent (H. sapiens) | BJ-Her2 | This paper | Lentiviral transduction as in doi:10.1128/JVI.01923-10 | |
| Cell line (H. sapiens) | Hela | ATCC | CCL-2 | |
| Cell line (H. sapiens) | MRC-5 | ECACC | 05090501 | |
| Cell line (H. sapiens) | HFF Human foreskin fibroblasts | Kindly provided by Dieter Neumann-Haefelin and Valeria Kapper-Falcone, Institute of Virology, Freiburg, Freiburg, Germany | HF-99/7 | |
| Cell line (H. sapiens) | BJ-5ta | ATCC | CRL-4001 | |
| Cell line (H. sapiens) | 293T-CD20 | Kindly provided by Irvin Chen, UCLA, USA | ||
| Cell line (M. musculus) | BW5147 | Kindly provided by Ofer Mandelboim, Hadassah Hospital, Jerusalem, Israel | FcR-expressing cell lines as in Corrales-Aguilar et al., 2013 | |
| Cell line (H. sapiens) | PBMC | Primary human cells | Primary cells isolated from human donors | |
| Transfected construct (H. sapiens) | Her2/Erbb2 | gBlock by IDT | NM_004448 | Construct to generate stably expressing BJ cells |
| Transfected construct (H. sapiens) | gp68 | gBlock by IDT | UL119-118 of MN900952.1 | Cloning via added flanking Nhe1 and BamH1 restriction sites |
| Transfected construct (H. sapiens) | gp34 | gBlock by IDT | RL11 of MN900952.1 | Cloning via added flanking Nhe1 and BamH1 restriction sites |
| Transfected construct (H. sapiens) | gE | gBlock by IDT | US8 of MN136524.1 | Cloning via added flanking Nhe1 and BamH1 restriction sites |
| Transfected construct (H. sapiens) | gI | gBlock by IDT | US7 of MN136524.1 | Cloning via added flanking Nhe1 and BamH1 restriction sites |
| Transfected construct (H. sapiens) | gp68-CD4 | gBlock by IDT | UL119-118 of MN900952.1 fused to human CD4 TM and cytosolic tail BT019791.1 | Cloning via added flanking Nhe1 and BamH1 restriction sites |
| Transfected construct (H. sapiens) | gp34-CD4 | gBlock by IDT | RL11 of MN900952.1 fused to human CD4 TM and cytosolic tail BT019791.1 | Cloning via added flanking Nhe1 and BamH1 restriction sites |
| Transfected construct (H. sapiens) | gE-CD4 | gBlock by IDT | US8 of MN136524.1 fused to human CD4 TM and cytosolic tail BT019791.1 | Cloning via added flanking Nhe1 and BamH1 restriction sites |
| Antibody | Cytotect Human plasma pool polyclonal | Biotest | Titration as indicated in this study, 1:100 in flow cytometry | |
| Antibody | αCD107a-APC mouse monoclonal | BD FastImmune | Clone H4A3 | 1:50 in flow cytometry |
| Antibody | αCD56-BV650 mouse monoclonal | Biolegend | Clone 5.1H11 | 1:50 in flow cytometry |
| Antibody | αCD3-FITC mouse monoclonal | Biolegend | Clone UCHT1 | 1:50 in flow cytometry |
| Antibody | αhuman-IgG-PE mouse monoclonal | BD | 1:100 in flow cytometry | |
| Antibody | αHis-PE mouse monoclonal | Miltenyi Biotec | 1:100 in flow cytometry | |
| Peptide, recombinant protein | Human Fcγ-TexasRed | Rockland | Human IgG-Fc fragment | |
| Antibody | Rituximab Humanized monoclonal | Roche, University Hospital Freiburg Pharmacy | Titration as indicated in this study, 1:100 in flow cytometry | |
| Antibody | Herceptin Humanized monoclonal | Roche, University Hospital Freiburg Pharmacy | Titration as indicated in this study | |
| Antibody | αCD20-PE mouse monoclonal | Miltenyi Biotec | 1:100 in flow cytometry | |
| Antibody | αhuman IgG-FITC Polyclonal rabbit | ThermoFisher | 1:100 in flow cytometry | |
| Antibody | THE Anti-His-HRP mouse monoclonal | Genscript | 0.5 µg/ml in ELISA | |
| Antibody | MSL-109 Humanized monoclonal | Absolute antibody | 10 µg/ml in flow cytometry | |
| Antibody | B12 Humanized monoclonal | Kindly provided by Ann Hessell, Scripps USA | 1 µg/ml in precipitation | |
| Antibody | B12 LALA Humanized monoclonal | Kindly provided by Ann Hessell, Scripps USA | 1 µg/ml in precipitation | |
| Recombinant DNA reagent | pIRES-eGFP | Addgene | ||
| Recombinant DNA reagent | pSLFRTKn | doi:10.1128/jvi.76.17.8596-8608 | ||
| Sequence-based reagent | KL-DeltaTRL11-Kana1 | This paper | PCR primer | ACGACGAAGAGGACGAGGACGACAACGTCTGATAAGGAAGGCGAGAACGTGTTTTGCACCCCAGTGAATTCGAGCTCGGTAC |
| Sequence-based reagent | KL-DeltaTRL11-Kana2 | This paper | PCR primer | TGTATACGCCGTATGCCTGTACGTGAGATGGTGAGGTCTTCGGCAGGCGACACGCATCTTGACCATGATTACGCCAAGCTCC |
| Sequence-based reagent | KL-DeltaTRL12-Kana1 | This paper | PCR primer | CGGACGGACCTAGATACGGAACCTTTGTTGTTGACGGTGGACGGGGATTTACAGTAAAAGCCAGTGAATTCGAGCTCGGTAC |
| Sequence-based reagent | KL-DeltaTRL12-Kana2 | This paper | PCR primer | CCTTACAGAATGTTTTAGTTTATTGTTCAGCTTCATAAGATGTCTGCCCGGAAACGTAGCGACCATGATTACGCCAAGCTCC |
| Sequence-based reagent | KL-DeltaUL119-Kana1 | This paper | PCR primer | TTGTTTATTTTGTTGGCAGGTTGGCGGGGGAGGAAAAGGGGTTGAACAGAAAGGTAGGTGCCAGTGAATTCGAGCTCGGTAC |
| Sequence-based reagent | KL-DeltaUL119-Kana2 | This paper | PCR primer | AGGTGACGCGACCTCCTGCCACATATAGCTCGTCCACACGCCGTCTCGTCACACGGCAACGACCATGATTACGCCAAGCTCC |
| Peptide, recombinant protein | sgp68-V5/His | This paper | Ectodomain of UL119-118 from MN900952.1 | V5/His6-tagged. Produced in 293T cells |
| Peptide, recombinant protein | sgp34-V5/His | This paper | Ectodomain of RL11 from MN900952.1 | V5/His6-tagged. Produced in 293T cells |
| Peptide, recombinant protein | sgp34mtrp-V5/His | This paper | Ectodomain of RL11 mtrp mutant from MN900952.1 | V5/His6-tagged. Produced in 293T cells |
| Peptide, recombinant protein | sgp68-strep | This paper | Ectodomain of UL119-118 from MN900952.1 | Streptavidin-tagged. Produced in 293T cells |
| Peptide, recombinant protein | sgp34-strep | This paper | Ectodomain of RL11 from MN900952.1 | Streptavidin-tagged. Produced in 293T cells |
| Peptide, recombinant protein | sgp34mtrp-strep | This paper | Ectodomain of RL11 mtrp mutant from MN900952.1 | Streptavidin-tagged. Produced in 293T cells |
| Peptide, recombinant protein | CD16-Avi/His | Sino Biological | Soluble recombinant FcγRIIIA | Avi/His-tagged 5 µg/ml in flow cytometry |
| Peptide, recombinant protein | CD32A-Avi/His | Sino Biological | Soluble recombinant FcγRIIA | Avi/His-tagged 5 µg/ml in flow cytometry |
| Peptide, recombinant protein | CD32B-Avi/His | Sino Biological | Soluble recombinant FcγRIIB | Avi/His-tagged 5 µg/ml in flow cytometry |
| Peptide, recombinant protein | CD64-Avi/His | Sino Biological | Soluble recombinant FcγRI | Avi/His-tagged 5 µg/ml in flow cytometry |
| Peptide, recombinant protein | wtFc | Kindly provided by Pamela Bjorkman, Caltech USA doi:10.1128/JVI.01476-07 | ||
| Peptide, recombinant protein | nbFc | Kindly provided by Pamela Bjorkman, Caltech USA doi:10.1128/JVI.01476-07 | ||
| Commercial assay or kit | Pierce F(ab')2 Preparation Kit | ThermoFisher | ||
| Commercial assay or kit | Easytag Express | Perkin Elmer | ||
| Software, algorithm | Prism | GraphPad | ||
| Software, algorithm | FlowJo | BD |
