Dentate gyrus development requires a cortical hem-derived astrocytic scaffold
- Laboratory of Stem Cell Biology and Developmental Genetics, The Francis Crick Institute, United Kingdom
Figures
Figure 1 with 5 supplements
Dentate gyrus (DG) morphogenesis is differentially affected in Sox1Cre versus Sox9fl/fl;Nestin-Cre mutants.
(A) H and E staining of 3-month-old (i-iii) and P2 (iv-vi) brain sections of Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Nestin-Cre mutants compared to Sox9fl/+ controls. DG (outlined) appears smaller in Sox9fl/fl;Sox1Cre/+ mutants compared to both controls and Sox9fl/fl;Nestin-Cre mutants. (B–C) Quantification of DG surface as pixel area, in 3-month-old mice. (B) DG is significantly smaller in Sox9fl/fl;Sox1Cre/+ mutants (33758 ± 5898) compared to controls (55651 ± 4492, t test p=0.0069) and Sox9fl/fl;Nestin-Cre mutants (62994 ± 3243, statistical analysis for Nestin-Cre mutants is not possible as n < 3). The defect is already visible in P2 pups (C), when DG area is significantly smaller in Sox9fl/fl;Sox1Cre/+ mutants (137101 ± 29892) compared to controls (200651 ± 5683, p=0.026), but not compared to Sox9fl/fl;Nestin-Cre (171772 ± 13866, Tukey’s multiple comparison test p=0.1672, ANOVA p=0.033). (D) Schematic of novel object recognition test (NORT) protocol. Pink and green circles represent familiar and new objects, respectively. (E) Quantification of exploration times spent by mice over the identical left and right object on day 2 (red boxes) and on the new object on day 3 (green boxes). Sox9fl/+;Sox1+/+ control mice (n = 13) spend significantly more time exploring the new object on day 3 (67.55 ± 13.16%) compared to time spend exploring the identical object on day 2 (left object: 49.83 ± 22.65%, t test p=0.0294; right object: 50.17 ± 22.65%, t test p=0.0391), indicating that they remember the objects from day 2. Sox9fl/fl;Sox1Cre/+ mutants (n = 11) instead do not remember the objects from day 2, because the time spent exploring the new object on day 3 (53.59 ± 19.70%) is not different from the time spent exploring objects on day 2, either on the left (43.37 ± 16.65%, t test p=0.2009) or right side (56.63 ± 16.65%, t test p=0.6839). (F–H) Immunofluorescence for YFP and SOX9 comparing, respectively, expression of R26ReYFP reporter of Cre activity and SOX9 expression patterns in Sox9fl/fl;Sox1Cre/+, Sox9fl/fl;Nestin-Cre mutants and controls, during forebrain (F) and archicortex (G) development. SOX9 remains expressed in Nestin-Cre mutants in both the CH and DNE (white asterisks in F). Yellow dashed square in (F) indicate area shown in (G) at higher magnification, also schematized in (H) together with Sox1Cre and Nestin-Cre recombination pattern in the ARK at E13.5. Signal from SOX9 immunofluorescence in Sox9 mutant tissue was confirmed to be background with ISH for Sox9 (Figure S.5). LV: lateral ventricle; DT: dorsal telencephalon; ARK: archicortex; CH; cortical hem; DNE: dentate neuroepithelium; VZ: ventricular zone; HNE: hippocampal neuroepithelium; 1ry: primary matrix; 2ry: secondary matrix; 3ry: tertiary matrix. Scale bar represent 400 µm in (Ai-iii); 200 µm in (Aiv-vi) and (F); 50 µm in (G).
-
Figure 1—source data 1
Quantification of dentate gyrus (DG) size in adults and P2 pups and analysis of memory formation ability during NORT behavioral test.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Histological analysis of CA regions in Sox9fl/fl;Sox1Cre/+ adult mice.
H and E staining of Sox9fl/fl;Sox1Cre/+ (ii, iv, vi, viii) and control (i, iii, v, vii) adult hippocampi for general morphological analysis of hippocampal CA regions. While CA2, and mostly CA3, in Sox9 mutants (vi, viii) appear less compacted than in controls (v, vii), DG is the most affected region. CA: cornus ammonis; DG: dentate gyrus. Scale bar represent 400 µm in (i–ii); 100 µm in (iii-viii).
Figure 1—figure supplement 2
Histological analysis Sox9fl/+;Sox1Cre/+ adult mice adult dentate gyrus (DG).
(A,B) H and E staining (A) and quantification (B) of Sox9fl/+;Sox1Cre/+ adult DG (n = 1, Aii), compared to Sox9fl/fl;Sox1Cre/+, Sox9fl/fl;Nestin-Cre and control mice (as previously shown in Figure 1A and B). Scale bar represent 400 µm.
-
Figure 1—figure supplement 2—source data 1
Quantification of dentate gyrus (DG) size in Sox9fl/+;Sox1Cre/+ adult mouse.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig1-figsupp2-data1-v2.xlsx
Figure 1—figure supplement 3
Sox9fl/fl;Sox1Cre/+ adults do not show anxiety-like behavior in open-field test.
(A) Schematic of arena subdivision between center (gray) and borders (pink) used for open-field test, performed to analyze anxiety-like behaviors. (B,C) Quantification of borders and center of arena exploration time as cumulative seconds (B) and average time represented with heatmaps (C). We found no difference between Sox9fl/+;Sox1+/+ and Sox9fl/fl;Sox1Cre/+ mutant mice, both in time spent in the borders (231.72 ± 8.78 s and 235.93 ± 14.38 s, t-test p=0.2829) and in the center (52.59 ± 9.01 s and 48.40 ± 14.25 s, t-test p=0.2864) of the arena. Therefore, Sox9fl/fl;Sox1Cre/+ mutant mice do not display anxiety-like behavior in this test.
-
Figure 1—figure supplement 3—source data 1
Analysis of anxiety behavior with open-field test.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig1-figsupp3-data1-v2.xlsx
Figure 1—figure supplement 4
Absence of SOX9 expression in a 3-month-old Sox9fl/fl;Nestin-Cre mutant brain.
(A) Immunofluorescence for SOX9 was performed to confirm absence of SOX9 expression in the brain of adult Sox9fl/fl;Nestin-Cre mutants (ii, iv) compared to controls (i, iii). LV: lateral ventricle; CC: corpus callosum. Scale bars represent 100 µm.
Figure 1—figure supplement 5
Qualitative and quantitative analyses of Sox9 transcripts confirm residual Sox9 expression in embryonic Sox9fl/fl;Nestin-Cre forebrains.
(A) ISH for Sox9 on Sox9fl/+ (i,iv,vii), Sox9fl/fl;Nestin-Cre (ii,v,viii) and Sox9fl/fl;Sox1Cre/+(iii,vi,ix) forebrains at E11.5 (i,ii,iii), E12.5 (iv,v,vi) and E13.5 (vii,viii,ix). Analysis of Sox9 expression confirms ventral to dorsal activity of Nestin-Cre as Sox9 is still expressed in the DT at E11.5 in Sox9fl/fl;Nestin-Cre mutants, (iii) and in the most ventral part of the ARK at E12.5 and E13.5 (arrows in vi, ix). Some rare cells still express Sox9 in the archicortex of Sox9fl/fl;Sox1Cre/+ mutants (arrow in v, viii). (B) Quantification of Sox9 expression via qPCR from dissected DT and ARK of controls, Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Nestin-Cre E12.5 embryos. Sox9 expression is drastically reduced in both DT and ARK of Sox9fl/fl;Sox1Cre/+ compared to controls (Sox9 fold change in DT: 0.006 ± 0.008, p<0.0001; and ARK: 0.027 ± 0.014, p<0.0001 Tukey’s multiple comparison test; ANOVA p<0.0001). Sox9 expression was also significantly reduced in Sox9fl/fl;Nestin-Cre mutants compared to controls (Sox9 fold change in DT: 0.204 ± 0.08, p=0.0002; and ARK: 0.234 ± 0.147, p=0.0017 Tukey’s multiple comparison test; ANOVA p=0.0005). Sox9 tended to be present at higher levels in Sox9fl/fl;Nestin-Cre compared to Sox9fl/fl;Sox1Cre/+, which may reflect differences in Cre activities; however, this was not statistically significant. LV: lateral ventricle; DT: dorsal telencephalon; ARK: archicortex. Scale bars represent 200 µm.
-
Figure 1—figure supplement 5—source data 1
Quantification of Sox9 expression with qPCR in E12.5 DT and ARK separately.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig1-figsupp5-data1-v2.xlsx
Figure 2 with 3 supplements
Granule neuron progenitors are generated normally but their distribution in SOX9 mutant developing DG is abnormal.
(A–K) Immunofluorescence for PAX6 (A) TBR2 (F) and PROX1 (I) were performed at indicated developmental (E14.5: Ai, ii; E16.5: Aiii, iv; E18.5: Fi-iii and Ii-iii) and postnatal stages (P2: Fiv-vi and Iiv-vi) of DG development. Arrows in Fii-iii,v-vi and Iv-vi point to respectively TBR2+ and PROX1+ cells accumulating close to the ventricle (yellow dashed line). 1ry, 2ry, and 3ry matrices are delineated with white dashed lines. Localization within the developing DG of each cell type analyzed is schematized for PAX6 at E14.5 (B) and E16.5 (C), for TBR2 at E18.5 and P2 (H) and PROX1 for E18.5 and P2 (K), where color intensity in the illustration reflects level of markers expression. (D) shows experimental analysis, total cell number indicate sum of cells in 1ry, 2ry, and 3ry matrix. Quantification of total PAX6+ cells (E), TBR2+ cells (G) and PROX1+ cells (J) is shown at the indicated developmental and postnatal stages. Total cell number analysis shows a reduced number of TBR2+ cells at P2 (G) in Sox9fl/fl;Sox1Cre/+ mutants (2020.31 ± 267.74; Tukey’s multiple comparison test p=0.01190, ANOVA p=0.014) compared to controls (2792 ± 331.72). The same tendency was observed for TBR2+ cells in P2 Sox9fl/fl;Nestin-Cre mutants (G) (2249.75 ± 195.18), and for PROX1+ cells (J) in both Sox9 mutants at P2 (Sox9fl/fl;Sox1Cre: 2225.50 ± 299.24 and Sox9fl/fl;Nestin-Cre: 2538.75 ± 340.30) compared to controls (2895.33 ± 367.51). (L, M) Analysis of PAX6+, TBR2+, and PROX1+ cells distribution along the three matrices, according to the corresponding above schematics where dashed lines indicate areas considered for 1ry, 2ry, and 3ry matrix quantification (also shown in A, F, Iiv-vi). At E14.5 and E16.5 (L), the same amount of PAX6+ cells are found in the 1ry and 2ry matrix in Sox9fl/fl;Sox1Cre/+ mutants compared to controls. At E18.5 (Mi), more TBR2+ cells were found in the 2ry matrix of Sox9fl/fl;Nestin-Cre mutants (276.53 ± 18.96) compared to both Sox9fl/fl;Sox1Cre/+ mutants (207.33 ± 39.85, p=0.03660) and controls (180.07 ± 1.79, Tukey’s multiple comparison test p=0.00850, ANOVA p=0.0090), while less TBR2+ cells were found in the 3ry matrix of both Sox9fl/fl;Sox1Cre/+ mutants (66.93 ± 7.90, p=0.0016) and Sox9fl/fl;Nestin-Cre mutants (84.00 ± 8.50, p=0.0075) compared to controls (132.53 ± 18.29, Tukey’s multiple comparison test, ANOVA p=0.0017). At P2 (Mii) more TBR2+ cells are found in 1ry matrix of Sox9fl/fl;Sox1Cre/+ mutants (79.47+14.59), compared to controls (36.47 ± 9.87, p=0.0101) and Sox9fl/fl;Nestin-Cre mutants (48.13 ± 10.35, Tukey’s multiple comparison test p=0.0399, ANOVA p=0.0106). In Sox9fl/fl;Nestin-Cre mutants, more TBR2+ cells are accumulating in the 2ry matrix (184.07 ± 8.47) compared to Sox9fl/fl;Sox1Cre/+ mutants (127.87 ± 22.72, Tukey’s multiple comparison test p=0.0175, ANOVA p=0.0183). In both Sox9 mutants, less TBR2+ cells are found in the 3ry matrix (Sox9fl/fl;Sox1Cre/+: 201.00 ± 59.44, p=0.0119; Sox9fl/fl;Nestin-Cre: 233.73 ± 27.81, p=0.029) compared to controls (378.93 ± 57.88, Tukey’s multiple comparison test, ANOVA p=0.0109). At P2, PROX1+ cells (Miii) accumulate in the 1ry matrix of Sox9fl/fl;Sox1Cre/+ mutants, (111.00 ± 39.89) compared to controls (17.67 ± 14.15, Tukey’s multiple comparison test p=0.0088, ANOVA p=0.0100), and a significant decrease in the 3ry matrix of both Sox9fl/fl;Sox1Cre/+ mutants (1786.67 ± 266.25, p=0.0117) and Sox9fl/fl;Nestin-Cre mutants (1991.33±260.48, p=0.0329) is observed compared to controls (2758.33 ± 297.16, Tukey’s multiple comparison test, ANOVA p=0.0112). (N) Analysis of the distribution of PROX1+ granule neurons distribution within the upper and lower blade of the forming DG at E18.5: the 3ry matrix was divided in 10 horizonal ventral to dorsal bins spanning the lower to upper blade domain. Cells were then counted within each bin. The percentage of PROX1+ cells present in each bin is represented. In Sox9fl/fl;Sox1Cre/+ mutants, PROX1+ cells are accumulating in the lower blade (18.40 ± 2.29%) compared to controls (13.57 ± 1.29%, p=0.0187), and are reduced in the upper blade (8.57 ± 0.58%) compared to controls (13.13 ± 0.55%, Tukey’s multiple comparison test p=0.0071, Two-way ANOVA interaction p=0.0387, row factor p<0.0001, column factor p=0.9991). A similar tendency was observed in Sox9fl/fl;Nestin-Cre mutants; however, it did not reached statistical significance. DG: dentate gyrus; DNE: dentate neuroepithelium; CH: cortical hem. Scale bar represent 50 µm in (Ai-ii) 100 µm in (Aiii-iv), (F) and (Ii-iii); 200 µm in (Iiv-vi).
-
Figure 2—source data 1
Quantification of total PAX6, TBR2, and PROX1-expressing cells at E18.5 and P2 and their distribution along 1ry, 2ry, and 3ry matrices and/or within the forming dentate gyrus (DG).
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Initial emergence of intermediate progenitors (IPs) and differentiating granule neurons is not affected by Sox9 deletion.
(A) Immunostaining for TBR2 (Ai-ii) and PROX1 (Aiii-iv) on E14.5 and E16.5 controls and Sox9fl/fl;Sox1Cre/+ mutant embryos, respectively. (B–C) Quantification shows that the total number of TBR2+ IPs (B) and PROX1+ differentiating granule neurons (C) is similar in Sox9fl/fl;Sox1Cre/+ mutants and controls. DNE: dentate neuroepithelium. Scale bars represent 50 µm in (Ai-ii); 100 µm in (Aiii-iv).
-
Figure 2—figure supplement 1—source data 1
Quantification of total number of TBR2+ cells at E14.5 and PROX1+ cells at E16.5.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig2-figsupp1-data1-v2.xlsx
Figure 2—figure supplement 2
Sox9 deletion is not associated with increased cell death in the developing dentate gyrus (DG).
(A) Immunofluorescence for cleaved Caspase-3 at consecutive stages of DG development (E16.5: i, ii; E18.5: iii, iv; P2: v, vi) in Sox9fl/fl;Sox1Cre/+ mutants compared to controls (arrowheads indicates cleaved Caspase-3+ cells). (B) Quantification of cleaved Caspase-3+ cells in 1ry and 2ry matrix of P2 pups shows that a similar number of apoptotic cells are present in Sox9fl/fl;Sox1Cre/+ mutants compared to controls. DNE: dentate neuroepithelium. Scale bars represent 100 µm.
-
Figure 2—figure supplement 2—source data 1
Quantification of Cleaved-Caspase+ cells in 1ry and 2ry matrix od P2 pups.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig2-figsupp2-data1-v2.xlsx
Figure 2—figure supplement 3
Sox9 deletion does not alter rate of neural progenitor proliferation, emergence, or differentiation toward a granule neuron fate.
(A–C) Analysis of proliferation in early dentate gyrus (DG) progenitors. (A) Double immunostaining for PAX6 and Ki67 on E14.5 (i–ii) and E16.5 (iii-iv) control and Sox9fl/fl;Sox1Cre/+ mutant embryos. No difference was found in PAX6+ progenitor proliferation either in the total population, shown as % PAX6+Ki67+ on total PAX6+ cells (B), as well as analyzing 1ry and 2ry matrices separately (C). The regions considered for 1ry and 2ry matrix are indicated by the white dotted lines in (A). (D–G) DG progenitors EdU birth-dating experiment. (D) Double staining for TBR2 and EdU on P2 control, Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Nestin-Cre mutant brains. Arrows indicate accumulation of cells close to the ventricle in Sox9 mutants. (E) Experimental protocol: EdU was injected at E18.5, samples harvested at P2 and immunostained for TBR2 and EdU. (F) TBR2+ progenitor emergence, quantified as the percentage of TBR2+EdU+/TBR2, was not affected by Sox9 deletion. (G) Distribution of newly generated TBR2+EdU+ progenitor along the three matrices (as delineated in Di). A significant accumulation of TBR2+EdU+ newly formed progenitors was observed in the 1ry matrix of Sox9fl/fl;Sox1Cre/+ mutants (26.87 ± 5.12) compared to controls (9.20 ± 4.30, p=0.0169), while Sox9fl/fl;Nestin-Cre mutants were not affected (15.93 ± 6.60, Tukey’s multiple comparison test, ANOVA p=0.0197). (H–J) Granule neurons EdU birth-dating experiment. (H) Double staining for PROX1 and EdU on E18.5 control, Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Nestin-Cre mutant embryos. (I) EdU was injected at E16.5, which corresponds to the first stage when this cell type appears in the developing DG, and samples harvested at E18.5. (J) The proportion of PROX1+EdU+/PROX1+ newly formed granule neurons is unchanged between controls and both Sox9 mutants, indicating that Sox9 deletion is not affecting granule neuron differentiation. DNE: dentate neuroepithelium; CH: cortical hem; 1ry: primary matrix; 2ry: secondary matrix; 3ry: tertiary matrix. Scale bars represent 50 µm in (Ai-ii); 100 µm in (Aiii-iv), (D) and (H).
-
Figure 2—figure supplement 3—source data 1
Analysis of proliferation in PAX6, TBR2, and PROX1-expressing cells during dentate gyrus (DG) development.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig2-figsupp3-data1-v2.xlsx
Figure 3 with 1 supplement
Ectopic accumulation of neuronal progenitors close to the ventricle suggests migratory defects in Sox9 mutant dentate gyrus (DG).
(A) Triple immunostaining for TBR2, SOX2, and EdU at P2 control, Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Nestin-Cre brains. EdU was injected at E18.5. Insets show higher magnification of cells in ectopic cluster (schematized in B), magnified area is indicated by the white arrow. Yellow and pink arrowheads indicate TBR2+EdU+ and SOX2+EdU+ cells in the ectopic cluster, respectively. (B) Illustration showing location of ectopic cluster within the developing DG. (C–D) Immunofluorescences for the differentiation markers PROX1 (C) and NeuroD1 (D) in Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Nestin-Cre mutants compared to controls at P2 (C) and E18.5 (D), respectively. Both markers are expressed by cells within the ectopic cluster (arrows) in Sox9 mutants. (E) Quantification of ectopic cluster size at E18.5 and P2 in Sox9fl/fl;Sox1Cre/+ compared to Sox9fl/fl;Nestin-Cre mutants. The percentage of TBR2+ progenitors in ectopic cluster relative to total number of TBR2+ progenitors in 2ry matrix is represented. At E18 (i), the ectopic cluster size was comparable between Sox9fl/fl;Sox1Cre/+ (34.11 ± 2.35%) and Sox9fl/fl;Nestin-Cre mutants (28.41 ± 3.10%). It then significantly decreases in Sox9fl/fl;Nestin-Cre mutants at P2 compared to E18.5 (17.87 ± 3.41%, t test p=0.0172) and Sox9fl/fl;Sox1Cre/+ at the same stage (36.73 ± 5.30%, t test p=0.0061). In agreement with the smaller ectopic matrix size at P2, less newly formed TBR2+EdU+ progenitors (ii) were found in the ectopic cluster of Sox9fl/fl;Nestin-Cre mutants (18.90 ± 3.53%) compared to Sox9fl/fl;Sox1Cre/+ (40.13 ± 6.97%, t test p=0.0084). (F) Schematic of in utero electroporation protocol. (G) Immunostaining for PROX1 and dsRed live fluorescence. Double-positive cells from the dashed yellow square are shown at higher magnification in the inset. (H) The total number of dsRed+ cells was significantly smaller in Sox9fl/fl;Sox1Cre/+ mutants (153.60 ± 33.72) compared to controls (583.40 ± 243.76, p=0.0045 t test). (I) The proportion of dsRed+ on total PROX1+ cells was not significantly reduced in Sox9 mutants (16.40 ± 15.11%) compared to controls (33.40 ± 7.27%). (J) Distribution of dsRed+ cells along the three matrices (as schematized in Figure 2M). We observed more dsRed+ cells in the 1ry matrix of Sox9fl/fl;Sox1Cre/+ mutants compared to controls (31.33 ± 7.47% vs. 14.32±7.03%, t test p=0.0105) and less in the 3ry matrix (29.49 ± 11.13% vs. 51.27±14.20%, t test p=0.0287). DNE: dentate neuroepithelium; IUE: in utero electroporation. Scale bars represent 100 µm.
-
Figure 3—source data 1
Quantification of ectopic matrix size at E18.5 and P2 and total number, differentiation, and distribution of dsRed+ cells at P2 upon in utero electroporation at E15.5.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
In utero electroporation does not compromise cell survival in the developing dentate gyrus of Sox9 mutants.
(A) Immunostaining for cleaved Caspase-3 in P2 Sox9fl/fl;Sox1Cre/+ (ii,iii) pups and controls (i) after IUE at E15.5, comparing ipsi- (i,ii) and contralateral (iii) hemispheres to the injection, showing that cell death is not increased in Sox9 mutants after IUE. Insets showing higher magnification of Cleaved Caspase-3 expressing cells in ectopic cluster. IUE: in utero electroporation; DNE: dentate neuroepithelium; ipsi: ipsilateral to injection; contra: contralateral to injection. Scale bars represent 100 µm.
Figure 4 with 1 supplement
Delay in formation of the glial scaffold in Sox9 mutants may explain progenitor migration defects.
(A–C) Analysis of glial scaffold formation. (A) Immunofluorescence for GFAP on E18.5 (Ai-iii) and P2 (Aiv-vi) control, Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Nestin-Cre brains showing GFAP reduction in both mutants at E18.5. Dashed line delineates the developing dentate gyrus (DG) area, yellow dashed squares indicate areas magnified in insets. (B) Representation of the glial scaffold (red lines) in DG. (C) GFAP immunofluorescence quantification (pixel area). At E18.5, GFAP expression was significantly reduced in Sox9fl/fl;Sox1Cre mutants (4745.17 ± 2609.79) compared to controls (22069.97 ± 9082.47, p=0.01120), while not in Sox9fl/fl;Nestin-Cre mutants (9803.93 ± 6141.10, Tukey’s multiple comparison test p=0.06090, ANOVA p=0.0121). At P2, GFAP expression is recovered in both Sox9 mutants compared to controls. (D–F) 3D reconstruction of control E18.5 embryos double immunostained for TBR2 and GFAP, (E) Representative control 10x single-plane confocal images of sections processed for 3D reconstruction (schematized in D; yellow dashed squares indicate processed regions shown in F). (F) Snapshots from 3D reconstruction show that the fimbrial scaffold and 1ry matrix progenitors are initially separated (a). 2ry matrix migrating progenitors then start to intermingle with GFAP+ fibers as the scaffold elongates from the fimbria (b,c). 3ry matrix progenitors are also distributed within the supragranular scaffold within the developing DG (d). Movies of all 3D reconstructions are available in the supplementary material (Videos 1–4). DNE: dentate neuroepithelium. Scale bars represent 200 µm.
-
Figure 4—source data 1
Quantification of GFAP expression at E18.5 and P2.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Migratory clues secreted by Cajal-Retzius cells and required during dentate gyrus (DG) development are not affected in Sox9 mutants.
(A) Analysis by qPCR of the expression of secreted chemokines Reln, Cxcl12, and their receptors Vldlr, Cxcr4. mRNA was extracted from E12.5 dissected archicortices of Sox9fl/fl;Sox1Cre/+, Sox9fl/fl;Nestin-Cre and control embryos. No significant difference was found in any of the genes analyzed in both Sox9 mutants compared to controls. (B) Immunofluorescence for REELIN on E18.5 Sox9fl/fl;Sox1Cre/+, Sox9fl/fl;Nestin-Cre and control embryos. The expression pattern and intensity of REELIN staining appeared unaffected in both Sox9 mutants compared to controls. Scale bars represent 100 µm.
-
Figure 4—figure supplement 1—source data 1
Quantification of Cxcr4, Vlvdr, Cxcl12, and Reeln expression with qPCR in E12.5 dissected ARK.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig4-figsupp1-data1-v2.xlsx
Figure 5 with 1 supplement
Emergence of astrocytic progenitor in the CH is affected in Sox9 mutants according to levels of Cre activity in this region.
(A) Double immunostaining for ALDH1L1 and GFAP in Sox9fl/+ embryos at E18.5 (i), E16.5 (ii), and E13.5 (iii). ALDH1L1 and GFAP are co-expressed at E18.5 (i) in the fimbria (b insets on the right) but not around the forming dentate gyrus (DG; a insets on the right). Earlier, at E16.5 (ii), ALDH1L1, but not GFAP, is expressed in a similar pattern, in the fimbria and in a few cells around the forming DG (arrow in Aii), and as early as E13.5 in the archicortex (arrow in Aiii). (B, C) Double immunostainings for SOX2;LEF1 (i), SOX2;ALDH1L1 (ii) at E13.5. SOX2 and LEF1 mutually exclusive expression patterns delineate the LEF1-SOX2high CH and LEF1+SOX2low DNE (schematized in B). ALDH1L1+ cells are exclusively located in the SOX2high CH. Double immunostaining for GLAST;LEF1 (iii) and BLBP;SOX2 (iv) show a similar pattern of expression of the two astrocytic markers GLAST and BLBP in the LEF1-;SOX2low CH, further suggesting ALDH1L1+ cells astrocytic nature. (D–E) Immunostaining (D) and quantification (F) of ALDH1L1+ cells in Sox9 mutants at E13.5 (i-iii) and E16.5 (iv-vi) compared to controls. White arrows in Fv indicate rare ALDH1L1+ cells found in Sox9fl/fl;Sox1Cre mutants. The number of ALDH1L1+ cells was significantly reduced in Sox9fl/fl;Sox1Cre mutants compared to controls, both at E13.5 (4.43 ± 3.93 vs. 14.14 ± 4.58, p=0.0193) and E16.5 (15.58 ± 1.62 vs. 39.54 ± 7.27, p=0.0338), while it was unaffected in Sox9fl/fl;Nestin-Cre mutants (E13.5: 11.00 ± 2.29, p=0.5373, E16.5: 43.73 ± 13.00, p=0.8288, Tukey’s multiple comparison test, ANOVA p=0.0242 and p=0.0147). (F) Analysis of Aldh1l1 expression levels by qPCR from dissected DT and ARK of E12.5 Sox9fl/fl;Sox1Cre, Sox9fl/fl;Nestin-Cre and control embryos. Aldh1l1 expression was significantly reduced in the ARK of Sox9fl/fl;Sox1Cre compared to both controls (p=0.0028) and Sox9fl/fl;Nestin-Cre mutants (p=0.0047, Tukey’s multiple comparison test, ANOVA p=0.0021). (G,H) Triple immunostaining for YFP, SOX9 and ALDH1L1 at E13.5 (i,ii,v,vi) and E16.5 (ii,iv,vii,viii) in Sox9fl/fl;Sox1Cre and Sox9fl/fl;Nestin-Cre mutants. A few double-positive SOX9;ALDH1L1 cells are detected in the CH of both Sox9 mutants (white arrows, schematized in H). More of these are present in Sox9fl/fl;Nestin-Cre compared to Sox9fl/fl;Sox1Cre/+ mutants due differential Cre activity as shown by the R26ReYFP reporter expression. LV: lateral ventricle; DNE: dentate neuroepithelium; CH: cortical hem; DT: dorsal telencephalon; ARK: archicortex; HNE: hippocampal neuroepithelium; VZ: ventricular zone. Scale bars represent 200 µm in (Aiii), 100 µm in (Ai,ii), and 50 µm in (C), (D), and (G).
-
Figure 5—source data 1
Quantification of ALDH1L1+ cells at E13.5 and E16.5 and of Aldh1l1 expression with qPCR in E12.5 DT and ARK separately.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Early CNS-specific deletion of Sox9 does not affect NF1A/B expression in the forebrain.
(A) Immunofluorescence for NF1A (i,ii) or NF1B (iii,iv) on E12.5 Sox9fl/fl;Sox1Cre/+ (ii, iv) and control (i,iii) embryos. Levels of expression appear similar in both DT and ARK in Sox9 mutants compared to controls. (B) Quantification of Nfia/b expression levels by qPCR on dissected E12.5 Sox9fl/fl;Sox1Cre/+ and control dorsal telencephalons and archicortices. There is no significant difference in Nfia/b levels in Sox9 mutants compared to controls. LV: lateral ventricle; DT: dorsal telencephalon; ARK: archicortex. Scale bar represent 200 µm in (Ai-ii) and 100 µm in (Aiii-iv).
-
Figure 5—figure supplement 1—source data 1
Quantification of Nfia and Nfib expression with qPCR in E12.5 DT and ARK separately.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig5-figsupp1-data1-v2.xlsx
Figure 6 with 1 supplement
CH-specific deletion of Sox9 using Wnt3airesCre compromises glial scaffold formation exclusively within the fimbria.
(A,B) Analysis of Wnt3airesCre recombination pattern in the archicortex. (A) Double immunofluorescence for YFP with LEF1 (i-iii), ALDH1L1 (iv-vi) and BLBP (vii-ix) in Wnt3airesCre/+;R26ReYFP embryos at E12.5 (i-iii) and E13.5 (iv-ix). Insets are magnified areas from yellow dashed boxes. Cre recombination is mostly observed in the LEF1- CH, however a few YFP+ cells are seen in the LEF1+ DNE (i-iii; arrowheads in magnified inset). ALDH1L1+;BLBP+ astrocytic progenitors express YFP in Wnt3airesCre//+;R26ReYFP embryos (iv-xi; arrowheads in magnified inset), also confirming their CH origin. (B) Double immunofluorescences for PROX1;YFP (Bi-iii) and GFAP;YFP (iv,ix) in P2 Wnt3airesCre/+;R26ReYFP embryos. Insets are magnified areas from yellow dashed boxes. Cells that have undergone Cre recombination are mostly GFAP+ and PROX1-, in agreement with a CHspecific recombination pattern (A). Arrowheads in Bi-iii and insets indicate some rare YFP+PROX1+ cells in the DG representing 6.45 ± 1.00% of PROX1+ cells. Arrows and arrowheads in Biv,ix and insets indicates respectively YFP-GFAP+ and YFP+GFAP+ fibers in the DNE/fimbria (Biv-vi) and around the DG (Bvii-ix), indicating the GFAP+ glial scaffold around the DG only partially originates from the CH. (C,D) Immunostainings and quantification for YFP (Ci,ii); SOX9 (Ciii,iv); ALDH1L1 (Cv,vi) at E13.5 and GFAP at E18.5 in Sox9fl/fl;Wnt3airesCre/+;R26ReYFP mutant compared to controls. In E13.5 archicortices of Sox9fl/fl;Wnt3airesCre/+ mutant and control embryos the CH specific deletion of SOX9 is confirmed. The number of ALDH1L1+ cells is significantly reduced (D) in Sox9fl/fl;Wnt3airesCre/+ mutants (6.95 ± 2.56) compared to controls (14.14 ± 4.58, t-test p=0.022). At E18.5, the GFAP+ glial scaffold is affected exclusively within the fimbria (star in Cviii) and not around the DG (arrowheads in Cvii-viii). (E, F) Quantification of GFAP immunofluorescence as pixel area in the FS and SGS separately, based on morphology from DAPI as shown in (F). GFAP expression is significantly lower in the FS of both Sox9fl/fl;Sox1Cre (3357.78 ± 1101.38, p=0.0029) and Sox9fl/fl;Wnt3airesCre/+ (8783.77 ± 898.29, p=0.043) mutants compared to controls (26114.39 ± 10208.45) but not in Sox9fl/fl;Nestin-Cre mutants (11304.45 ± 5919.25, Sidak multiple comparison test, Two-way ANOVA interaction p=0.0027). Conversely, GFAP expression in the SGS is significantly lower in Sox9fl/fl;Sox1Cre (10166.42 ± 4443.82, p=0.0377) and Sox9fl/fl;Nestin-Cre mutants (9096.35 ± 1545.00, p=0.0249) compared to controls (26560.38 ± 9242.99) but not in Sox9fl/fl;Wnt3airesCre/+ mutants (41270.70 ± 18028.47; Sidak multiple comparison test, Two-way ANOVA interaction p=0.0027). CH: cortical hem; DNE: dentate neuroepithelium; DG: dentate gyrus; FS: fimbrial scaffold; SGS: supragranular scaffold. Scale bars represent 100 µm in (Ai-iii) and (Cvii-viii); 50 µm in (Aiv-ix), (B), (Ci-vi).
-
Figure 6—source data 1
Analysis of ALDH1L1+ cells at E13.5 and GFAP expression at E18.5 in Sox9fl/fl;Wnt3airesCre/+ mutants compared to controls.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Lineage-tracing analysis of CH-derived cells in Wnt3airesCre/+;R26ReYFP pups.
(A,B) Immunofluorescence for YFP and the Cajal-Retzius cell marker REELIN (A) or the oligodendrocyte precursor cells (OPCs) marker PDGFRa (B) on P2 Wnt3airesCre/+;R26ReYFP brains. YFP+ cells express REELIN both around the DG (Ai-iv) and in the outer layer of the cortex (Av-viii) (indicated by white arrows). Conversely, YFP is not expressed in PDGFRa+ cells, either around the DG (Bi-iv) or within the fimbria (Bv-viii) (indicated by white arrows). This suggests that Cajal-Retzius cells originate from the cortical hem, while OPCs do not. DG: dentate gyrus. Scale bar represent 50 µm.
Figure 7 with 1 supplement
CH-specific deletion of Sox9 using Wnt3airesCre specifically affects granule neuron progenitor migration along the 1ry-to-3ry matrix axis.
(A–D) Analysis of PROX1+ differentiating granule neurons in E18.5 Sox9fl/fl;Wnt3airesCre/+ dentate gyrus (DG). (A) Immunostaining for PROX1 on E18.5 controls and Sox9fl/fl;Wnt3airesCre/+ brains. The total number of PROX1+ cells (B) and their distribution within the forming DG (C, see Figure 3N for analysis settings) was not affected in Sox9fl/fl;Wnt3airesCre/+ mutants compared to controls. (D) Percentage of PROX1+ granule neurons positioned in the DG lower blade (bins 1–5), versus the DG upper blade (bins 6–10) in E18.5 controls, Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Nestin-Cre mutants (results from Figure 2N), and Sox9fl/fl;Wnt3airesCre/+ mutants (results from C). In contrast with Sox9fl/fl;Sox1Cre/+ (bins 1–5: 63.53 ± 1.85%, bins 6–10: 36.43 ± 1.70%, p=<0.0001) and Sox9fl/fl;Nestin-Cre mutants (bins 1– 5: 60.10 ± 7.47%, bins 6–10: 39.87 ± 7.43%, p=0.0002), PROX1+ granule neurons distribution in Sox9fl/fl;Wnt3airesCre/+ mutants (bins 1–5: 54.60 ± 3.26%, bins 6–10: 45.35 ± 3.30%) is similar to controls (bins 1–5: 54.00 ± 2.61%, bins 6–10: 46.03 ± 2.60%; Sidak multiple comparison test, Two-way ANOVA interaction p=0.0044). (E–H) Analysis of TBR2+ intermediate progenitors at E18.5 in Sox9fl/fl;Wnt3airesCre/+ DG via immunofluorescence (E). The total number of TBR2+ cells is unchanged (F) but their distribution along the three matrices (G) is affected as there were more cells in the 2ry matrix of Sox9fl/fl;Wnt3airesCre/+ mutants (228.60 ± 5.37) compared to controls (180.07 ± 1.79, p=0.0001, t test). Arrow indicates accumulation of TBR2+ cells in the ectopic cluster in Sox9fl/fl;Wnt3airesCre/+ mutants. (H) Percentage of TBR2+ in ectopic cluster. The percentage of TBR2+ cells in the ectopic cluster is comparable to that observed Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Nestin-Cre mutants (calculated as % of TBR2+ progenitors in ectopic cluster relative to total number of TBR2 progenitors in 2ry matrix). (J) Immunofluorescence for NeuroD1 showing ectopic differentiation toward granule neuron cell fate in the ectopic cluster of Sox9fl/fl;Wnt3airesCre/+ mutants (arrow). (K) Triple immunostaining for SOX9, YFP, and GFAP on E18.5 controls and Sox9fl/fl;Wnt3airesCre/+ brains showing YFP- cells accumulating next to the SOX9+ DNE in E18.5 Sox9fl/fl;Wnt3airesCre/+;R26ReYFP mutants (delineated by yellow dashed line) and underlaid by a defective GFAP scaffold. DNE: dentate neuroepithelium. Scale bars represent 50 µm in (K); 100 µm in (A), (E), and (J).
-
Figure 7—source data 1
Quantification of total number and distribution of TBR2 and PROX1-expressing cells and ectopic matrix size during dentate gyrus (DG) development in Sox9fl/fl;Wnt3airesCre/+ mutants compared to controls.
- https://cdn.elifesciences.org/articles/63904/elife-63904-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Histological analysis of Sox9fl/fl;Wnt3airesCre/+ E18.5 developing DG.
H and E staining on cryosections from E18.5 control (i), Sox9fl/fl;Sox1Cre/+ (ii), Sox9fl/fl;Nestin-Cre (iii) and Sox9fl/fl;Wnt3airesCre/+ (iv) for a general morphological analysis of the developing DG. Yellow dashed line indicates formation of the ectopic cluster next to the DNE, which is here visible only in Sox9fl/fl;Sox1Cre/+ and Sox9fl/fl;Wnt3airesCre/+ mutants. In Sox9fl/fl;Nestin-Cre mutants, the ectopic cluster is not visible due to reduced resolution of the H and E staining. DG: dentate gyrus; DNE: dentate neuroepithelium. Scale bar represent 200 µm.
Figure 8
Model for the dual origin and function of the dentate gyrus (DG) glial scaffold based on the analysis of defects following differential deletion of Sox9.
(A–D) Schematic of mouse models used for Sox9 conditional deletion and analysis of DG development. The pattern of Cre recombination is represented in the archicortex at E13.5 (green area) and the corresponding phenotype observed at E18.5/P2. Stars indicate local absence of the GFAP+ glial scaffold. (E) Figure legend. (F) Model of DG development based on defects observed following differential deletion of Sox9. At early stages of DG development (E13.5), granule neuron progenitors undergo delamination from the 1ry matrix and form the 2ry matrix (migration direction depicted by arrow 1). This initial step is hypothesized to be independent of the glial scaffold because it is not affected in its absence in Sox9 mutants. From E18.5, progenitor migration toward the forming DG/3ry matrix relies on the fimbrial scaffold (red lines, arrow 2). This fimbrial scaffold derives from astrocytic progenitors located in the CH (red area). At the same time, the dentate scaffold around the DG (blue lines) provides support for granule neuron positioning within upper and lower blades of the forming DG (arrows 3). Cells giving rise to this second scaffold are DNE derived (blue area). CH: cortical hem; DNE: dentate neuroepithelium; HNE: hippocampal neuroepithelium; VZ: ventricular zone; DT: dorsal telencephalon; ARK: archicortex.
Videos
Video 1
Movie of 3D reconstruction of progenitors at the primary matrix level.
GFAP+ fimbrial scaffold (red) and 1ry matrix TBR2+ progenitors (in green) are initially separated.
Video 2
Movie of 3D reconstruction of migrating progenitors at the secondary matrix level.
TBR2+ migrating progenitors (green) in the 2ry matrix start to intermingle with GFAP+ fibers (red).
Video 3
Movie of 3D reconstruction of migrating progenitors as the secondary matrix elongates.
Intermingling of TBR+ migrating progenitors (green) and GFAP+ fibers (red) in the distal part of the 2ry matrix.
Video 4
Movie of 3D reconstruction of migrating progenitors at the tertiary matrix level.
Distribution of TBR2+ progenitors (green) within the GFAP+ supragranular scaffold (red).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | Sox9fl/fl | Akiyama et al., 2002 | Sox9tm2Crm MGI: 2429649 | Conditional targeted mutation |
| Genetic reagent (M. musculus) | Sox1Cre/+ | Takashima et al., 2007 | Sox1tm1(cre)Take MGI: 3807952 | Targeted mutation |
| Genetic reagent (M. musculus) | Nestin-Cre | Tronche et al., 1999 | (no gene)Tg(Nescre)1Kln MGI: 2176173 | Transgenic insertion |
| Genetic reagent (M. musculus) | Wnt3airesCre | Yoshida et al., 2006 - | Wnt3atm1.1(cre)Mull MGI: 98956 | Targeted mutation |
| Genetic reagent (M. musculus) | R26ReYFP | Srinivas et al., 2001 | Gt(ROSA)26Sortm1(EYFP)Cos MGI: 2449038 | Targeted mutation |
| Antibody | Anti- ALDH1L1 (rabbit polyclonal) | Abcam | Cat# ab87117, RRID: AB_10712968 | IF (1:500) |
| Antibody | Anti-BLBP (rabbit polyclonal) | Millipore | Cat# ABN14, RRID: AB_10000325 | IF (1:200) |
| Antibody | Anti-Caspase (rabbit polyclonal) | R and D system | Cat# AF835, RRID: AB_2243952 | IF (1:400) |
| Antibody | Anti-GFAP-Cy3 (mouse monoclonal) | Sigma | Cat# C9205, RRID: AB_476889 | IF (1:500) |
| Antibody | Anti-GLAST (guinea pig polyclonal) | Millipore | Cat# AB1782, RRID: AB_90959 | IF (1:200) |
| Antibody | Anti-LEF1 (rabbit polyclonal) | Cell Signalling | Cat# 2230, RRID: AB_823558 | IF (1:200) |
| Antibody | Anti-NF1A (rabbit polyclonal) | Active Motif | Cat# 39397, RRID: AB_2314931 | IF (1:500) |
| Antibody | Anti-NF1B (rabbit polyclonal) | Abcam | Cat# ab186738, RRID: AB_2782951 | IF (1:200) |
| Antibody | Anti-PAX6 (rabbit polyclonal) | Covance | Cat# PRB-278P, RRID: AB_291612 | IF (1:300) |
| Antibody | Anti-PROX1 (rabbit polyclonal) | BioLegend | Cat# PRB-238C, RRID: AB_291595 | IF (1:500) |
| Antibody | Anti-REELIN (mouse monoclonal) | Abcam | Cat# ab78540, RRID: AB_1603148 | IF (1:200) |
| Antibody | Anti-SOX2 (goat polyclonal) | Neuromics | Cat# GT15098, RRID: AB_2195800 | IF (1:500) |
| Antibody | Anti-SOX9 (goat polyclonal) | R and D system | Cat# AF3075, RRID: AB_2194160 | IF (1:200) |
| Antibody | Anti-TBR2 (rabbit polyclonal) | Abcam | Cat# ab23345, RRID: AB_778267 | IF (1:500) |
| Antibody | Anti-GFP (rat monoclonal) | Fine chemical products | Cat# 04404–84, RRID: AB_10013361 | IF (1:1000) |
| Recombinant DNA reagent | pCAG-hyPBase (plasmid) | Mikuni et al., 2016 | Plasmids for in utero electroporation (1 µg/µl) | |
| Recombinant DNA reagent | pPB-CAG-DsRed (plasmid) | Mikuni et al., 2016 | Plasmids for in utero electroporation (1 µg/µl) | |
| Software, algorithm | Ethovision XT | Noldus | RRID:SCR_000441 | |
| Software, algorithm | Distance.gui | This paper | Source code file provided (see Source Code File 1) |
Table 1
List of primary antibodies used.
Antigen retrieval protocol (30 min in 65°C water bath or 15 min in 95°C decloaking chamber) was performed for the indicated samples (e: embryos; p: pups).
| Antigen | Host | Dilution | Vendor | Catalog # | 65°C | 95°C |
|---|---|---|---|---|---|---|
| ALDH1L1 | Rabbit | 1:500 | Abcam | ab87117 | e | |
| BLBP | Rabbit | 1:200 | Millipore | ABN14 | ||
| Caspase | Rabbit | 1:400 | R and D system | AF835 | ||
| GFAP-Cy3 | Mouse | 1:500 | Sigma | C9205 | ||
| GLAST | Guinea pig | 1:200 | Millipore | AB1782 | ||
| LEF1 | Rabbit | 1:200 | Cell Signalling | 2230P | e | |
| NF1A | Rabbit | 1:500 | Active Motif | 39397 | e | |
| NF1B | Rabbit | 1:200 | Abcam | ab186738 | e | |
| PAX6 | Rabbit | 1:300 | Covance | PRB-278P | e | |
| PROX1 | Rabbit | 1:500 | BioLegend | PRB-238C | e, p | |
| REELIN | Mouse | 1:200 | Abcam | ab78540 | e | |
| SOX2 | Goat | 1:500 | Neuromics | GT15098 | e | p |
| SOX9 | Goat | 1:200 | R and D system | AF3075 | e | |
| TBR2 | Rabbit | 1:500 | Abcam | ab23345 | e, p | |
| YFP | Rat | 1:1000 | Fine chemical products | 04404–84 |
Table 2
List of secondary antibodies and nuclear staining used.
| Fluorophore | Host/reactivity species | Dilution | Vendor | Catalog# |
|---|---|---|---|---|
| Alexa 568 | Donkey anti-Rabbit | 1:500 | Thermo Fisher Scientific | A10042 |
| Alexa 647 | Donkey anti-Rabbit | 1:500 | Thermo Fisher Scientific | A31573 |
| Alexa 568 | Donkey anti-Goat | 1:500 | Thermo Fisher Scientific | A11057 |
| Alexa 647 | Donkey anti-Goat | 1:500 | Thermo Fisher Scientific | A21447 |
| Alexa 594 | Donkey anti-Mouse | 1:500 | Thermo Fisher Scientific | A21203 |
| Alexa 555 | Donkey anti-Mouse | 1:500 | Thermo Fisher Scientific | A31570 |
| Alexa 488 | Donkey anti-Rat | 1:500 | Thermo Fisher Scientific | A21208 |
| DAPI 300 μM | 1:500 | Thermo Fisher Scientific | D1306 |
Table 3
List of primers used for qPCR.
| Target | Forward primer (5’- … −3’) | Reverse primer (5’- … −3’) | Supplier and Catalog # |
|---|---|---|---|
| Gapdh | TTCACCACCATGGAGAAGGC | CCCTTTTGGCTCCACCCT | Eurofins |
| Sox9 | AAGAAAGACCACCCCGATTACA | CAGCGCCTTGAAGATAGCATT | Eurofins |
| Nf1a | CTTTGTACATGCAGCAGGAC | TTCCTGCAGCTATTGGTGTTT | Eurofins |
| Nf1b | GTGGAACCGGTGAATCTTTC | TCTGTCCTGGGCTCTATTCC | Eurofins |
| Aldh1l1 | N/A | N/A | Qiagen PPM27706B-200 |
| Cxcr4 | N/A | N/A | Qiagen PPM03149E-200 |
| Cxcl12 | TGCATCAGTGACGGTAAACCA | TTCTTCAGCCGTGCAACAATC | Eurofins |
| Reln | TTACTCGCACCTTGCTGAAAT | CAGTTGCTGGTAGGAGTCAAAG | Eurofins |
| Vldlr | GGCAGCAGGCAATGCAATG | GGGCTCGTCACTCCAGTCT | Eurofins |
Additional files
-
Source code 1
The Distance.gui software was used to analyse cell distribution as detailed in the Materials and method section.
It was written by Dr. Vivien Labat-gest and kindly donated by Prof. Federico Luzzati.
- https://cdn.elifesciences.org/articles/63904/elife-63904-code1-v2.zip
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/63904/elife-63904-transrepform-v2.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Dentate gyrus development requires a cortical hem-derived astrocytic scaffold
eLife 10:e63904.
https://doi.org/10.7554/eLife.63904
