1. Evolutionary Biology
  2. Microbiology and Infectious Disease
Download icon

Globally defining the effects of mutations in a picornavirus capsid

  1. Florian Mattenberger
  2. Victor Latorre
  3. Omer Tirosh
  4. Adi Stern
  5. Ron Geller  Is a corresponding author
  1. Institute for Integrative Systems Biology, I2SysBio (Universitat de València-CSIC), Spain
  2. The Shmunis School of Biomedicine and Cancer Research, Tel-Aviv University, Israel
Research Article
Cite this article as: eLife 2021;10:e64256 doi: 10.7554/eLife.64256
5 figures, 2 tables and 9 additional files

Figures

Figure 1 with 2 supplements
Deep mutational scanning (DMS) of the CVB3 capsid.

(A) Overview of the deep mutational scanning experimental approach. A mutagenesis PCR was used to introduce all possible single amino acid mutations across the CVB3 capsid region (Mut Library 1–3). Viral genomic RNA (vRNA) produced from the mutant libraries was then electroporated into cells to generate high diversity CVB3 populations (Mut Virus 1–3). The frequency of each mutation relative to the WT amino acid was then determined in both the mutagenized libraries and the resulting virus populations via high-fidelity duplex sequencing. (B) The average rate of double or triple mutations per codon observed in the mutagenized libraries (Mut Library 1–3), the resulting mutagenized virus (Mut Virus 1–3), as well as controls for the error rate of the amplification and sequencing process (PCR and RT-PCR) or the WT unmutagenized virus (WT Virus 1–2). Single mutations per codon were omitted from the analysis to increase the signal-to-noise ratio. (C) Venn diagram showing the number of amino acid mutations observed in the mutagenized libraries. MOI: multiplicity of infection. NGS: next-generation sequencing.

Figure 1—figure supplement 1
Sanger analysis of DMS libraries.

(A) The number of mutated codons per clone. (B) Original and mutated base for each mutation. (C) The number of nucleotide changes per codon. (D) Cumulative fraction of mutations versus the codon position. (E) Location of both mutations and indels across the capsid sequence.

Figure 1—figure supplement 2
Results of high-fidelity duplex sequencing.

(A) The relative frequency of the mutated base within each mutated codon. (B) The relative frequency of each mutation type.

Figure 2 with 1 supplement
Mutational fitness effects (MFE) across the CVB3 capsid and their correlation with structural, evolutionary, and immunological attributes.

(A) Overview of the MFE observed across the CVB3 capsid. Bottom: A heatmap representing the MFE of all mutations observed at each capsid site. Green indicates no data available (ND), and the positions of the mature viral proteins (VP1–4) or antibody neutralization sites (nAb) are indicated above. Top: A 21 amino acid sliding window analysis of the average sequence variation in enterovirus B genomes (Shannon entropy; black line) or a 21 amino acid sliding window of the average MFE observed at each capsid site (red line). (B) Correlation between the average MFE observed at each capsid site and variation in enterovirus B sequence alignments (Shannon entropy). (C) Violin plot of MFE in antibody neutralization sites versus other capsid sites. (D–F) Boxplots of MFE as a function of secondary structure (D), position in the capsid (E), or the predicted effect of mutations on stability or aggregation propensity (F). (G) Validation of the MFE obtained by DMS using a competition assay. For each mutant, the average and standard deviation of the MFE obtained by DMS (n = 3) is plotted against the average and standard deviation of the fitness derived using the competition assay (n = 4). A two-sided Mann–Whitney test was used for two- category comparisons.

Figure 2—figure supplement 1
Correlation of amino acid preferences observed in experimental replicates.

Hexagonal bin plots showing the correlation of amino acid preferences between the three experimental replicates. Spearman’s correlation coefficient and p-value are shown above each plot.

Figure 3 with 1 supplement
Prediction of MFE based on structural and sequence information.

(A) The top 10 predictors identified in a random forest model for explaining MFE in the CVB3 capsid based on the percent of mean squared error (MSE) increase. (B) Hexagonal plot showing the correlation between MFE predicted using a random forest algorithm trained on the top five variables versus observed MFE. The random forest model was trained on 70% of the data and then tested on the remaining 30% (shown). RSA, relative surface area.

Figure 3—figure supplement 1
Prediction of mutational fitness effects using random forest or linear models.

(A) Hexagonal bin plot showing the correlation between actual and predicted MFE derived from a random forest model using all 52 variables. The model was trained on 70% of the data and tested on the remaining 30% of the data (shown). (B) Variable importance was obtained from the random forest model. (C) Linear model using the top five parameters of the random forest model. See supplementary file 6 for parameter description.

Figure 4 with 1 supplement
Antibody neutralization sites show differential selection between laboratory conditions and nature.

(A) Violin plot showing the sum of absolute differential selection observed at capsid sites comprising antibody neutralization epitopes (nAb) versus all other capsid sites. (B–C) Logoplots showing the observed differential selection of sites in the EF loop or BC loop. The WT sequence is indicated in red. (D) The CVB3 capsid pentamer (PDB:4GB3), colored according to the amount of differential selection. The BC and EF loops are shown next to the structure together with the side chains for sites showing the highest differential selection.

Figure 4—figure supplement 1
Sequence preferences of capsid-encoded motifs.

(A) Amino acid preferences of the CVB3 myristoylation motif. The canonical Prosite myristoylation motif is indicated above, with curly brackets indicating disfavored amino acids and square brackets indicating tolerated amino acids. (B) WCPRP motif required for 3CDpro cleavage of P1. Asterisks indicate analogous positions in FMDV shown to be essential for viability (Kristensen and Belsham, 2019).

Figure 5 with 1 supplement
Sequence preference of capsid 3CDpro cleavage sites and their use for the identification of novel cellular targets of the viral protease.

(A) Overview of the CVB3 capsid maturation pathway. The CVB3 capsid precursor P1 is co-translationally cleaved by the viral 2A protease. P1 is then myristoylated and cleaved by the viral 3CDpro to generate the capsid proteins VP0, VP3, and VP1. Finally, upon assembly and genome encapsidation, VP0 is further cleaved into VP4 and VP2 in a protease-independent manner to generate the mature capsid. Red and black asterisks indicated 3CDpro or protease-independent cleavage events, respectively. (B,C) Logoplots showing amino acid preferences for the 10 amino acid regions spanning the 3CDpro cleavage sites (P1–P’1) of both VP0/VP3 and VP3/VP1 in the DMS dataset. (D) Overview of the bioinformatic pipeline for identification of novel 3CDpro cellular targets using the amino acid preferences for the capsid cleavage sites from our DMS study. A position-specific scoring matrix (PSSM) was generated based on the amino acid preferences for the 10 amino acid regions spanning the two 3CDpro cleavages sites. This PSSM was then used to query the human genome for potential cellular targets, and non-cytoplasmic proteins were filtered out, yielding 746 proteins. (E) The cellular proteins PLSCR1, PLEKHA4, and WDR33 are cleaved by 3CDpro. Western blot analysis of cells cotransfected with 3CDpro and GFP-PLSCR1 or GFP-PLEKHA4 and probed with a GFP antibody or transfected with 3CDpro and probed using a WDR33 antibody. When indicated, the 3CDpro inhibitor rupintrivir was included to ensure cleavage was mediated by the viral protease. Red arrows indicate cleavage products of the expected size (GFP-PLSCR1 full length = 64 kDa, cleaved N-terminus = 36 kDa; GFP-PLEKHA4 full length = 118 kDa, cleaved N-terminus = 72 kDa; WDR33 full length = 146 kDa, cleaved N-terminus = 72 kDa). *p<0.05, ***p<0.001.

Figure 5—figure supplement 1
Evaluation of select hits identified as potential 3CDpro target proteins.

Western blots of cells transfected with 3CDpro and probed for the indicated endogenous protein or cotransfected with 3CDpro and the indicated fusion protein and blotted for the tag. Each experiment was performed twice. When indicated, the 3Cpro inhibitor rupintrivir was added.

Tables

Table 1
Incorporation of DMS results in evolutionary models better describes natural CVB3 evolution compared to standard codon models.
ModelΔAICLog-likelihoodParametersParameter
values
ExpCM0.00−14,580.516Beta = 2.18, kappa = 7.47, omega = 0.16
Goldman-Yang M54187.56−16,668.2912Alpha_omega = 0.30, beta_omega = 10.00, kappa = 7.15
Averaged ExpCM4303.74−16,732.386Beta = 0.61, kappa = 7.55, omega = 0.02
Goldman-Yang M04371.26−16,761.1411Kappa = 7.14, omega = 0.02
Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Strain, strain background (coxsackievirus B3)pCVB3-XhoI-P1-Kpn2110.1016/j.celrep.2019.09.014Infectious CVB3 clone based on the Nancy strain (Taxon identifier 103903)
Strain, strain background (coxsackievirus B3)pCVB3-XhoI-∆P1-Kpn21This paperInfectious CVB3 clone without P1 region
Strain, strain background (coxsackievirus B3)Marked reference CVB3 virus10.1038/nmicrobiol.2017.88Infectious CVB3 clone with silent mutations in the polymerase region used as a reference for fitness assays
Strain, strain background (Escherichia coli)NZY5αNZY TechMB004Competent cells, standard cloning
Strain, strain background (Escherichia coli)MegaX DH10B T1R Electrocomp cellsThermoFisherC6400-03Electrocompetent cells, library cloning
Cell line (Homo sapiens)HeLa-H1ATCCCRL-1958; RRID:CVCL_3334Cell line for CVB3 infection and DMS library production
Cell line (Homo sapiens)HEK293ATCCCRL-1573; RRID:CVCL_0045Cell line used for production of CVB3 mutants and for protease cleavage
AntibodyAnti-GFP (Mouse monoclonal)SantaCruzSc-9996Western blot (1:2000)
AntibodyAnti-FLAG (Mouse monoclonal)SantaCruzSc-166335Western blot (1:2000)
AntibodyAnti-HA (Mouse monoclonal)SantaCruzSc-7392Western blot (1:2000)
AntibodyAnti-WDR33 (Mouse monoclonal)SantaCruzSc-374466Western blot (1:1000)
AntibodyAnti-TSG101 (Mouse monoclonal)SantaCruzSc-136111Western blot
(1:1000)
AntibodyAnti-GAK (Mouse monoclonal)SantaCruzSc-137053Western blot (1:1000)
AntibodyAnti-MAGED1 (Mouse monoclonal)SantaCruzSc-393291Western blot (1:1000)
Recombinant DNA reagentDMS libraries (1–3)This paperCVB3 infectious clone libraries with mutagenized capsid region
Recombinant DNA reagentpUC19-HiFi-P1 (plasmid)This paperCVB3 capsid region used as template for DMS cloned into SalI digested pUC19 vector. Used for site-directed mutagenesis
Recombinant DNA reagentT7 encoding plasmid (plasmid)10.1128/jvi.02583–14RRID:Addgene_65974Plasmid encoding T7 polymerase for transfection
Recombinant DNA reagentpIRES-3CDpro (plasmid)This paperCVB3 3 CD protease region cloned into XhoI and NotI pIRES plasmid (Clonetech)
Recombinant DNA reagentpeGFP_PLEKHA410.1016/j.celrep.2019.04.060Kind gift from Dr. Jeremy Baskin
GFP-PLEKHA4 expression plasmid
Recombinant DNA reagentpeGFP_PLSCR110.1371/journal.pone.0005006Kind gift from Dr. Serfe Benichou
GFP-PLSCR1 expression plasmid
Recombinant DNA reagentpAcGFP-C1 WDR33https://doi.org/10.1016/j.molcel.2018.11.036Kind gift from Dr. Matthias Altmeyer pAcGFP-C1 WDR33 expression plasmid
Recombinant DNA reagentFLAG-NLCR5AddgeneRRID:Addgene_37521NLCR5 expression plasmid
Recombinant DNA reagentHA-ZC3HAV1AddgeneRRID:Addgene_45907HA-ZC3HAV1 expression plasmid
Recombinant DNA reagentFluc-eGFPAddgeneRRID:Addgene_90170Fluc-eGFP expression plasmid
Sequence-based reagentHiFi_FIDTPCR primerFor generating PCR to clone libraries and sequencing: CTTTGTTGGGTTTATACCACTTAGCTCGAGAGAGG
Sequence-based reagentHiFi_RIDTPCR primerFor generating PCR to clone libraries and sequencing: CCTGTAGTTCCCCACATACACTGCTCCG
Sequence-based reagentDMS primersIDTPCR primerPrimers spanning the full coding region of the CVB3 capsid to perform codon mutagenesis. Listed in Supplementary file 1.
Sequence-based reagent2045_FIDTPCR primerPrimer used for Sanger sequencing.
TCGAGTGTTTTTAGTCGGACG
Sequence-based reagent2143_RIDTPCR primerPrimer used for Sanger sequencing.
TCGAGTGTTTTTAGTCGGACG
Sequence-based reagent3450_RTIDTPCR primerPrimer used for Sanger sequencing and RT-PCR.
TCGAGTGTTTTTAGTCGGACG
Sequence-based reagentqPCR_F10.1038/nmicrobiol.2017.88PCR primerqPCR primer for competition assays. GATCGCATATGGTGATGATGTGA
Sequence-based reagentqPCR_R10.1038/nmicrobiol.2017.88PCR primerqPCR primer for competition assays. AGCTTCAGCGAGTAAAGATGCA
Sequence-based reagentMGB_CVB3_wt10.1038/nmicrobiol.2017.88TaqManProbeqPCR probe for competition assays. 6FAM-CGCATCGTACCCATGG-TAMRA
Sequence-based reagentMGB_CVB3_Ref10.1038/nmicrobiol.2017.88TaqManProbeqPCR probe for competition assays. HEX-CGCTAGCTACCCATGG-TAMRA
Sequence-based reagentQ8D_FIDTPCR primerPrimer for site-directed mutagenesis: gtatcaacgGATaagactggg
Sequence-based reagentQ8D_RIDTPCR primerPrimer for site-directed mutagenesis: ttgagctcccattttgctgt
Sequence-based reagentK829L_FIDTPCR primerPrimer for site-directed mutagenesis: gagaaggcaCTAaacgtgaac
Sequence-based reagentK829L_RIDTPCR primerPrimer for site-directed mutagenesis: gtattggcagagtctaggtgg
Sequence-based reagentK235D_FIDTPCR primerPrimer for site-directed mutagenesis: gggtccaacGATttggtacag
Sequence-based reagentK235D_RIDTPCR primerPrimer for site-directed mutagenesis: ggatgcgaccggtttgtccgc
Sequence-based reagentR16G_FIDTPCR primerPrimer for site-directed mutagenesis: catgagaccGGActgaatgct
Sequence-based reagentR16G_RIDTPCR primerPrimer for site-directed mutagenesis: tgccccagtcttttgcgttg
Sequence-based reagentK827G_FIDTPCR primerPrimer for site-directed mutagenesis: caatacgagGGGgcaaagaac
Sequence-based reagentK827G_RIDTPCR primerPrimer for site-directed mutagenesis: gcagagtctaggtggtctagg
Sequence-based reagentQ566M_FIDTPCR primerPrimer for site-directed mutagenesis: atttcgcagATGaactttttc
Sequence-based reagentQ566M_RIDTPCR primerPrimer for site-directed mutagenesis: gaaaggagtgtccttcaatag
Sequence-based reagentT315P_FIDTPCR primerPrimer for site-directed mutagenesis: attacggtcCCCatagcccca
Sequence-based reagentT315P_RIDTPCR primerPrimer for site-directed mutagenesis: tgggacgtacgtggtgga
Sequence-based reagentN395H_FIDTPCR primerPrimer for site-directed mutagenesis: gagaaggtcCATtctatggaa
Sequence-based reagentN395H_RIDTPCR primerPrimer for site-directed mutagenesis: tccaacattttggactgggac
Sequence-based reagentT849A_FIDTPCR primerPrimer for site-directed mutagenesis: actacaatgGTCaatacgggc
Sequence-based reagentT849A_RIDTPCR primerPrimer for site-directed mutagenesis: gatgctttgcctagtagtgg
Sequence-based reagentK235D_FIDTPCR primerPrimer for site-directed mutagenesis: gggtccaacGATttggtacag
Sequence-based reagentK235D_RIDTPCR primerPrimer for site-directed mutagenesis: ggatgcgaccggtttgtccgc
Sequence-based reagent3C_ForIDTPCR primerPrimer for cloning CVB3 3 CD into pIRES: TATTCTCGAGACCATGGGCCCTGCCTTTGAGTTCG
Sequence-based reagent3D_RevIDTPCR primerPrimer for cloning CVB3 3 CD into pIRES: TATTGCGGCCGCCTAGAAGGAGTCCAACCATTTCCT
Commercial assay or kitNEBuilder HiFi DNA Assembly kitNEBE2621XSeamless cloning
Commercial assay or kitTranscriptAid T7 High Yield Transcription KitThermoFisher ScientificK0441T7 in vitro transcription kit
Commercial assay or kitQuick-RNA Viral kitZymo ResearchR1035RNA purification
Commercial assay or kitDNA Clean andConcentrator-5Zymo ResearchD4013DNA purification, gel purification
Commercial assay or kitLuna Universal Probe One-Step RT-qPCR kitNEBE3006XOne-step qPCR master mix
Chemical compound, drugRupintivirTocris BiosciencesCat. #: 6414CVB3 3C protease inhibitor
Software, algorithmCodonTilingPrimershttps://doi.org/10.1016/j.chom.2017.05.003Software to design primers for mutagenesis (https://github.com/jbloomlab/CodonTilingPrimers)
Software, algorithmSanger Mutant Library AnalysisDr. Jesse BloomSoftware to assess library mutagenesis by Sanger sequencing (https://github.com/jbloomlab/SangerMutantLibraryAnalysis)
Software, algorithmSamtoolshttp://www.htslib.org/version 1.5Suite of programs for interacting with high-throughput sequencing data
Software, algorithmFastp10.1093/bioinformatics/bty560Software for NGS read trimming and QC
Software, algorithmPicardTools, FastqToSamhttps://broadinstitute.github.io/picard/Version 2.2.4Used to generate Bam files from Fastq files
Software, algorithmDuplex pipelinehttps://github.com/KennedyLabUW/Duplex-SequencingKennedy et al., 2014Version 3.0Analysis pipeline for duplex sequencing (UnifiedConsensusMaker.py)
Software, algorithmVariantBam10.1093/bioinformatics/btw111Software to filter Bam files
Software, algorithmBWAhttps://sourceforge.net/projects/bio-bwa/files/Version 0.7.16Software to align NGS reads
Software, algorithmFgbiohttp://fulcrumgenomics.github.io/fgbio/version 1.1.0Software used to hard-clip NGS reads
Software, algorithmVirVarSeq10.1093/bioinformatics/btu587version 1.1.0Software used to identify codons in each NGS read
Software, algorithmCustom R scriptsThis paperCustom R scripts to process output of VirVarSeq script.
Available athttps://github.com/RGellerLab/CVB3_Capsid_DMS
Software, algorithmDMS_tools210.1186/s12859-015-0590-4Software to determine amino acid preferences and mutational fitness effects
Software, algorithmTANGO10.1038/nbt1012Software to determine the effect of mutations on aggregation
Software, algorithmFoldX10.1093/nar/gki387Software to determine the effect of mutations on stability
Software, algorithmDSSPhttp://swift.cmbi.ru.nl/gv/dssp/Software used to obtain secondary structure and RSA within DMS_tools2
Software, algorithmViprDBhttp://viperdb.scripps.edu/
Carrillo-Tripp et al., 2009
Software used to obtain structural information on capsid sites
Software, algorithmDECIPHER Package10.32614/RJ-2016–025R package for performing codon alignments
Software, algorithmPhyDMSdoi:10.7717/peerj.3657For phylogenetic and differential selection analyses. https://jbloomlab.github.io/phydms/index.html
Software, algorithmCustom R scriptsThis paperCustom R script to generate in silico peptides spanning 10AA 3 CD protease cleavage site.
Available at https://github.com/RGellerLab/CVB3_Capsid_DMS
Software, algorithmPSSMSearch10.1093/nar/gky426Used to generate position-specific scoring matrix and search human proteome for hits. http://slim.icr.ac.uk/pssmsearch/
Software, algorithmPeptides R packageISSN 2073–4859Version 2.4.2R package to predict molecular weight of proteins
Software, algorithmRandomForest R package10.1023/A:1010933404324Version 4.6–16R package for random forest prediction
Software, algorithmLogolas10.1186/s12859-018-2489-3Package to generate logo plots in R

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)